Method for intervening metabolism reprogramming of macrophages and application of method

Abstract

The invention relates to the technical field of biology, in particular to a method for intervening metabolism reprogramming of macrophages and application of the method. The invention provides a method for intervening metabolic reprogramming and inflammatory activation of macrophages, namely, by down-regulating the TRAF2 expression level of the macrophages, influencing the metabolic reprogramming of the macrophages and reducing the activation of an NLRP3 inflammatory small body pathway of the macrophages and the generation of inflammatory cytokines, the acute hepatic failure induced by LPS / D-GalN is relieved. Interference on metabolism reprogramming and inflammatory activation of macrophages based on the method is expected to be applied to intervention of other liver injuries related to macrophage homeostasis imbalance, including liver ischemia reperfusion injury, alcoholic liver injury, metabolic liver injury, autoimmune liver injury, hepatic failure and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for intervening in macrophage metabolic reprogramming to thereby affect the inflammatory activation thereof, and the method's alleviating effect on inflammatory damage to liver tissue. Background Art

[0002] The immune system can both help the body resist the attack of pathogens and prevent reactions to its own components. There is a delicate balance between immune defense and immune tolerance. Once the balance is broken, diseases may follow. As the main immune cell group in the liver, macrophages play a key role in maintaining the homeostasis of liver tissue itself and even the entire body. In the liver, macrophages can be divided into two major categories according to their sources: Kupffer cells (KCs) and monocyte-derived macrophages (MDMs, or mononuclear macrophages). KCs are switches for initiating, promoting and inhibiting immune responses. On the one hand, KCs can produce a variety of inflammatory mediators, such as reactive oxygen, reactive nitrogen, inflammatory cytokines and chemokines, forming an inflammatory environment and causing tissue damage. On the other hand, KCs can also produce immune regulatory molecules such as IL-10, transforming growth factor β (TGF-β), and programmed death protein ligand 1 (PD-L1), thereby playing a negative regulatory role in inflammatory responses. Under normal conditions, the pro-inflammatory and anti-inflammatory effects of KCs are in a dynamic balance. Once the balance is broken, it will cause liver immune disorders. When the liver is threatened by damage, infection, etc., MDMs receive signals from the local microenvironment to promote their functional differentiation and infiltrate the liver in large quantities to stimulate inflammatory responses. In addition, MDMs can also be alternatively activated or transformed through function to inhibit inflammation, promote tissue regeneration and fibrosis. Therefore, there are many molecular mechanisms in the liver to ensure that liver macrophages sensitively recognize liver damage, respond quickly, and coordinate the subsequent pro-inflammatory immune response and the calming of inflammation and the process of damage repair.

[0003] Metabolic reprogramming refers to the process by which cells adapt to environmental changes by changing gene expression and metabolic pathways under specific conditions. Its role in shaping the functional phenotype of macrophages has received increasing attention. Glucose metabolism is a key driver of macrophage inflammatory capacity, which depends on the production of the pentose phosphate pathway (PPP) of NADPH, thereby generating ROS and subsequent oxidative burst. Under normal physiological conditions, the main source of energy for macrophages is glucose oxidative phosphorylation (OXPHOS). Glycolysis is the main metabolic process for activated macrophages to produce energy. Macrophages of different activated forms have obvious differences in the glycolytic pathway. When macrophages are induced by lipopolysaccharides and IFN-γ, their metabolic pathway changes from OXPHOS to glycolytic pathway, promoting the polarization of M1 macrophages. After macrophages are activated, the HIF-1α-mediated Warburg effect occurs. The Warburg effect is a metabolic phenomenon in which glycolysis still dominates even under normoxic conditions. HIF-1α can induce the expression of ALDA, PGK1, PKM, etc., and the high expression of these enzymes promotes the occurrence of glycolysis. Macrophages lacking HIF-1α show a decrease in glycolysis rate and energy production, indicating that HIF-1α affects the polarized phenotype of macrophages by affecting their glycolysis. This suggests that HIF-1α is an important target for intervention in macrophage metabolic reprogramming. In addition, glucose transporter 1 (GLUT1) plays an important role in the uptake of glucose by macrophages. GLUT1 is overexpressed in macrophages after being stimulated by TLRs (Toll-like receptors), which will lead to an increase in ROS (reactive oxygen species) and pro-inflammatory mediators by promoting aerobic glycolysis.

[0004] TRAF2 is a member of the TRAFs family and has E3 ligase activity. It is generally believed that there are 6 proteins in the TRAFs family, and their C-termini have homologous domains, which are called TRAF domains. The TRAF domain is subdivided into a compact coil TAF-N domain that mediates trimerization, and a loosely packed TRAF-C domain. In TRAF2, this domain mediates the binding of TRAF2 to TNFRSF receptors containing TRAF binding motifs, such as the short aa motif in the cytoplasmic domain of TNFR2, which is the TRAF binding motif of TNFR2. In addition to TRAF1, TRAF proteins also share a similar N-terminal domain consisting of a RING domain and 5-7 zinc finger structures. TRAFs family protein signaling plays a central role in many biological activities. However, research on TRAF2 has mainly focused on cancer and Alzheimer's disease. We found that TRAF2 expression was significantly upregulated in the liver tissue of acute liver failure model mice and in LPS-induced activated macrophages, accompanied by abnormal expression of macrophage glucose metabolism-related molecules. These results suggest that TRAF2 may play an important role in macrophage metabolic reprogramming, inflammatory activation and liver inflammatory damage. Summary of the invention

[0005] The present invention provides a method for intervening in macrophage metabolic reprogramming and inflammatory activation, namely, by downregulating the expression level of macrophage TRAF2, affecting macrophage metabolic reprogramming, reducing the activation of the macrophage NLRP3 inflammasome pathway and the production of inflammatory cytokines, and thereby alleviating LPS / D-GalN-induced acute liver failure.

[0006] This is achieved in the following ways:

[0007] 1. In vitro intervention of inflammatory activation of human macrophages

[0008] Design of human TRAF2-specific siRNA (h-siTRAF2) and its control siRNA (h-siNC) sequences:

[0009] h-siTRAF2: 5'-GGAGCATTGGCCTCAAGGA-3'

[0010] h-siNC:5'-ATTGTATGCGATCGCAGACTT-3'

[0011] Then adopt RNA iMAX was transfected into THP1 cells, a human monocyte-macrophage cell line, cultured overnight in a 6-well plate. 24 hours after transfection, LPS (125 ng / mL) was added for stimulation for 6 hours.

[0012] Then the cells were collected and the interference efficiency of TRAF2 was analyzed by PCR and Western Blotting (WB), respectively.

[0013] The primer sequences for the human TRAF2 gene are:

[0014] F:TCCCTGGAGTTGCTACAGC

[0015] R:AGGCGGAGCACAGGTACTT

[0016] Both PCR and WB results confirmed that the use of the above-mentioned h-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of human macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS.

[0017] 2. In vitro intervention of inflammatory activation and metabolic reprogramming of mouse macrophages

[0018] Design of mouse TRAF2-specific siRNA (m-siTRAF2) and its control siRNA (m-siNC) sequences:

[0019] m-siTRAF2: 5'-GGACCUGGAGGUACACUAU-3'

[0020] m-siNC: 5'-UUCUCCGAACGUGUCACGUTT-3'

[0021] Then adopt RNA iMAX was transfected into mouse macrophage cell line RAW264.7 cells cultured overnight in 6-well plates. 24 hours after transfection, LPS (125 ng / mL) was added for stimulation for 6 hours.

[0022] Then the cells were collected and the interference efficiency of TRAF2 was analyzed by PCR and Western Blotting (WB), respectively.

[0023] The primer sequences for mouse TRAF2 gene are:

[0024] F:AGAGAGTAGTTCGGCCTTTCC

[0025] R:GTGCATCCATCATTGGGACAG

[0026] Both PCR and WB results confirmed that the use of the above m-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of mouse macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS. Intervention of TRAF2 expression can also inhibit the expression of macrophage glucose metabolism-related molecules such as GLUT1, HIF-1α, HK2, LDHA, and PKM2, thereby affecting macrophage glucose metabolism. At the same time, after knocking down TRAF2, the activation of inflammatory and injury-related pathways such as the macrophage MAPK pathway (such as JNK) and NFκB pathway was significantly reduced.

[0027] 3. In vivo intervention of inflammatory activation and metabolic reprogramming of mouse macrophages

[0028] Myeloid cell TRAF2 gene-specific knockout mice were constructed, that is, the Cre / loxP recombination system was used to specifically knock out the TRAF2 gene in mouse myeloid cells. TRAF2-flox mice (C57BL / 6 background) and Lysozyme2-Cre (Lyzm-Cre) mice (C57BL / 6 background) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. TRAF2 Flox+ / +, LyzmCre+ / - mice were crossed with TRAF2 Flox+ / +, Lyzm Cre- / - mice to obtain myeloid TRAF2 conditional knockout mice (TRAF2 Flox+ / +, Lyzm Cre+ / -, marked as MAC TRAF2 KO mice) and wild-type mice (TRAF2 Flox+ / +, Lyzm Cre- / -, marked as WT mice). The bedding of mice was changed and the genotype of mice was identified on the 10th day after birth. The mice were separated into cages on the 21st day, and MAC TRAF2 KO and WT mice aged 6 to 8 weeks were used for experiments.

[0029] The mouse genotype was identified using the following method:

[0030] First, cut about 0.5 cm of tissue from the end of the mouse tail to extract DNA; then perform DNA amplification; the amplified product is then subjected to agarose gel electrophoresis and imaged. The primer sequences required for the DNA amplification experiment are as follows:

[0031] B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre):

[0032] Mutant A:CCCAGAAATGCCAGATTACG

[0033] Common A,B:CTTGGGCTGCCAGAATTTCTC

[0034] Wild type: TTACAGTCGGCCAGGCTGAC

[0035] TRAF2 Flox mice:

[0036] F:TTGAGTTTGGTCCTCTCCACCCAT

[0037] R:GGGAGAAATGAATATGGGTGCATATAC

[0038] The amplification procedure is as follows:

[0039] B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre):

[0040]

[0041]

[0042] TRAF2 Flox mice:

[0043]

[0044] MAC TRAF2 KO and WT mice aged 6 to 8 weeks were taken and anesthetized to be killed, and bone marrow-derived macrophages (BMDM) of the mice were isolated and cultured. PCR and WB experiments showed that the level of TRAF2 in BMDM of MAC TRAF2 KO mice was significantly lower than that of WT mice. In BMDM of MACTRAF2 KO mice, the expression of inflammatory cytokines induced by LPS was significantly reduced. In addition, the expression of HIF-1α and the expression of glucose metabolism-related molecules GLUT1, HK2, LDHA and PKM2 in BMDM of MAC TRAF2 KO mice was significantly reduced.

[0045] Then, mice aged 6 to 8 weeks were intraperitoneally injected with 10 μg / kg LPS and 400 mg / kg D-galactosamine (D-GalN) to establish an acute liver failure mouse model. Four hours after modeling, the mice were killed and a comparative analysis of the MAC TRAF2 KO group and the WT group was performed. ALT and AST detection of serum samples and liver HE pathology results showed that myeloid (including macrophages) knockout of TRAF2 can significantly alleviate LPS / D-GalN-induced ALT and AST elevation and liver tissue inflammatory damage.

[0046] Application of TRAF2 intervention preparations in the preparation of drugs for therapeutic intervention of macrophage metabolic reprogramming.

[0047] Application of TRAF2 intervention preparations in the preparation of drugs for regulating macrophage glucose metabolism.

[0048] The use of TRAF2 intervention preparations in the preparation of drugs for downregulating HIF-1α expression and reducing the expression of glycolysis-related enzymes such as HK2, LDHA and PKM2.

[0049] The application of TRAF2 intervention preparations in the preparation of drugs for reducing the up-regulation of inflammatory cytokines such as TNF-α and IL-1β induced by LPS stimulation, and down-regulating the expression of molecules such as HIF-1α, GLUT1, HK2, LDHA and PKM2 in BMDM.

[0050] The application of TRAF2 intervention preparations in the preparation of drugs that simultaneously affect the metabolic reprogramming of macrophages and the activation of inflammatory and damage-related pathways such as JNK and NFκB.

[0051] The use of TRAF2 intervention preparations in the preparation of drugs for treating and reducing the activation of the NLRP3 inflammasome pathway in macrophages and the production of inflammatory cytokines.

[0052] The invention relates to the use of a TRAF2 intervention preparation in the preparation of a drug for alleviating LPS / D-GalN-induced ALT and AST elevation and inflammatory damage to liver tissue, wherein the inflammatory damage to liver tissue is liver ischemia-reperfusion injury, alcoholic liver injury, metabolic liver injury, autoimmune liver injury or liver failure.

[0053] Application of TRAF2 intervention preparation in the preparation of drugs for treating LPS / D-GalN-induced acute liver failure.

[0054] The TRAF2 intervention preparation is used to downregulate or inhibit the expression level of TRAF2 in macrophages.

[0055] Preferably, the TRAF2 intervention preparation further comprises a pharmaceutically acceptable excipient.

[0056] The present invention also provides an in vitro intervention preparation for macrophage inflammatory activation.

[0057] An in vitro intervention preparation for inflammatory activation of human macrophages, TRAF2-specific siRNA (h-siTRAF2) and its control siRNA (h-siNC) sequences:

[0058] h-siTRAF2: 5'-GGAGCATTGGCCTCAAGGA-3'

[0059] h-siNC:5'-ATTGTATGCGATCGCAGACTT-3'

[0060] An in vitro intervention preparation for mouse macrophage inflammatory activation, mouse TRAF2-specific siRNA (m-siTRAF2) and its control siRNA (m-siNC) sequences:

[0061] m-siTRAF2: 5'-GGACCUGGAGGUACACUAU-3'

[0062] m-siNC: 5'-UUCUCCGAACGUGUCACGUTT-3'

[0063] A myeloid cell, TRAF2 Flox is a knockout of the coding sequence of exons 3-4 of the Traf2-201 (ENSMUST00000028311.12) transcript.

[0064] Application of an in vitro intervention preparation for macrophage inflammatory activation in the preparation of a drug for treating LPS / D-GalN-induced acute liver failure.

[0065] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: 1. By intervening with TRAF2 molecules, the LPS-induced inflammatory activation of macrophages is significantly alleviated, and the secretion of inflammatory cytokines is reduced. 2. By intervening with TRAF2 molecules, the expression of GLUT1, a molecule related to macrophage glucose metabolism, is affected, thereby regulating macrophage glucose metabolism. 3. By intervening with TRAF2 molecules, the expression of HIF-1α and its mediated Warburg effect are downregulated, and the expression of glycolysis-related enzymes such as HK2, LDHA and PKM2 is reduced. 4. By knocking out TRAF2 in the myeloid system, the LPS-induced inflammatory activation of BMDM is reduced. 5. By knocking out TRAF2 in the myeloid system, the expression of HIF-1α in BMDM is downregulated, and the expression of glycolysis-related enzymes such as GLUT1 and HK2, LDHA and PKM2, which are related to glucose metabolism, is affected. 6. By intervening with TRAF2 molecules, the metabolic reprogramming of macrophages and the activation of inflammatory and damage-related pathways such as JNK and NFκB can be simultaneously affected. 7. Myeloid knockout of TRAF2 alleviates LPS / D-GalN-induced acute liver failure in mice.

[0066] Given the key role of macrophages in liver physiological homeostasis and liver damage repair (including liver ischemia-reperfusion injury, alcoholic liver injury, metabolic liver injury, autoimmune liver injury, liver failure, etc.), the intervention of macrophage metabolic reprogramming and inflammatory activation based on this method is expected to be applied to the intervention of other liver injuries related to macrophage homeostasis imbalance, including liver ischemia-reperfusion injury, alcoholic liver injury, metabolic liver injury, autoimmune liver injury, liver failure, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 Interfering with TRAF2 in THP1 cells can reduce the activation of their inflammatory pathways and the production of inflammatory factors:

[0068] (A) Protein expression of inflammatory factors before and after LPS stimulation after knockdown of TRAF2 in THP1 cells; (B) Relative mRNA expression level of TRAF2 before and after LPS stimulation after knockdown of TRAF2 in THP1 cells; (C) Relative mRNA expression level of inflammatory factors before and after LPS stimulation after knockdown of TRAF2 in THP1 cells.

[0069] Figure 2 Interference with TRAF2 in Raw264.7 cells can reduce the activation of inflammatory pathways and the production of inflammatory factors:

[0070] (A) Protein expression of inflammatory factors before and after LPS stimulation after knockdown of TRAF2 in Raw264.7 cells; (B) Relative mRNA expression level of TRAF2 before and after LPS stimulation after knockdown of TRAF2 in Raw264.7 cells; (C) Relative mRNA expression level of inflammatory factors before and after LPS stimulation after knockdown of TRAF2 in Raw264.7 cells.

[0071] Figure 3 Interference with TRAF2 in Raw264.7 cells reduced GLUT1 expression and glucose uptake:

[0072] (A) Knocking down TRAF2 in Raw264.7 cells reduced the basal expression level of GLUT1 protein; (B) Knocking down TRAF2 in Raw264.7 cells reduced the expression level of GLUT1 protein under LPS stimulation; (C) The flow cytometry results of 2-NBDG staining showed that the MFI value was significantly reduced after knocking down TRAF2, indicating that glucose uptake was reduced.

[0073] Figure 4 Interference with TRAF2 in Raw264.7 cells can reduce the expression of HIF-1α and glycolytic enzymes:

[0074] (A) Knockdown of TRAF2 in Raw264.7 cells reduced the basal expression level of HIF-1α protein; (B) Knockdown of TRAF2 in Raw264.7 cells reduced the expression level of HIF-1α protein under LPS stimulation; (C) Knockdown of TRAF2 in Raw264.7 cells reduced the mRNA expression of HIF-1α and glycolytic enzymes such as HK2, LDHA and PKM2.

[0075] Figure 5 Identification of TRAF2 myeloid knockout mice and analysis of TRAF2 levels in different cells:

[0076] (A) Genotype identification results of TRAF2 myeloid knockout mice; (B) TRAF2 protein level in BMDM of TRAF2 myeloid knockout mice; (C) TRAF2 mRNA level in BMDM and primary hepatocytes of TRAF2 myeloid knockout mice. KO represents MACTRAF2 KO.

[0077] Figure 6 TRAF2 myeloid knockout can affect the expression of inflammatory factors and glucose metabolism molecules in BMDM:

[0078] (A) TRAF2 myeloid knockout significantly reduced the up-regulation of TNF-α and IL-1β induced by LPS stimulation; (B) The mRNA expression levels of HIF-1α, GLUT1, HK2, LDHA and PKM2 in BMDM of TRAF2 myeloid knockout mice were significantly downregulated. KO represents MACTRAF2 KO.

[0079] Figure 7 Myeloid knockout of TRAF2 alleviates acute liver failure in mice

[0080] (A) Serum ALT and AST levels of mice after acute liver failure induced by LPS / D-GalN; (B) HE pathology of liver tissue. KO represents MAC TRAF2 KO. DETAILED DESCRIPTION

[0081] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0082] Example 1

[0083] In vitro intervention of inflammatory activation of human macrophages

[0084] Design of human TRAF2-specific siRNA (h-siTRAF2) and its control siRNA (h-siNC) sequences:

[0085] h-siTRAF2: 5'-GGAGCATTGGCCTCAAGGA-3'

[0086] h-siNC:5'-ATTGTATGCGATCGCAGACTT-3'

[0087] Then adopt RNA iMAX was transfected into THP1 cells, a human monocyte-macrophage cell line, cultured overnight in a 6-well plate. 24 hours after transfection, LPS (125 ng / mL) was added for stimulation for 6 hours.

[0088] Then the cells were collected and the interference efficiency of TRAF2 was analyzed by PCR and Western Blotting (WB), respectively.

[0089] The primer sequences for the human TRAF2 gene are:

[0090] F:TCCCTGGAGTTGCTACAGC

[0091] R:AGGCGGAGCACAGGTACTT

[0092] Both PCR and WB results confirmed that the use of the above-mentioned h-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of human macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS.

[0093] h-siTRAF2 sequence was used to interfere with the expression of TRAF2 in THP1 cells. The effects of knocking down TRAF2 on the expression of inflammatory factors in macrophages induced by LPS were compared and analyzed. Both PCR and WB results confirmed that the h-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of human macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS ( Figure 1 ).

[0094] Compared with other interference sequences of human TRAF2, the h-siTRAF2 sequence described in the invention has a better interference effect on TRAF2 expression. Relative quantitative PCR was used to analyze the mRNA expression level of TRAF2 to evaluate the interference efficiency of different siRNA sequences, as shown in Table 1:

[0095] Table 1

[0096] Non-interfering control h-siNC h-siTRAF2 h-siTRAF2-1 h-siTRAF2-2 h-siTRAF2-3 1.00±0.08 1.11±0.12 <![CDATA[0.17±0.04 a ]]> <![CDATA[0.35±0.12 a,b ]]> <![CDATA[0.88±0.34 b ]]> <![CDATA[0.61±0.28 a,b ]]>

[0097] Note: Values ​​are mean ± SD; a—statistically significant difference compared with h-siNC (p < 0.05); b—h-siTRAF2-1 / 2 / 3 is statistically significant compared with h-siTRAF2 (p < 0.05)

[0098] Example 2

[0099] In vitro intervention of inflammatory activation of mouse macrophages

[0100] Design of mouse TRAF2-specific siRNA (m-siTRAF2) and its control siRNA (m-siNC) sequences:

[0101] m-siTRAF2: 5'-GGACCUGGAGGUACACUAU-3'

[0102] m-siNC: 5'-UUCUCCGAACGUGUCACGUTT-3'

[0103] Then adopt RNA iMAX was transfected into mouse macrophage cell line RAW264.7 cells cultured overnight in 6-well plates. 24 hours after transfection, LPS (125 ng / mL) was added for stimulation for 6 hours.

[0104] Then the cells were collected and the interference efficiency of TRAF2 was analyzed by PCR and Western Blotting (WB), respectively.

[0105] The primer sequences for mouse TRAF2 gene are:

[0106] F:AGAGAGTAGTTCGGCCTTTCC

[0107] R:GTGCATCCATCATTGGGACAG

[0108] Both PCR and WB results confirmed that the use of the above m-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of mouse macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS. Intervention of TRAF2 expression can also inhibit the expression of macrophage glucose metabolism-related molecules such as GLUT1, HIF-1α, HK2, LDHA, and PKM2, thereby affecting macrophage glucose metabolism. At the same time, after knocking down TRAF2, the activation of inflammatory and injury-related pathways such as the macrophage MAPK pathway (such as JNK) and NFκB pathway was significantly reduced.

[0109] The m-siTRAF2 sequence was used to interfere with the expression of TRAF2 in RAW264.7 cells. The effects of knocking down TRAF2 on the expression of inflammatory factors in macrophages induced by LPS were compared and analyzed. Both PCR and WB results confirmed that the use of the above m-siTRAF2 sequence can significantly reduce the background TRAF2 expression level of human macrophages, and significantly reduce the upregulation of TRAF2 expression induced by LPS stimulation, as well as the upregulation of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 induced by LPS ( Figure 2Expression profiling sequencing and WB analysis also showed that after knocking down TRAF2, the activation of inflammatory and injury-related pathways such as the macrophage MAPK pathway (such as JNK) and NFκB pathway was significantly reduced.

[0110] Compared with other interference sequences of mouse TRAF2, the m-siTRAF2 sequence described in the invention has a better interference effect on TRAF2 expression. Relative quantitative PCR was used to analyze the mRNA expression level of TRAF2 to evaluate the interference efficiency of different siRNA sequences, as shown in Table 2:

[0111] Table 2

[0112] Non-interfering control m-siNC m-siTRAF2 m-siTRAF2-1 m-siTRAF2-2 m-siTRAF2-3 1.00±0.07 0.97±0.09 <![CDATA[0.14±0.05 a ]]> <![CDATA[0.77±0.21 a,b ]]> <![CDATA[0.48±0.16 a,b ]]> <![CDATA[0.69±0.19 a,b ]]>

[0113] Note: Values ​​are mean ± SD; a—statistically significant difference compared with m-siNC (p < 0.05); b—statistically significant difference compared with m-siTRAF2-1 / 2 / 3 (p < 0.05)

[0114] Example 3

[0115] The m-siTRAF2 sequence described in Example 2 was used to interfere with the expression of TRAF2 in RAW264.7 cells. The effects of knocking down TRAF2 on the expression of GLUT1, a molecule related to macrophage glucose metabolism, and on the glucose uptake of macrophages were compared and analyzed. The WB results showed that the use of the above-mentioned m-siTRAF2 sequence can significantly reduce the background GLUT1 expression level of mouse macrophages, and significantly reduce the GLUT1 expression level under LPS stimulation conditions. 2-NBDG staining was used to analyze the cell glucose uptake ability, and the flow cytometry results showed that the MFI value (mean fluorescence intensity) was significantly reduced after knocking down TRAF2. It shows that the technology described in the present invention can affect cellular glucose metabolism (by reducing macrophage glucose uptake). Figure 3 ).

[0116] Example 4

[0117] The m-siTRAF2 sequence described in Example 2 was used to interfere with the expression of TRAF2 in RAW264.7 cells. The effects of knocking down TRAF2 on the expression level of HIF-1α in macrophages and the expression of glycolysis-related enzymes such as HK2, LDHA, and PKM2 were compared and analyzed. WB results showed that the use of the above m-siTRAF2 sequence can significantly reduce the background HIF-1α expression level in mouse macrophages, and significantly reduce the HIF-1α expression level under LPS stimulation conditions. PCR analysis also showed that knocking down TRAF2 can significantly reduce the expression of glycolysis-related enzymes such as HK2, LDHA, and PKM2 in macrophages ( Figure 4). This indicates that the technology of the present invention can affect cellular sugar metabolism by reducing macrophage glycolysis-related enzymes.

[0118] Example 5

[0119] In vivo intervention of inflammatory activation of mouse macrophages

[0120] Myeloid cell TRAF2 gene-specific knockout mice were constructed, that is, the Cre / loxP recombination system was used to specifically knock out the TRAF2 gene in mouse myeloid cells. TRAF2-flox mice (C57BL / 6 background) and Lysozyme2-Cre (Lyzm-Cre) mice (C57BL / 6 background) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. TRAF2 Flox+ / +, LyzmCre+ / - mice were crossed with TRAF2 Flox+ / +, Lyzm Cre- / - mice to obtain myeloid TRAF2 conditional knockout mice (TRAF2 Flox+ / +, Lyzm Cre+ / -, marked as MAC TRAF2 KO mice) and wild-type mice (TRAF2 Flox+ / +, Lyzm Cre- / -, marked as WT mice). The bedding of mice was changed and the genotype of mice was identified on the 10th day after birth. The mice were separated into cages on the 21st day, and MAC TRAF2 KO and WT mice aged 6 to 8 weeks were used for experiments.

[0121] The mouse genotype was identified using the following method:

[0122] First, cut about 0.5 cm of tissue from the end of the mouse tail to extract DNA; then perform DNA amplification; the amplified product is then subjected to agarose gel electrophoresis and imaged. The primer sequences required for the DNA amplification experiment are as follows:

[0123] B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre):

[0124] Mutant A:CCCAGAAATGCCAGATTACG

[0125] Common A,B:CTTGGGCTGCCAGAATTTCTCWild type:TTACAGTCGGCCAGGCTGAC

[0126] TRAF2 Flox mice:

[0127] F:TTGAGTTTGGTCCTCTCCACCCAT

[0128] R: GGGAGAAAATGAATATGGGTGCATATAC The amplification procedure is as follows:

[0129] B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre):

[0130]

[0131] TRAF2 Flox mice:

[0132]

[0133]

[0134] MAC TRAF2 KO and WT mice aged 6 to 8 weeks were taken and anesthetized to be killed, and bone marrow-derived macrophages (BMDM) of the mice were isolated and cultured. PCR and WB experiments showed that the level of TRAF2 in BMDM of MAC TRAF2 KO mice was significantly lower than that of WT mice. In addition, the expression of inflammatory cytokines induced by LPS was significantly reduced in BMDM of MAC TRAF2 KO mice.

[0135] Then, mice aged 6 to 8 weeks were intraperitoneally injected with 10 μg / kg LPS and 400 mg / kg D-galactosamine (D-GalN) to establish an acute liver failure mouse model. Four hours after modeling, the mice were killed and a comparative analysis of the MAC TRAF2 KO group and the WT group was performed. ALT and AST detection of serum samples and liver HE pathology results showed that myeloid (including macrophages) knockout of TRAF2 can significantly alleviate LPS / D-GalN-induced ALT and AST elevation and liver tissue inflammatory damage.

[0136] Primer sequences were used for DNA amplification and gel electrophoresis to identify the mouse genotype. According to the genotype identification results, BMDM of 6-8 week-old myeloid TRAF2 conditional knockout mice (TRAF2 Flox+ / +, Lyzm Cre+ / -, marked as MACTRAF2 KO mice) and wild-type mice (TRAF2 Flox+ / +, Lyzm Cre- / -, marked as WT mice) were collected, and protein and RNA were extracted for WB and PCR experiments. At the same time, primary hepatocytes from these two groups of mice were collected to analyze TRAF2 levels. PCR results showed that there was no significant difference in TRAF2 levels in the hepatocytes of these two groups of mice. The above experimental results show that this strategy can achieve specific knockout of TRAF2 in the mouse myeloid lineage (represented by BMDM cells) ( Figure 5 ).

[0137] Example 6

[0138] BMDM of MAC TRAF2 KO mice and WT mice in Example 5 were collected and activated by LPS induction, and PCR was used to analyze the effect of myeloid knockout of TRAF2 on LPS-induced inflammatory activation of BMDM. The effect of myeloid knockout of TRAF2 on the expression of HIF-1α in BMDM, as well as the expression of glycolysis-related enzymes such as GLUT1 and HK2, LDHA and PKM2, which are related to sugar metabolism, was analyzed. The results showed that myeloid knockout of TRAF2 can significantly reduce the up-regulation of inflammatory cytokines such as TNF-α and IL-1β induced by LPS stimulation, and significantly down-regulate the expression of molecules such as HIF-1α, GLUT1, HK2, LDHA and PKM2 in BMDM ( Figure 6 ). This indicates that the method of the present invention can affect the metabolic reprogramming of BMDM and reduce the secretion of pro-inflammatory factors.

[0139] Example 7

[0140] In Example 5, MAC TRAF2 KO mice and WT mice were intraperitoneally injected with LPS / D-GalN to establish a mouse acute liver failure model, and PBS was intraperitoneally injected as a solvent control group. Four hours after modeling, the mice were killed and a comparative analysis of the MAC TRAF2 KO group and the WT group was performed. The results of serum ALT and AST detection and liver HE pathology showed that myeloid (including macrophage) knockout of TRAF2 can significantly alleviate LPS / D-GalN-induced ALT and AST elevation and liver tissue inflammatory damage ( Figure 7 ).

Claims

1. A method for intervening in macrophage metabolic reprogramming and inflammatory activation, characterized in that: By downregulating the expression level of TRAF2 in macrophages, affecting macrophage metabolic reprogramming, and reducing the activation of the NLRP3 inflammasome pathway in macrophages and the production of inflammatory cytokines, this method is limited to non-disease diagnosis and treatment methods.

2. The method according to claim 1, characterized in that: Specifically, it includes one of the following three methods: 1) In vitro intervention of inflammatory activation of human macrophages Design of human TRAF2-specific siRNA (h-siTRAF2) and its control siRNA (h-siNC) sequences: h-siTRAF2: 5'-GGAGCATTGGCCTCAAGGA-3' h-siNC:5'-ATTGTATGCGATCGCAGACTT-3' Then adopt RNA iMAX was transfected into THP1 cells, a human monocyte-macrophage cell line, cultured overnight in a 6-well plate. 24 hours after transfection, LPS was added for stimulation for 6 hours; 2) In vitro intervention of inflammatory activation and metabolic reprogramming of mouse macrophages Design of mouse TRAF2-specific siRNA (m-siTRAF2) and its control siRNA (m-siNC) sequences: m-siTRAF2: 5'-GGACCUGGAGGUACACUAU-3' m-siNC: 5'-UUCUCCGAACGUGUCACGUTT-3' Then adopt RNA iMAX was transfected into RAW264.7 cells, a mouse macrophage cell line, cultured overnight in a 6-well plate. 24 hours after transfection, LPS was added for stimulation for 6 hours; 3) In vivo intervention of inflammatory activation and metabolic reprogramming of mouse macrophages Myeloid cell TRAF2 gene-specific knockout mice were constructed, i.e., the Cre / loxP recombination system was used to specifically knockout the TRAF2 gene in mouse myeloid cells; TRAF2 Flox was designed to knock out the coding sequence of exons 3-4 of the Traf2-201 (ENSMUST00000028311.12) transcript. TRAF2 Flox+ / +, Lyzm Cre+ / - mice were crossed with TRAF2 Flox+ / +, Lyzm Cre- / - mice to obtain myeloid TRAF2 gene conditional knockout mice (TRAF2 Flox+ / +, Lyzm Cre+ / -, marked as MAC TRAF2 KO mice) and wild-type mice (TRAF2 Flox+ / +, Lyzm Cre- / -, marked as WT mice). The litter of mice was changed on the 10th day after birth and the mouse genotype was identified. The mice were separated into cages on the 21st day, and MAC TRAF2KO and WT mice aged 6 to 8 weeks were selected for the experiment; The mouse genotype identification was carried out by the following method: first, the tissue of about 0.5 cm from the end of the mouse tail was cut to extract DNA; then DNA amplification was performed; the amplified product was subjected to agarose gel electrophoresis and imaged and recorded; the primer sequences required for the DNA amplification experiment are as follows: B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre): Mutant A:CCCAGAAATGCCAGATTACG Common A,B:CTTGGGCTGCCAGAATTTCTC Wild type: TTACAGTCGGCCAGGCTGAC TRAF2 Flox mice: F:TTGAGTTTGGTCCTCTCCACCCAT R:GGGAGAAATGAATATGGGTGCATATAC The amplification procedure is as follows: B6.129P2-Lyz2 tm1(cre)Ifo / J mice (Lyzm-Cre): TRAF2 Flox mice: MAC TRAF2 KO and WT mice aged 6 to 8 weeks were anesthetized and killed, and bone marrow macrophages (BMDM) of the mice were isolated and cultured. PCR and WB experiments showed that the level of TRAF2 in BMDM of MAC TRAF2 KO mice was significantly lower than that of WT mice. The expression of inflammatory cytokines induced by LPS was significantly reduced in BMDM of MAC TRAF2KO mice. In addition, the expression of HIF-1α and the expressions of glucose metabolism-related molecules GLUT1, HK2, LDHA and PKM2 in BMDM of MAC TRAF2 KO mice were significantly reduced. Then, mice aged 6 to 8 weeks were intraperitoneally injected with 10 μg / kg LPS and 400 mg / kg D-galactosamine (D-GalN) to establish an acute liver failure mouse model; 4 hours after modeling, the mice were killed, and a comparative analysis of the MAC TRAF2 KO group and the WT group was performed; ALT and AST detection of serum samples and liver HE pathology results showed that myeloid (including macrophages) knockout of TRAF2 can significantly alleviate LPS / D-GalN-induced ALT and AST elevation and inflammatory damage to liver tissue.

3. Application of TRAF2 intervention preparations in the preparation of drugs for therapeutic intervention of macrophage metabolic reprogramming.

4. Application of TRAF2 intervention preparations in the preparation of drugs for regulating macrophage glucose metabolism.

5. The application of TRAF2 intervention preparations in the preparation of drugs for downregulating HIF-1α expression and reducing the expression of glycolysis-related enzymes such as HK2, LDHA and PKM2.

6. The application of TRAF2 intervention preparations in the preparation of drugs for reducing the up-regulation of inflammatory cytokines such as TNF-α and IL-1β induced by LPS stimulation, and down-regulating the expression of molecules such as HIF-1α, GLUT1, HK2, LDHA and PKM2 in BMDM.

7. The application of TRAF2 intervention preparations in the preparation of drugs that simultaneously affect the metabolic reprogramming of macrophages and the activation of inflammatory and injury-related pathways such as JNK and NFκB.

8. Application of TRAF2 intervention preparations in the preparation of drugs for treating and reducing the activation of the NLRP3 inflammasome pathway in macrophages and the production of inflammatory cytokines.

9. Use of TRAF2 intervention preparations in the preparation of drugs for alleviating LPS / D-GalN-induced ALT and AST elevation and inflammatory damage to liver tissue, wherein the inflammatory damage to liver tissue is liver ischemia-reperfusion injury, alcoholic liver injury, metabolic liver injury, autoimmune liver injury or liver failure.

10. The use according to any one of claims 3 to 9, characterized in that: The TRAF2 intervention preparation downregulates or inhibits the expression level of TRAF2 in macrophages.

11. A TRAF2 intervention preparation, the siRNA sequence is as follows: Human TRAF2-specific siRNA sequence: h-siTRAF2: 5'-GGAGCATTGGCCTCAAGGA-3'. or, Mouse TRAF2-specific siRNA sequence: m-siTRAF2: 5'-GGACCUGGAGGUACACUAU-3'.

12. A myeloid cell, wherein TRAF2 Flox is a coding sequence of exons 3-4 of a knockout Traf2-201 (ENSMUST00000028311.12) transcript.

Images