Rice yeast fermented bread improver and preparation method thereof, bread premixed flour, frozen dough and whole wheat bread

Abstract

The invention provides a bread improver and a preparation method thereof, bread premixed flour, frozen dough and whole wheat bread, and relates to the technical field of bread improvers. The preparation method provided by the invention comprises the following steps: extruding and puffing rice, fermenting the rice yeast, drying and crushing to obtain the bread improver fermented by the rice yeast. After the bread improver prepared by the method is added into dough to prepare bread, yeast aerogenesis and dough expansion in the fermentation process can be effectively promoted, and then the specific volume and texture of the bread are improved.

Description

Technical Field

[0001] The invention relates to the technical field of bread improvers, and in particular to a bread improver and a preparation method thereof, bread premix, frozen dough and whole wheat bread. Background Art

[0002] With the development of economy and the progress of society, people's living standards have been greatly improved, and the dietary structure of residents has also changed significantly. Bread is one of the most consumed staple foods in the world and is widely popular in many countries. In China, with the acceleration of modernization, people's requirements for the quality of bread products are getting higher and higher, and consumers pay more attention to baked products containing natural ingredients. Whole wheat flour has attracted much attention due to its high nutritional value. Compared with refined white flour, whole wheat flour contains the whole grain of wheat and has a higher content of vitamins, minerals, dietary fiber and other nutrients. Therefore, whole wheat bread made from whole wheat flour is favored by more and more consumers.

[0003] However, whole wheat bread contains more insoluble dietary fiber, which will not only reduce the overall gluten protein content in wheat dough, but also destroy the continuity of the gluten network structure, and compete with gluten protein and starch for water absorption, thereby affecting the interaction between dough and water, causing certain damage to the quality of bread. In the prior art, bread improvers are often added to whole wheat bread. They are generally compound additives composed of emulsifiers, oxidants, enzyme preparations, inorganic salts and fillers, which can improve the quality of whole bread after addition. However, bread improvers in existing designs are often compounded by multiple components, ignoring the role of biological components therein, so it is urgent to provide a solution to improve the above problems. Summary of the invention

[0004] The invention aims to provide a bread improver fermented by rice yeast, a preparation method thereof, and bread premix, frozen dough and whole wheat bread.

[0005] In a first aspect, the present invention provides a method for preparing a bread improver fermented with rice yeast, comprising: extruding and puffing rice, fermenting the rice yeast, and drying and crushing the rice yeast to obtain the bread improver fermented with rice yeast.

[0006] Optionally, the rice includes at least one of brown rice, white rice, black rice, purple rice and red rice.

[0007] Optionally, the rice yeast includes Aspergillus oryzae M6, which has been deposited in the China Center for Type Culture Collection on April 12, 2023, with a deposit number of CCTCC NO: M2023533, and a deposit address of Wuhan University, Wuhan, China.

[0008] Optionally, the average particle size of the bread improver is 200-800nm.

[0009] Optionally, the method comprises the following steps: extruding and puffing rice powder to obtain puffed rice; inoculating rice yeast into puffed rice with a water content of 35-50% and fermenting the rice in a fermentation environment; and drying and crushing the rice yeast to obtain a bread improver fermented with the rice yeast.

[0010] Optionally, the rice yeast is cultured in a culture medium containing organic iron for 48-72 hours and then the composite rice yeast is collected; the composite rice yeast is inoculated into puffed rice with a water content of 35-50%; and the fermentation treatment is carried out in a fermentation environment and a magnetic field of 0.3mT-0.4mT.

[0011] Optionally, the organic iron includes at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate.

[0012] Optionally, the concentration of the organic iron in the culture medium is 10 mg / L-200 mg / L.

[0013] Optionally, the culture medium comprises potato dextrose medium.

[0014] Optionally, the initial inoculation density of the rice yeast in the culture medium is 10 4 cfu / mL-10 6 cfu / mL.

[0015] Optionally, culturing rice koji in a culture medium containing organic iron comprises an induction stage, a consolidation stage and a reinforcement stage, and the organic iron concentration in the culture medium increases in a gradient during the induction stage, the consolidation stage and the reinforcement stage.

[0016] Optionally, the rice yeast and lactic acid bacteria are co-cultured in a culture medium containing organic iron and then centrifuged to obtain the composite rice yeast.

[0017] Optionally, the inoculation amount of the composite rice yeast in the puffed rice is 3×10 7 cfu / g-4×10 7 cfu / g.

[0018] Optionally, the temperature of the fermentation environment is 34°C-38°C.

[0019] Optionally, the humidity of the fermentation environment is 90%-95%.

[0020] Optionally, the fermentation environment is a light-proof environment.

[0021] Optionally, the frequency of the magnetic field is 50 Hz-100 Hz.

[0022] Optionally, the composite rice yeast is inoculated into the puffed rice for fermentation treatment for 48-72 hours.

[0023] Optionally, during the fermentation process, the magnetic field is intermittently applied to the composite rice yeast, and the interval between two adjacent magnetic fields is 4-6 hours.

[0024] Optionally, after the rice powder is extruded and puffed, it is irradiated with far infrared rays for 470-490 seconds and then cooled to room temperature to obtain puffed rice, the puffed rice is mixed with a fermentation substrate and then inoculated with rice yeast, and fermented in a fermentation environment.

[0025] Optionally, the rice powder is extruded and puffed at a temperature of 150-170°C and a flow rate of 2.0-2.5 m 3 / h of superheated steam for 900-1000s and then cooled to room temperature to obtain puffed rice, the puffed rice is mixed with a fermentation substrate and then inoculated with rice yeast, and fermented in a fermentation environment.

[0026] In a second aspect, the present invention further provides a bread improver fermented with rice koji prepared by any of the above optional preparation methods.

[0027] In a third aspect, the present invention further provides a bread premix, comprising the bread improver fermented with rice koji obtained by any of the above optional preparation methods or the above-mentioned bread improver fermented with rice koji.

[0028] Optionally, the mass fraction of the bread improver is 1-3%.

[0029] In a fourth aspect, the present invention further provides a frozen dough, comprising the bread improver fermented with rice yeast prepared by any of the above optional preparation methods or the above rice yeast fermented bread improver or the above bread premix prepared by adding water and mixing with yeast.

[0030] In a fifth aspect, the present invention further provides a whole wheat bread, which is prepared by thawing the frozen dough and baking it at high temperature. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The present invention provides a flowchart of a method for preparing a bread improver fermented with rice koji. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Unless otherwise defined, the technical terms or scientific terms used herein should be the common meanings understood by people with general skills in the field to which the present invention belongs.

[0033] The invention provides a method for preparing a bread improver fermented with rice koji, comprising: extruding and puffing rice, fermenting the rice koji, and drying and crushing the rice koji to obtain the bread improver fermented with rice koji. In fact, by extruding and puffing the rice, the insoluble dietary fiber in the rice can be modified and the destructiveness of the dietary fiber to the gluten network can be reduced. In addition, the various active enzymes produced in the rice koji fermentation process can effectively degrade the starch macromolecules in the dough and produce oligosaccharides, which is beneficial to the fermentation and gas production of the dough.

[0034] Specifically, rice includes at least one of brown rice, white rice, black rice, purple rice, and red rice. In fact, rice contains a variety of nutrients and bioactive components, and is considered to be a functional food that is beneficial to health. However, the texture of rice is relatively hard, and it is difficult to digest and use directly when eaten directly. After extrusion and puffing of rice, starch gelatinization, protein denaturation, and dietary fiber modification can be promoted, making the molecular structure looser, which is not only conducive to the subsequent rice koji fermentation, but also can fully release the bioactive components in rice.

[0035] In some embodiments, see Figure 1 The method for preparing a bread improver fermented with rice koji comprises the following steps:

[0036] S1, extruding and puffing rice powder to obtain puffed rice;

[0037] S2, inoculating rice yeast into puffed rice with a water content of 35-50% and fermenting it in a fermentation environment;

[0038] S3, drying and crushing to obtain a bread improver fermented with rice yeast.

[0039] In fact, when the rice powder is extruded and puffed in step S1, the water content of the rice powder used is 30-50%. In this way, during the extrusion and puffing process, under the action of high temperature, high pressure and high shear force, the water in the rice powder is vaporized, thereby generating a strong steam pressure. When the steam pressure exceeds the strength limit of the rice powder, a porous puffing structure can be formed, which is beneficial for loading the rice koji in the subsequent process.

[0040] Specifically, when the rice powder is extruded and puffed in step S1, the extrusion and puffing parameters used are related to the particle size and type of the rice powder. In addition, in order to improve the particle size consistency of the puffed rice after step S1, the rice powder can be sieved in advance, for example, the rice powder can be sieved through a 40-mesh sieve in advance, so as to avoid that the rice powder with larger particles is not fully puffed, while the rice powder with smaller particles is over-puffed.

[0041] In some embodiments, when the rice powder is extruded and puffed in step S1, the rice powder can be extruded and puffed in multiple temperature zones. In fact, by heating the rice powder in multiple temperature zones, the temperature of the rice powder at different stages can be accurately controlled, so that when the rice powder passes through different temperature zones, the rice powder can be evenly heated and evenly heated, which helps to achieve a more uniform puffing effect, and can also reduce the loss of nutrients in the rice powder and reduce the damage of heat-sensitive active substances.

[0042] In some embodiments, when the colored rice powder is extruded and puffed during step S1, when the rice powder is specifically black rice powder that has passed through a 40-mesh sieve, extrusion and puffing can be performed in five temperature zones, and the temperatures of the five temperature zones can be 60-80°C, 90-110°C, 160-180°C, 160-180°C, and 160-180°C, respectively.

[0043] In addition, through multi-temperature zone extrusion puffing, substances with unique flavors can be produced under the combination of different temperatures and different times, giving the puffed rice a rich aroma and taste. At the same time, substances with bad flavors in rice powder can be removed. After being added to the bread improver and mixed into whole wheat bread, it can give the whole wheat bread a more unique taste.

[0044] In some embodiments, after the rice powder is extruded and puffed in step S1, far infrared rays are used for 470-490 seconds and then cooled to room temperature to obtain puffed rice. Specifically, the far infrared ray irradiation temperature is 150-170°C.

[0045] In some embodiments, after the rice powder is extruded and puffed in step S1, the temperature is 150-170°C and the flow rate is 2.0-2.5m 3 / h of superheated steam for 900-1000s and then cooled to room temperature to obtain puffed rice.

[0046] In fact, by irradiating or superheated steaming the extruded rice, the starch granules therein can be further gelatinized and degraded into small molecules, which can provide a basis for the subsequent growth of rice koji or compound rice koji, and can also enhance the fermentation effect, which is beneficial to improve the enzyme activity of the biological enzymes produced by metabolism.

[0047] Specifically, after the rice powder is extruded and puffed in step S1, and subjected to far-infrared irradiation or superheated steam treatment, it is mixed with the fermentation matrix, which is conducive to improving the ability of the rice koji to utilize the nutrients in the fermentation matrix for rapid growth after the rice koji is inoculated. Specifically, the fermentation matrix can be potato dextrose culture medium.

[0048] In some embodiments, when step S2 is performed to inoculate rice yeast on puffed rice for fermentation, the rice yeast can utilize the nutrients in the puffed rice as nutrients for growth, and degrade the starch macromolecules in the puffed rice, destroy the structure of the starch molecules, and make the surface of the puffed rice after fermentation have more fine pores, and increase the content of bioactive ingredients (polyphenols) therein.

[0049] Specifically, when the rice yeast is inoculated on the puffed rice with a moisture content of 35-50%, it is beneficial for the rice yeast to undergo solid-state fermentation growth. In addition, since the moisture content of the puffed rice obtained after extrusion and puffing of rice powder is uncontrollable, distilled water can be sprayed into the puffed rice or hot air treatment at 30-35° C. can be performed to adjust the moisture content.

[0050] In some embodiments, after the rice koji is inoculated into the puffed rice in step S2, the fermentation environment is 36-38 ° C, the ambient humidity is 88%-92%, and the solid-state fermentation time is controlled to be 70-74h. In fact, the rice koji used is Aspergillus oryzae M6, which was deposited in the China Center for Type Culture Collection on April 12, 2023, with a deposit address of Wuhan University, Wuhan, China, and a deposit number of CCTCC NO: 2023533. The Aspergillus oryzae M6 (CCTCC NO: 2023533) can simultaneously metabolize α-amylase, protease, cellulase, carboxymethyl cellulase and pectinase during solid-state fermentation.

[0051] Isolation of Aspergillus oryzae M6 (CCTCC NO: 2023533): Use a sterile medicine spoon to take 1g of naturally fermented soybean paste and 9mL of 0.9% saline solution, stir and dilute, shake and take 1mL of soybean milk dilution and 9mL of saline solution to dilute to a dilution of 10 -2 At the same time, prepare a dilution of 10 -3 , 10 -4 , 10 -5 , 10 -6 dilution, and take 200 μL of 10 -3 , 10 -4 , 10 -5 , 10 -6The dilution is evenly spread on a red Bengal medium with chloramphenicol added using a sterile applicator, and after constant temperature static culture at 28°C for 96 hours, a typical mold single colony is selected and streaked on a potato dextrose agar solid medium, and purified 2-3 times until a single colony is obtained, and the purified mold strain is streaked and transferred on a potato dextrose agar solid slant medium to obtain an Aspergillus oryzae strain for cryopreservation;

[0052] Mutagenesis: After the isolated Aspergillus oryzae strain was cultured to maturity, the Aspergillus oryzae plate was washed with sterile water to prepare a uniform spore suspension, and the concentration of the Aspergillus oryzae spore suspension was adjusted to 10 8 CFU / mL, and then 10mL of spore suspension was evenly coated on the slide, and the mutagenesis conditions were set as follows: ventilation volume 10SLM, power 100W, time was set to 0s, 15s, 30s, 45s, 60s, 75s, 90s, 120s respectively. After completing the atmospheric pressure and room temperature plasma mutagenesis treatment, the slide was washed in PBS and then suspended in sterile plasma water for use;

[0053] Screening: The induced Aspergillus oryzae suspension was spread on casein medium, cultured at 30°C for 72 hours in a constant temperature and dark environment, and single colonies with vigorous mycelial growth and large transparent circle compared with the uninduced Aspergillus oryzae strain were streaked on soy protein medium. After cultured at 30°C for 48 hours, single colonies with large colony diameter and vigorous growth were selected again, transferred to soy protein medium for culture and storage after maturity; the strains were activated and cultured to make 1×10 6 CFU / mL of spore suspension, drawing the spore suspension and placing it on a solid fermentation basal medium, carrying out a solid fermentation process at 30 ℃ for 72h, and measuring the enzymatic activities of amylase, protease, cellulase, carboxymethyl cellulose and pectinase, preferably preserving the strains with normal growth and high enzyme activity; wherein the casein medium comprises casein 10g / L, beef soaked powder 10g / L, disodium hydrogen phosphate 2g / L, sodium chloride 5g / L, agar powder 15g / L and deionized water 1L, and the raw material is sterilized at 121 ℃ for 20min by high pressure sterilization; the soy protein medium comprises soy protein isolate 10g, MgSO4·7H2O 0.5g, xylose 30g, KH2PO41g, agar powder 15g, dissolved in 1000m L distilled water, adjusting pH to 6.4, and sterilizing at 121 ℃ for 15min; the solid fermentation basal medium comprises cooked black rice 97% and (NH4)2SO4 3%, adjust the solid-water ratio to 1:0.8, and sterilize at 121 degrees for 15 minutes;

[0054] Identification: The strain was sent to Beijing Qingke Biotechnology Co., Ltd. for gene identification, and the gene sequence of Aspergillus oryzae M6 was obtained as follows:

[0055] AACGGTACTCTCTGCTTATTGATATGCCTGTCCGAAGACTGATTTGCGTT

[0056] CGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCT

[0057] CGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGG

[0058] AGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATG

[0059] ACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTT

[0060] CAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTT

[0061] CGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTT

[0062] TAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTC

[0063] GTGGTGTCTCCGGCGGGCCGGGCCCGGGGCTGAGAGCCCCCGGCGGCC

[0064] ATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGG

[0065] AGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCCTGCCCCCCCCCACGGGAAAAGGC.

[0066] Specifically, when executing step S2, after rice yeast is inoculated into culture components and cultivated in advance, rice yeast spore suspension is made. In fact, by cultivating rice yeast in advance, it is conducive to activating and breeding the rice yeast of cryopreservation, and then the growth activity and inoculation density of rice yeast can be effectively adjusted. Specifically, the culture components used for rice yeast inoculation can be potato dextrose agar medium or other any conventional medium.

[0067] In some embodiments, when executing step S2, it includes:

[0068] S21, culturing the rice yeast in a medium containing organic iron for 48-72 hours and then collecting the composite rice yeast;

[0069] S22, inoculating the composite rice yeast into puffed rice with a water content of 35-50%;

[0070] S23, fermentation treatment is carried out in a fermentation environment and a magnetic field of 0.3mT-0.4mT.

[0071] In fact, by culturing the rice koji in a culture medium containing organic iron in advance in step S21, the rice koji can be encouraged to absorb organic iron during the growth process, and then the iron element can be integrated into the fermentation product during the fermentation process, thereby increasing the iron content in the fermentation product, which is of positive significance for preventing and improving iron deficiency-related diseases, and can also enhance the activity of proteases, amylases and cellulases produced by rice koji fermentation.

[0072] Specifically, in step S21, the organic iron added in the culture medium includes at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate. In fact, after the rice yeast is taken in organic iron, the growth and reproduction of itself can be promoted, and the activity of the biological enzyme produced by the rice yeast can be adjusted. In addition, in the different stages of the growth of rice yeast, different types of organic iron can be added in the culture medium to cooperate so that the rice yeast can grow faster under the promotion of multiple organic irons.

[0073] In some embodiments, the concentration of organic iron added to the culture medium in step S21 is 10-200 mg / L. In fact, the organic iron concentration within this concentration range can provide an appropriate amount of iron for the growth of rice koji, thereby meeting the growth and metabolism requirements of rice koji, and avoiding oxidative stress on rice koji, resulting in damage to the rice koji.

[0074] In some embodiments, the culture medium for adding organic iron in step S21 can be potato dextrose culture medium, specifically potato dextrose culture medium includes potato, glucose and agar. In fact, the culture medium for adding organic iron can be a common culture medium commonly used in the field for growing rice koji, and can be synthesized using commercial products or conventional steps and conventional raw materials in the laboratory.

[0075] In some embodiments, in step S21, the initial inoculation density of rice yeast in the culture medium containing organic iron is 10 4 cfu / mL-10 6In fact, by controlling the initial inoculation density of rice koji in the culture medium, it is beneficial to promote the growth of rice koji in the culture medium and to take in enough iron to avoid growth competition caused by too much rice koji.

[0076] In some embodiments, when the rice koji is cultured in a culture medium containing organic iron in step S21, it includes an induction stage, a consolidation stage and a reinforcement stage, and the organic iron concentration in the culture medium increases gradually during the induction stage, the consolidation stage and the reinforcement stage.

[0077] In fact, during the induction stage of cultivation, lower concentrations of organic iron can gently stimulate rice yeast, allowing it to quickly adapt to the presence of organic iron, avoiding excessive stress on the rice yeast, and helping the rice yeast to quickly start the absorption and utilization mechanism of organic iron and begin to synthesize specific iron transport proteins and related metabolic pathways. In addition, low concentrations of organic iron can also promote the growth and metabolism of rice yeast.

[0078] In fact, during the consolidation stage of cultivation, the rice yeast can adapt to a certain concentration of organic iron after the induction stage of cultivation, which helps to improve the intake and utilization of iron by Aspergillus oryzae. At the same time, more iron-containing enzymes in the rice yeast are activated, which can enhance the metabolic function of the rice yeast, enable the rice yeast to utilize the nutrients in the culture medium more efficiently, promote the rapid growth of the rice yeast, and at the same time increase the reserves of organic iron inside the rice yeast.

[0079] In fact, during the intensive stage of cultivation, high concentrations of organic iron can greatly stimulate the absorption of organic iron by rice yeast, while also improving the stress resistance and adaptability of rice yeast, and can effectively cope with oxidative stress in the environment. Specifically, when a large amount of organic iron is input into rice yeast and stored, the rich iron reserves can not only promote the growth and metabolism of Aspergillus oryzae itself, but also promote the enzyme activity of biological enzymes such as protease and cellulase produced by rice yeast fermentation.

[0080] In some embodiments, when the rice koji is cultured in the induction stage in step S21, the initial concentration of organic iron in the culture medium is 10-40 mg / L, when the rice koji is cultured in the consolidation stage, the initial concentration of organic iron in the culture medium is 40-150 mg / L, and when the rice koji is cultured in the reinforcement stage, the initial concentration of organic iron in the culture medium is 150-200 mg / L.

[0081] Specifically, the initial concentration difference of organic iron in the induction stage, consolidation stage and strengthening stage is greater than or equal to 30 mg / L, which is conducive to constructing the concentration gradient of organic iron in different stages, and then conducive to different degrees of organic iron stimulation to rice koji, which is conducive to the intake of organic iron by rice koji.

[0082] In some embodiments, when performing step S21, rice yeast and lactobacillus are co-cultured in a culture medium containing organic iron. In fact, when rice yeast is induced to culture, the ratio of the number of viable inoculated bacteria of rice yeast and lactobacillus on the culture medium is (10-20): 1, so that the dominant position of rice yeast in the growth process can be established, and at the same time, when lactobacillus can take in organic iron during metabolism, and produce composite iron that is more easily absorbed by rice yeast through the metabolic pathway of lactobacillus itself, thereby promoting the utilization efficiency of rice yeast to organic iron.

[0083] In some embodiments, when performing step S21, rice yeast and lactobacillus are co-cultured in an induction phase, a consolidation phase, and a reinforcement phase on a culture medium containing organic iron, so that the rice yeast can be multi-factorially stimulated to absorb and utilize organic iron, thereby absorbing and storing more organic iron. Specifically, the lactobacillus used can be Lactobacillus CCRC12944.

[0084] In fact, when executing step S21, rice yeast and lactobacillus are co-cultivated in the induction phase, consolidation phase and strengthening phase on a medium containing organic iron, the overall cultivation duration is controlled to be 48-72h, and after completing the cultivation, the medium environment is adjusted to an alkaline environment, and the composite rice yeast is obtained after continuing to cultivate for 8-12h. Specifically, the alkaline environment adjusted after completing the co-cultivation can greatly inhibit the growth of lactobacillus, thereby being able to separate and obtain the composite rice yeast.

[0085] In some embodiments, after performing step S21 to obtain the composite rice yeast, the composite rice yeast can be stored at low temperature, so as to facilitate multiple cultivations after one cultivation. Specifically, when using the composite rice yeast stored at low temperature, the composite rice yeast can be grown and activated in a culture medium containing organic iron. Specifically, the composite rice yeast can be stored in a low temperature environment of 4°C.

[0086] In some embodiments, in step S22, the inoculation amount of the composite rice yeast in the puffed rice is 3×10 7 -4×10 7 cfu / g, which is conducive to the rapid growth of the composite rice yeast in the puffed rice by fully utilizing its nutrients and quickly producing bioactive enzymes such as protease, amylase, cellulase, etc., and can also change the flavor substances and nutritional composition structure of the puffed rice. In this way, after being made into bread products, they can have a more unique flavor and richer nutrients.

[0087] In some embodiments, in step S23, the temperature of the fermentation environment is 34°C-38°C and the humidity is 90-95% in a dark environment. In fact, this temperature range is conducive to the fermentation of the composite rice koji, and can also improve the activity of various biological enzymes, which is conducive to enzymolysis of the puffed rice. In addition, the high humidity of the fermentation environment is conducive to the composite rice koji to maintain its own moisture content, thereby maintaining normal metabolism and fermentation activities, and at the same time helps the spore germination and mycelium growth of the composite rice koji, thereby promoting the growth of the composite rice koji, and is conducive to the rapid diffusion of various biological enzymes on the puffed rice.

[0088] In some embodiments, the magnetic field in step S23 is an alternating magnetic field with a frequency of 50-100 Hz. In fact, by fermenting the composite rice yeast in a magnetic field environment, the ion movement and surface potential change in the composite rice yeast can be affected, and the composite rice yeast can be stimulated to carry out metabolic activities, and the composite rice yeast can be promoted to use the iron element stored therein in the alternating magnetic field environment, thereby improving the activity of the biological enzyme produced by the composite rice yeast fermentation, and the composition and nutritional components of the fermentation product of the composite rice yeast can be changed by affecting the metabolic pathway of the composite rice yeast, thereby optimizing the flavor and mouthfeel of the bread.

[0089] In some embodiments, in step S23, the composite rice koji is fermented for 48-72 hours in a fermentation environment and magnetic field, which is conducive to the composite rice koji adapting to the growth of puffed rice and starting its own metabolic activities, thereby producing various biological enzymes to decompose the starch macromolecules in the puffed rice. At the same time, as the fermentation activity continues, the composite rice koji uses the nutrients in the puffed rice for growth and metabolism, and outputs the metabolites into the puffed rice to improve the flavor of the puffed rice. In addition, the fermentation treatment of 48-72 hours can fully ferment the puffed rice, prompting the nutritional components in the puffed rice to be significantly improved, and by controlling the fermentation time, the flavor change of the puffed rice can be controlled.

[0090] In some embodiments, during the fermentation process of the composite rice yeast on the puffed rice, the magnetic field is intermittently applied to the composite rice yeast, and the interval between two adjacent magnetic fields is 4-6 hours. In fact, by setting the intermittent magnetic field, it is possible to provide a periodic stimulation for the growth of the composite rice yeast, avoid excessive stimulation to the composite rice yeast and cause death, and the intermittent period of the magnetic field is conducive to the adjustment and adaptation of the composite rice yeast, so that the composite rice yeast can grow and ferment in a relatively stable state, and promote the composite rice yeast to optimize its own metabolic pathway.

[0091] In fact, in step S3, the fermentation product obtained after the fermentation treatment is vacuum dried at 30-50°C and then ground and pulverized to obtain a bread improver with an average particle size of 200-800nm. In fact, the particle size of the bread improver can be reduced by grinding, thereby improving the dispersibility of the bread improver in the bread product, while avoiding the poor taste caused by the excessive particle size of the bread improver.

[0092] In addition, the present invention also provides a bread improver fermented with rice koji prepared by any of the above optional preparation methods. In fact, the bread improver has fermented puffed rice as a matrix, and a large amount of biological enzymes such as α-proteinase and cellulase are attached to it. After being added to flour and fermented, the biological enzymes can be activated and the starch macromolecules in the flour can be degraded.

[0093] At the same time, the present invention also provides a bread premix, which includes the bread improver fermented by rice koji prepared by any of the above optional preparation methods, and also includes whole wheat flour. In fact, the mass fraction of the bread improver in the bread premix is ​​1-3%. By premixing the whole wheat flour and the bread improver, it is convenient for people to use without the need for people to prepare additional ingredients.

[0094] At the same time, the present invention also provides a frozen dough, which includes the bread improver fermented by rice yeast prepared by any of the above optional preparations, or is prepared by adding water to the above bread premix, kneading, fermenting, and freezing. In fact, making frozen dough is conducive to commercial production and people's consumption without kneading dough by themselves, and it is conducive to ensuring quality consistency.

[0095] Meanwhile, the present invention also provides a whole wheat bread, which is prepared by thawing the frozen dough and then baking it at a high temperature.

[0096] Example 1

[0097] This embodiment 1 provides a method for preparing a bread improver fermented with rice koji, comprising the following steps:

[0098] S1, black rice is ground and pulverized through 40 mesh sieves, after collecting the sieved material, adjusting the moisture content to 35% to obtain black rice powder, the black rice powder is put into an extruder at a feeding rate of 8.0kg / h, the extruder extrude the black rice powder with a screw speed of 130rpm, and the black rice powder is expanded in 70 ℃, 100 ℃, 170 ℃, 170 ℃, 170 ℃ temperature zones successively, collect the material of the extruder at the discharge port, and obtain puffed rice after drying in a hot air drying oven at 45 ℃;

[0099] S2, the puffed rice and potato dextrose broth medium were mixed at a mass volume ratio of 4g / mL, and nutrient balance was carried out at room temperature for 18h, and Aspergillus oryzae M6 was added at 2.5×10 5 cfu / g (compared to puffed rice), and then stirred and mixed, and transferred to a fermentation box at 37°C and 90% humidity for 72 hours of solid-state fermentation; during the fermentation process, the fermented material was turned over every 24 hours, and after the fermentation was completed, the fermented rice was dried at low temperature to obtain the fermented rice;

[0100] S3, drying the fermented rice in a hot air drying oven at 40° C. to a constant weight, and then grinding the fermented rice using a grinder to a mean particle size of 500 nm to obtain a rice koji fermented bread improver.

[0101] Example 2

[0102] This embodiment 2 provides a method for preparing a bread improver fermented with rice koji, which is different from the embodiment 1 in that, in step S2, Aspergillus oryzae M6 is pre-fermented at 2.3×10 5 cfu / mL was inoculated in a potato glucose medium with a pH of 5.5 and an initial concentration of 150 mg / L ferrous gluconate, and cultured in an incubator at 37°C and an oxygen content of 20% for 60 h. During the culture process, the concentration of ferrous gluconate in the medium was adjusted to 140-160 mg / L every 10 h. After the culture was completed, the composite rice koji was collected by centrifugation and the composite rice koji was precipitated at 3.8×10 7 cuf / g was inoculated into puffed rice with a moisture content of 40%, and fermented for 60 hours in a light-shielded environment at 30°C and an alternating magnetic field of 0.3 mT and 50 Hz, and then dried and sterilized to obtain the fermented rice; wherein the alternating magnetic field was applied intermittently, and the application time of each alternating magnetic field was 5 hours, and the interval time was 5 hours.

[0103] Example 3

[0104] This embodiment 3 provides a method for preparing a bread improver fermented with rice koji, which is different from that of embodiment 2 in that, in step S2, Aspergillus oryzae M6 is pre-fermented at 2.3×10 5 cfu / mL was inoculated in a potato glucose medium with a pH of 5.5 and an initial concentration of 20 mg / L ferrous gluconate for 8 hours of induction stage culture, and then the concentration of ferrous gluconate in the medium was adjusted to 100 mg / L and the induction stage culture was carried out for 40 hours. During the induction culture, the concentration of ferrous gluconate in the medium was adjusted to 90-110 mg / L every 10 hours, and then the concentration of ferrous gluconate in the medium was adjusted to 160 mg / L and 7 hours of intensive stage culture was carried out.

[0105] Example 4

[0106] This embodiment 4 provides a method for preparing a bread improver fermented with rice koji, which is different from that of embodiment 2 in that, in step S2, Aspergillus oryzae M6 is pre-fermented with 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 The cells were co-inoculated at a density of 1.5 cfu / mL into potato dextrose medium with a pH of 5.5 and an initial concentration of 150 mg / L ferrous gluconate.

[0107] Example 5

[0108] This embodiment 5 provides a method for preparing a bread improver fermented with rice koji, which is different from that of embodiment 4 in that, in step S2, Aspergillus oryzae M6 is pre-fermented with 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL were co-inoculated in a potato glucose medium with a pH of 5.5 and an initial concentration of 20 mg / L ferrous gluconate for 8 hours of induction stage culture, and then the concentration of ferrous gluconate in the medium was adjusted to 100 mg / L and the induction stage culture was carried out for 40 hours. During the induction culture, the concentration of ferrous gluconate in the medium was adjusted to 90-110 mg / L every 10 hours, and then the concentration of ferrous gluconate in the medium was adjusted to 160 mg / L and 7 hours of intensive stage culture was carried out.

[0109] Example 6

[0110] This Example 6 provides a method for preparing a bread improver fermented with rice koji, which is different from Example 5 in that, in step S1, after drying in a hot air drying oven at 45°C, the rice is irradiated with far infrared rays at 160°C for 480s and cooled to room temperature to obtain puffed rice.

[0111] Example 7

[0112] This embodiment 7 provides a method for preparing a bread improver fermented with rice koji, which is different from that of embodiment 5 in that, in step S1, after drying in a hot air drying oven at 45°C, the mixture is dried at 160°C and a flow rate of 2.3 m 3 / h of superheated steam for 950s and then cooled to room temperature to obtain puffed rice.

[0113] Comparative Example 1

[0114] This comparative example 1 provides a method for preparing a bread improver fermented with rice koji, which is different from Example 1 in that step S1 is not performed, and in step S2, black rice and potato dextrose broth medium are directly mixed at a mass volume ratio of 4 g / mL.

[0115] Performance Testing

[0116] 1.0 g of the bread improver prepared in Example 1 to Example 7 was weighed respectively, and 20 mL of sodium citrate buffer (50 mmol, pH 5.5) was added and stirred, and then extracted at 30° C. for 30 min, and then centrifuged at 4° C. to obtain a crude enzyme solution, and the enzyme activity in the crude enzyme solution was measured. The measurement method is as follows, and the measurement results are shown in Table 1.

[0117] α-Amylase: Take 250 μL crude enzyme solution and 1.75 mL 1% soluble starch solution respectively, stir and react in a 50°C water bath for 10 min, immediately add 4 mL 3,5-dinitrosalicylic acid reagent and boil in a water bath for 5 min, then add deionized water to make the volume 10 mL, cool to room temperature, measure the absorbance at 540 nm, and calculate the unit enzyme activity of α-amylase in the crude enzyme solution according to the standard curve (with glucose as the standard);

[0118] Protease: Take 2 mL of crude enzyme solution and 2 mL of 1% casein solution, stir and react in a 40°C water bath for 15 min, add 4 mL of 0.4 mol / L trichloroacetic acid solution to terminate the reaction and let stand for 30 min, then centrifuge at 12000 rpm for 5 min to collect the supernatant, measure the absorbance of the supernatant at 280 nm, and calculate the unit enzyme activity of the protease in the crude enzyme solution according to the standard curve (with tyrosine as the standard);

[0119] Cellulase: Take 1 mL of crude enzyme solution and 2 mL of sodium citrate buffer (0.1 mol / L, pH 4.8) and mix them evenly to prepare enzymatic solution. Add 0.1 g of filter paper strip with a size of 1.0 cm × 6.0 cm and 1 mL of 0.5% solution of sodium carboxymethyl cellulose to the enzymatic solution respectively, and stir the mixture in a 50°C water bath for 1 h. Immediately add 4 mL of 3,5-dinitrosalicylic acid reagent and boil it in a boiling water bath for 5 min. Then add deionized water to make the volume 10 mL. After cooling to room temperature, measure the absorbance at 540 nm, and calculate the unit enzyme activity of cellulase and carboxymethyl cellulase in the crude enzyme solution according to the standard curve (with glucose as the standard).

[0120] Table 1 Enzyme activities in bread improvers

[0121] α-Amylase (U / g) Protease (U / g) Cellulase (U / g) Example 1 382.3 324.5 14.8 Example 2 413.4 349.9 18.6 Example 3 436.9 365.8 22.6 Example 4 452.6 388.6 26.9 Example 5 481.6 403.5 34.8 Example 6 486.9 405.6 36.8 Example 7 488.6 406.7 37.0 Comparative Example 1 192.4 212.5 5.9

[0122] Combining Example 1 with Comparative Example 1 and Table 1, it can be seen that after the black rice powder is extruded and puffed in advance in Example 1, starch gelatinization and protein denaturation can be promoted, and the molecular structure of the black rice powder can be made looser, which is beneficial to the fermentation of rice koji in puffed rice, and further can improve the activity of α-amylase, protease and cellulase produced by the fermentation of rice koji.

[0123] In combination with Example 1 and Example 2, and as can be seen from Table 1, in Example 2, by culturing Aspergillus oryzae M6 in an organic iron culture medium, Aspergillus oryzae M6 can be prompted to absorb organic iron, and organic iron can participate in the fermentation and metabolic process of Aspergillus oryzae, and then the activities of α-amylase, protease and cellulase produced in the fermentation process under the magnetic field environment are significantly higher than those in Example 1, which can illustrate that the addition of organic iron can promote the physiological activity of Aspergillus oryzae M6.

[0124] In conjunction with Example 2 and Example 3, and as can be seen from Table 1, when Aspergillus oryzae M6 is cultivated in an organic iron culture medium in Example 3, organic iron is divided into three stages and the concentration gradient is changed, which can effectively improve the intake of organic iron by Aspergillus oryzae M6, which can further illustrate that the concentration of organic iron in Aspergillus oryzae M6 is positively correlated with the enzyme activity of the produced biological enzyme. At the same time, it can also be verified that Aspergillus oryzae is cultivated in multiple concentration gradients, which contributes to its absorption and utilization of materials such as organic iron.

[0125] Combining Example 2 and Example 4, and from Table 1, it can be seen that in Example 4, Aspergillus oryzae M6 and Lactobacillus CCRC12944 are co-cultured, and the growth of Aspergillus oryzae M6 and the intake of organic iron can be promoted through the symbiotic effect of the strains, thereby ultimately improving the activity of the biological enzymes produced by fermentation.

[0126] In combination with Examples 2 to 5, it can be seen from Table 1 that by using a multi-stage organic iron concentration gradient for cultivation and supplemented by the co-cultivation of lactobacillus, the growth rate of Aspergillus oryzae M6 can be greatly improved and the fermentation and enzyme production of Aspergillus oryzae M6 can be promoted, while the activity of the produced α-amylase, protease and cellulase can also be improved.

[0127] In combination with Example 5 to Example 7, it can be seen from Table 1 that after extrusion puffing of the black rice powder, the starch gelatinization and protein denaturation therein can be greatly promoted. Therefore, after adding far-infrared irradiation and superheated steam treatment, although the puffed rice can be further gelatinized and denatured, the final effect on the enzyme activity is not significant.

[0128] The preparation process of dough and bread is as follows: weigh 2 grams of the bread improver of Examples 1-7, and mix them evenly with 198 grams of bread flour to obtain dry materials; mix 4 grams of dry yeast and 56 grams of water evenly, place them in a fermentation box, and activate them at 37°C for 10 minutes; add the activated yeast to the dry materials, add 56 grams of water, and stir for 8 minutes to obtain dough; divide the dough into 6 small doughs of 40 grams each, put them into a 50mm×50mm×50mm mold, and proof them in a proofing box at 37°C for 1 hour; take out the proofed dough, use an electric oven to select the hot air convection mode, and bake at 190°C for 13 minutes; after baking, take out the bread in the mold, cool it at room temperature for 1 hour, and then measure it.

[0129] The free thiol content in the dough was determined by Gu Miaomiao (Gu Miaomiao. Study on the Effect of Flavor Protease on Bread Quality [D]. Jiangnan University, 2022.) before and after proofing. TGE buffer solution: 86mM Tris-HCl (pH 8.0), 92mM glycine and 4.1mM EDTA. SDS-TGE extraction buffer solution: 2.5% SDS (w / v) TGE solution. Color development buffer solution: 20mg 5,5'-dithio-2-nitrobenzoic acid was dissolved in 5mL SDS-TGE buffer. 50mg freeze-dried dough powder was mixed and shaken with 4mL SDS-TGE buffer to fully dissolve. 0.04mL of color development buffer was added and vortexed to mix. After 30min of reaction in the dark, the supernatant was centrifuged and the absorbance was tested at 412nm. The standard curve was drawn with reduced glutathione as the standard for quantitative analysis. The results are shown in Table 2.

[0130] Table 2 Free sulfhydryl content of dough

[0131] Before fermentation (μg / g) After fermentation (μg / g) Example 1 596 1065 Example 2 612 1086 Example 3 632 1103 Example 4 651 1136 Example 5 662 1158 Example 6 693 1191 Example 7 698 1121

[0132] The bread corresponding to Examples 1 to 7 was tested for the following items:

[0133] Specific volume: After weighing the bread, the rapeseed displacement method was used to calculate the volume of the bread and the specific volume of the bread. At the same time, the bread was cut using a bread slicer and the middle slice was taken. The sample was scanned with an image scanner at a resolution of 300 dpi and analyzed using Image J software. The scanned image was converted into an 8-bit grayscale binary image and a 20×20 mm 2 The porosity of the bread crumb was measured at the center of the bread (total pore area / viewing area, %). The results are shown in Table 3 below.

[0134] Table 3 Physical and chemical indicators of bread

[0135] <![CDATA[Specific volume (cm 3 / g)]]> Porosity (%) Example 1 3.8 25.5 Example 2 4.2 28.2 Example 3 4.5 30.3 Example 4 4.8 32.6 Example 5 5.0 35.6 Example 6 5.3 38.5 Example 7 5.4 38.8

[0136] As can be seen from Table 2, the free thiol content of the dough before and after proofing is significantly increased, which indicates that the gluten protein depolymerizes during the proofing process of the dough, resulting in the cleavage of disulfide bonds, thus showing an increase in the free thiol content. In fact, the data shown in Table 2 are consistent with the data in Table 1, which shows that the α-amylase, protease and cellulase produced by Aspergillus oryzae M6 are strongly correlated with the depolymerization of gluten protein, which shows that the bread modifier provided by the present invention can hydrolyze the gluten protein in the dough to reduce the hardness of the dough and weaken the gluten network to make the gluten film thinner, thereby obtaining a softer bread product with a more uniform internal structure.

[0137] In addition, it can be seen from Table 3 that the bread produced using the bread improver provided by the present invention has a higher specific volume and porosity, which indicates that the biological enzyme present in the bread improver can hydrolyze starch and produce small molecular sugar substances, thereby promoting yeast fermentation and increasing the specific volume and porosity of the bread.

[0138] Although the embodiments of the present invention are described in detail above, it is obvious to those skilled in the art that various modifications and variations can be made to these embodiments. However, it should be understood that such modifications and variations are within the scope and spirit of the present invention as described in the claims. Moreover, the present invention described herein may have other embodiments and may be implemented or realized in a variety of ways.

Claims

1. A method for preparing a bread improver fermented with rice koji, characterized in that: include: The rice is extruded and puffed, then fermented with rice koji, and then dried and crushed to obtain a bread improver fermented with rice koji.

2. The preparation method according to claim 1, characterized in that: The rice includes at least one of brown rice, white rice, black rice, purple rice and red rice; And / or, the rice yeast includes Aspergillus oryzae M6, which has been deposited in China Center for Type Culture Collection on April 12, 2023, with a deposit number of CCTCC NO: M2023533, and the deposit address is Wuhan University, Wuhan, China; And / or, the average particle size of the bread improver is 200-800nm.

3. The preparation method according to claim 1 or 2, characterized in that: The following steps are involved: Extruding and puffing rice powder to obtain puffed rice; Inoculating rice yeast into puffed rice with a moisture content of 35-50% and performing fermentation treatment in a fermentation environment; The rice yeast fermented bread improver is obtained after drying and crushing.

4. The preparation method according to claim 3, characterized in that: The rice yeast is cultured in a medium containing organic iron for 48-72 hours and then the composite rice yeast is collected; Inoculate the composite rice yeast into puffed rice with a moisture content of 35-50%; The fermentation process was carried out in a fermentation environment and a magnetic field of 0.3mT-0.4mT.

5. The preparation method according to claim 4, characterized in that: The organic iron comprises at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate; And / or, the concentration of the organic iron in the culture medium is 10 mg / L-200 mg / L; and / or, the culture medium comprises potato dextrose medium; And / or, the initial inoculation density of the rice koji in the culture medium is 10 4 cfu / mL-10 6 cfu / mL; And / or, culturing the rice koji in a culture medium containing organic iron comprises an induction stage, a consolidation stage and a reinforcement stage, and the concentration of organic iron in the culture medium increases gradually during the induction stage, the consolidation stage and the reinforcement stage; and / or, co-culturing rice yeast and lactic acid bacteria in a culture medium containing organic iron and then centrifuging to obtain composite rice yeast; And / or, the inoculation amount of the composite rice yeast in the puffed rice is 3×10 7 cfu / g-4×10 7 cfu / g; And / or, the temperature of the fermentation environment is 34°C-38°C; And / or, the humidity of the fermentation environment is 90%-95%; And / or, the fermentation environment is a light-proof environment; And / or, the frequency of the magnetic field is 50 Hz-100 Hz; and / or, inoculating the composite rice yeast into the puffed rice for fermentation for 48-72 hours; And / or, during the fermentation process, the magnetic field is intermittently applied to the composite rice yeast, and the interval between two adjacent magnetic fields is 4-6 hours.

6. The preparation method according to claim 3, characterized in that: The rice powder is extruded and puffed, and then irradiated with far infrared rays for 470-490 seconds and then cooled to room temperature to obtain puffed rice, and the puffed rice is mixed with a fermentation substrate and then inoculated with rice yeast, and fermented in a fermentation environment; Or, after extruding the rice powder, use the temperature at 150-170℃ and the flow rate at 2.0-2.5m 3 / h of superheated steam for 900-1000s and then cooled to room temperature to obtain puffed rice, the puffed rice is mixed with a fermentation substrate and then inoculated with rice yeast, and fermented in a fermentation environment.

7. A bread improver fermented with rice koji obtained by the preparation method according to any one of claims 1 to 6.

8. A bread premix, characterized in that: The bread improver comprises the bread improver fermented with rice koji prepared by the preparation method according to any one of claims 1 to 6 or the bread improver fermented with rice koji according to claim 7; preferably, the mass fraction of the bread improver is 1-3%.

9. A frozen dough, characterized in that: The invention comprises a bread improver fermented with rice koji prepared by the preparation method according to any one of claims 1 to 6, or a bread improver fermented with rice koji as claimed in claim 7, or a bread improver obtained by mixing the bread premix according to claim 8 with water and then fermenting with yeast.

10. A whole wheat bread, characterized in that: The product is prepared by thawing the frozen dough according to claim 9 and baking it at high temperature.

Images