OsEPF1 gene for regulating and controlling generation of rice macrospores

Abstract

The invention relates to an OsEPF1 gene for regulating and controlling generation of rice macrospores, in particular to participation of a plant secretory peptide OsEPF1 rich in cysteine in regulating and controlling the generation process of the rice macrospores. Compared with wild type ZH11, the OsEPF1 gene function deletion mutant for regulating and controlling rice macrospore generation has obvious defects in female germ cell development, especially in the early ovule development stage and the AC and MMC stages, the mutant can generate a plurality of AC / MMC-like cells, then fertility is affected, and the fruiting rate of a rice single plant is reduced; the pEPF1:: EPF1 is supplemented back into the mutant postovule, the growth process of the macrospore is normal, and the maturing rate can be recovered to be normal. The invention proves that the OsEPF1 affects the development of female gametophytes and finally affects the maturing rate of rice by regulating the transformation from somatic cells to germ cell fate in the rice macrospore generation process, and the discovery has important significance on the research on the determination of the rice female germ cell fate, and has certain application value on rice breeding work.

Description

Technical Field

[0001] The invention relates to an OsEPF1 gene for regulating rice megaspore generation, in particular to a plant cysteine-rich secretory peptide OsEPF1 participating in regulating the rice megaspore generation process, and belongs to the field of plant biotechnology. Background Art

[0002] The development of reproductive organs determines the reproduction of plants and the yield of crops. The ovule development process is a necessary link in the sexual reproduction of plants, which directly affects fertility and yield. The development of plant megaspores is the first stage of ovule development and plays a vital role in ovule development. The development of female gametophyte begins in the early stage of ovule development. As the diploid megaspore mother cell undergoes meiosis, only one haploid spore forms the female gametophyte. Genetic and epigenetic processes mediate the formation of megaspore mother cells and limit each ovule to form only one megaspore mother cell. Megasporogenesis is a necessary prerequisite for the formation of female gametophytes, and female gametophytes are one of the most important reproductive structures in plants. It is a structure that produces egg cells and develops into embryos after fertilization. The sexual reproduction process of plants, including the guidance of pollen tubes, fertilization, and the induction of seed development, is mediated by the function of female gametophytes. Therefore, plant megasporogenesis and the development of female gametophytes are key links in determining whether plants can reproduce sexually, reproduce offspring, and produce species diversity through genetic recombination.

[0003] Plants do not form reproductive cells during embryonic development, but in adult plants, specialized somatic cells eventually produce gametes. After meiosis, specialized somatic cells form four haploid spores, which undergo programmed death and degeneration, and the surviving spores form gametes after mitosis. The transition from somatic cells to reproductive cells is limited to a very small number of cells in the male and female organs of flowers, which indicates that there is a highly sophisticated regulatory mechanism in plants to select reproductive cell precursors and determine the transition and switch from somatic cells to gametophytes. However, the molecular mechanism of this precise regulation is not yet clear. The development of female gametophytes includes two stages: megaspore development and female gametophyte development, both of which take place in the ovule. How does the transition from archespore cells to megaspore mother cells occur, what is the mechanism that regulates the differentiation and meiosis of megaspore mother cells, how are functional megaspores formed, which key genes are involved in this series of processes, what is the regulatory mechanism, and how does megaspore development transition and switch to female gametophyte development? These scientific issues need to be solved urgently. Summary of the invention

[0004] The present invention mainly provides a gene OsEPF1 involved in regulating rice megaspore formation, and the function of the gene has important application value for the study of rice reproductive development, especially the megaspore formation stage, and the creation of rice female sterility genetic material.

[0005] An OsEPF1 gene regulating rice megaspore formation, the nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] The method for constructing the rice OsEPF1 gene deletion mutant specifically comprises:

[0007] (1) Construction of OsEPF1 gene deletion expression vector;

[0008] (2) Introduce the expression vector into rice plants to obtain gene-deficient plants.

[0009] The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multiple cloning site Bsa I of multiple sgRNA expression cassettes near the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which are spliced ​​together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method.

[0010] The gene-deficient plant in step (2) includes the addition or deletion of the nucleotide base sequence of the target gene OsEPF1.

[0011] The addition is the addition of 1 bp base, and the deletion is the deletion of 1 bp or the deletion of consecutive 17 bp bases.

[0012] The gene-deficient plants include osepf1-1, osepf1-2, and osepf1-3, and their nucleotide sequences are: SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively.

[0013] Furthermore, the present invention discloses a complementation vector for the rice OsEPF1 gene deletion mutant. The complementation vector skeleton is pGWB504, which comprises a promoter 2500 bp upstream of the start codon ATG of the OsEPF1 gene and a complete CDS sequence of the OsEPF1 gene.

[0014] The significant advantage of the present invention is that the newly discovered rice cysteine-rich secretory peptide OsEPF1 gene affects the female gametophyte development of rice by regulating megaspore occurrence, and ultimately affects the fruit setting rate and yield, which is of great significance to the study of the regulation of female reproductive development of rice, and has certain application value in rice breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 These are the structure and gene editing identification results of the OsEPF1 gene that regulates rice megaspore formation.

[0016] Figure 2 The present invention provides an observation and statistics of the seed setting rate of the rice OsEPF1 gene loss-of-function mutant and complemented strains; Figure A shows the inflorescence morphology and seed setting of the wild-type Zhonghua 11 (ZH11), osepf1-1, osepf1-2, osepf1-3 mutants and complemented strain (Com#) at maturity; Figure B shows the seed setting rate statistics of ZH11, osepf1-1 mutant and Com#.

[0017] Figure 3 The present invention is to observe the embryo sac fertility of the OsEPF1 gene loss-of-function mutant and complemented strain. DETAILED DESCRIPTION

[0018] Example 1 Construction of CRISPR / Cas 9 vector

[0019] The gene editing system used in this study is the CRISPR / Cas9 system modified by Liu Yaoguang's research group at South China Agricultural University in 2015. This system uses a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads the multiple cloning site Bsa I of multiple sgRNA expression cassettes near the binary vector RB. The sgRNA expression cassette elements are installed on the intermediate plasmid vector, which can be spliced ​​together by restriction enzyme ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method, ultimately achieving gene editing of the OsEPF1 gene (Xie X, Ma X, Zhu Q, Zeng D, Li G, Liu YG. 2017. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 10(9): 1246-1249.), (Liu W., Xie X., Ma X., Li J., Chen J., and Liu Y.-G.2015.DSDecode:A Web-based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations.Mol.Plant 8(9):1431-1433.). The vector backbone is the pCAMBIA1300 plant expression vector, and the inserted target site sequence is:

[0020] EPF1-UT-F:CAGGTGATTCAGGCCGTGAAGTTTTAGAGCTATGCTG;

[0021] EPF1-UT-R:TTCACGGCCTGAATCACCTGTGCCACGGATCATCTGC.

[0022] Figure 1 The structure of the OsEPF1 gene that regulates rice megaspore formation and the results of gene editing identification are shown in the figure. As shown in the figure, three homozygous mutants with different editing methods are shown, named osepf1-1, osepf1-2, and osepf1-3. The subsequent results are mainly shown with osepf1-1.

[0023] Example 2 Vector Construction of Complementary Strains

[0024] (1) Using wild-type ZH11 genomic DNA as a template, the promoter 2500 bp upstream of the start codon ATG of the OsEPF1 gene was amplified by PCR using the primers in Table 1;

[0025] (2) Using the cDNA of mature spikelet tissue as a template, the complete CDS sequence of the OsEPF1 gene was amplified using the primers in Table 1;

[0026] (3) The two PCR fragments in (1) and (2) were connected to pENTR by Infusion enzyme. TM / D-TOPO vector (Invitrogen) and verified by sequencing, then recombined into the destination vector pGWB504 through LR reaction, and transformed into the osepf1-1 mutant through Agrobacterium tumefaciens transformation method to obtain the complemented strain (Com#).

[0027] Table 1 Primer list

[0028]

[0029]

[0030] Example 3 Phenotypic Observation and Statistics

[0031] 1. Observation and statistics of fruit setting rate:

[0032] The wild type ZH11, osepf1-1, osepf1-2, osepf1-3 mutants and complemented lines (Com#) were planted in an artificial intelligence greenhouse, and the conditions were set as follows: temperature 28℃~32℃, air humidity 70%, light 16h, dark 8h. When the rice grew to maturity, the panicles were cut off for fruiting rate statistics, and at least 30 rice plants were counted for each line, and only 1 to 2 panicles on the main stem of each plant were counted. Figure 2 The present invention is an observation and statistics of the seed setting rate of the rice OsEPF1 gene functional loss mutant and complementation strain. Figure A shows the inflorescence morphology and seed setting of the wild-type Zhonghua 11 (ZH11), osepf1-1, osepf1-2, osepf1-3 mutants and complementation strain (Com#) at maturity; Figure B shows the seed setting rate of ZH11, osepf1-1 mutant and Com#. The above results show that the loss of OsEPF1 gene function leads to a decrease in rice seed setting rate, while the complementary strain has a normal seed setting rate, suggesting that OsEPF1 plays an important role in regulating rice seed setting rate.

[0033] 2. Observation of rice embryo sac development

[0034] Using rice ZH11 as the material, laser confocal observation of embryo sac development was performed. The specific steps are as follows:

[0035] (1) Sampling: Sampling was carried out when the rice leaf age residue was 0.5, and the different developmental stages of rice ovules were defined according to the length of the spikelets. The spikelet length of 1.5-2 mm was the archosporium cell (AC) stage; the spikelet length of 2-3 mm was the megaspore mother cell (MMC) stage; the spikelet length of 3-4 mm was the meiosis stage; the spikelet length of 4-5 mm was the megaspore tetrad stage; the spikelet length of 5-6 mm was the FM stage; the spikelet length of 6-7 mm was the mitosis stage; the spikelet length of 7-8 mm was the mature embryo sac (MO) stage;

[0036] (2) Fixation: Fix with FAA fixative for 24 h (50% EtOH:HAc:HCHO=89:6:5), rinse twice with 50% ethanol, transfer to 70% ethanol, and separate the ovary under a dissecting microscope;

[0037] (3) Staining: rehydrate with 50%, 30% ethanol gradient and distilled water, mordanted with 2% KAl(SO4)2 for 20 minutes, stained with 10 mg / L eosin for 10-12 hours, separated with 2% KAl(SO4)2 for 20 minutes, and washed with water 2-3 times;

[0038] (4) Dehydration: Dehydration with ethanol gradient 30%, 50%, 70%, 80%, 90% and anhydrous ethanol in sequence, and anhydrous ethanol was repeated three times;

[0039] (5) Transparency: Use a mixture of anhydrous ethanol and methyl salicylate in equal volume ratios, leave it in transition for 1-2 hours, and finally use 100% methyl salicylate to make it transparent for more than 1 hour.

[0040] Observation: After the ovary becomes transparent, place it on a glass slide with methyl salicylate for sealing. Perform layered scanning observation of the mature embryo sac as a whole under a laser confocal microscope and obtain images.

[0041] Figure 3 The embryo sac fertility of the OsEPF1 gene loss-of-function mutant and complemented strains was observed. In the WT (ZH11) ovule primordium, the archespore cell (AC) is specialized from the L2 epidermal cells in the nucellus tissue, and then develops into the megaspore mother cell (MMC) and the functional megaspore (FM) ( Figure 3 A). Figure 3 A, In the osepf1-1 mutant, multiple AC-like cells or MMC-like cells were observed, with the ratios being 33.3% (n=21) and 36.0% (n=25), respectively, indicating that the specialization and fate transition of female reproductive cells during megasporogenesis are defective in osepf1-1 ovules. Figure 3 As shown in A, osepf1-1 ovules at the FM stage, of which 41.9% (n=31) contained multiple FM-like cells in one ovule. At maturity (MO), structural abnormalities of the female gametophyte were detected in osepf1-1 ovules (47.16%, n=53) compared with WT (0%, n=20). In the complemented lines (Com#), ovule development was normal at the AC and MMC stages. These data suggest that OsEPF1 plays an important role in the transition and specification of MMC fate.

[0042] Compared with the wild-type ZH11, the OsEPF1 gene function-deficient mutant regulating rice megasporogenesis has obvious defects in the development of female germ cells, especially in the early stage of ovule development, AC and MMC periods, the mutant will produce multiple AC / MMC-like cells, which will affect fertility and lead to a decrease in the fruit setting rate of rice per plant; after pEPF1::EPF1 is complemented to the mutant, the megasporogenesis process in the ovule develops normally, and the fruit setting rate can be restored to normal. This study proves that Os EPF1 affects the development of female gametophytes by regulating the transformation of somatic cells to reproductive cells during rice megasporogenesis, and ultimately affects the fruit setting rate of rice. This discovery is of great significance to the study of the fate determination of female germ cells in rice, which has certain application value in rice breeding.

[0043] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. An OsEPF1 gene that regulates megaspore formation in rice, characterized in that: The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The method for constructing a rice OsEPF1 gene deletion mutant according to claim 1, characterized in that: specific include: (1) Construction of OsEPF1 gene deletion expression vector; (2) Introduce the expression vector into wild-type rice plants to obtain gene-deficient plants.

3. The method according to claim 2, characterized in that The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multiple cloning site Bsa I of multiple sgRNA expression cassettes near the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which are spliced ​​together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method.

4. The method according to claim 2, characterized in that: The gene-deficient plant in step (2) includes the addition or deletion of the nucleotide base sequence of the target gene OsEPF1.

5. The method according to claim 4, characterized in that The addition is the addition of 1 bp base, and the deletion is the deletion of 1 bp or the deletion of consecutive 17 bp bases.

6. The method according to claim 4, characterized in that The gene-deficient plants include osepf1-1, osepf1-2, and osepf1-3, and their nucleotide sequences are: SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively.

7. The complementation vector for the rice OsEPF1 gene deletion mutant according to claim 1, characterized in that: The complementation vector skeleton is pGWB504, which contains a promoter 2500 bp upstream of the start codon ATG of the OsEPF1 gene and a complete CDS sequence of the OsEPF1 gene.

Images