Construction method and application of high-salt-resistance metarhizium anisopliae strain for synthesizing glycine betaine

Abstract

The invention discloses a construction method and application of a high-salt-resistance metarhizium anisopliae strain for synthesizing glycine betaine, and belongs to the technical field of strain application. The construction method of the strain comprises the following steps: introducing choline dehydrogenase and betaine aldehyde dehydrogenase coding genes into an expression vector to obtain recombinant expression plasmids, transferring the recombinant expression plasmids into original metarhizium anisopliae, and carrying out kanamycin screening and PCR verification to obtain the strain. The invention has the beneficial effects that the invention provides the construction method of the high-salt-resistance metarhizium anisopliae strain for synthesizing glycine betaine, and provides the application of the strain in pest control in a high-salt environment. Glycine betaine can improve the coping capacity of the strain to a high-salt environment and salt stress, and can improve the drought resistance of plants, the survival capacity of the plants in the high-salt environment and the resistance of the plants. The method responds to national policies, the application range of metarhizium anisopliae is widened, and rapid development of biopesticides is promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of strain application, and specifically relates to a construction method and application of a highly salt-resistant Metarhizium anisopliae strain capable of synthesizing glycine betaine. Background Art

[0002] In the production of Metarhizium muscardine, preparations of Metarhizium anisopliae variants are mainly used to control pests, such as underground pests, stem borers, peach borer, coconut leaf beetle, migratory locusts, cabbage moth, cabbage looper and tomato bollworm, as well as sanitary pests such as mosquito larvae and mosquito larvae in small water bodies.

[0003] Glycine betaine can be used as an osmotic regulating substance in plants to help plant cells maintain water balance and reduce the impact of drought on plants; for plant resistance to salt stress, in a high-salt environment, the accumulation of glycine betaine can help plant cells maintain a stable osmotic pressure and reduce water loss, thereby reducing the damage of salt stress to plants. In addition, during the long-term evolution of plants, plants have derived a series of defense mechanisms to cope with heavy metal ion pollution, among which betaine can effectively alleviate the toxic effects on plants. In a low-temperature environment, glycine betaine can protect the structure of plant cell membranes, reduce cell membrane rupture and ion leakage caused by low temperature, and improve the plant's resistance to low temperatures. Choline dehydrogenase is an enzyme in organisms that catalyzes the reaction of choline and acetic acid to produce betaine.

[0004] The growth rate of Metarhizium anisopliae is reduced in a high-salt environment, and the formation and vitality of spores are inhibited, which limits its application in saline-alkali land. However, there is no report on how to construct a strain of Metarhizium anisopliae with high salt resistance. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to improve the adaptability of Metarhizium anisopliae in a high-salt environment.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] The first aspect of the present invention provides a method for constructing a highly salt-resistant green anisopliae strain that synthesizes glycine betaine, firstly introducing choline dehydrogenase and betaine aldehyde dehydrogenase encoding genes into an expression vector to obtain a recombinant expression plasmid, then transferring the recombinant expression plasmid into the original green anisopliae, and then screening with kanamycin and verifying with PCR to obtain;

[0008] The nucleotide sequence of the choline dehydrogenase encoding gene is shown in SEQ ID No: 1, and the nucleotide sequence of the betaine aldehyde dehydrogenase encoding gene is shown in SEQ ID No: 2.

[0009] Preferably, the method specifically comprises the following steps:

[0010] (1) According to the DNA sequences of choline dehydrogenase and betaine aldehyde dehydrogenase in the NCBI database, primers were designed and PCR was performed to amplify the genes encoding choline dehydrogenase and betaine aldehyde dehydrogenase;

[0011] (2) connecting the choline dehydrogenase and betaine aldehyde dehydrogenase encoding genes to the pET-28a(+) empty plasmid vector, transforming the ligation product into the competent Escherichia coli DH5α, culturing, verifying the correct positive transformants, and then extracting the recombinant expression plasmid;

[0012] (3) The chemical transformation method was used to prepare Metarhizium competent cells, and the recombinant expression plasmid was transferred into the Metarhizium competent cells. After culturing for a period of time, the cells were cultured in a culture medium containing kanamycin to screen out strains with a higher survival rate. PCR verification was then performed to obtain highly salt-resistant Metarhizium strains.

[0013] Preferably, in step (1), the amplification primers for the choline dehydrogenase encoding gene include betA-F and betA-R; the amplification primers for the betaine aldehyde dehydrogenase encoding gene include betB-F and betB-R; the sequences of betA-F, betA-R, betB-F, betB-R are shown in SEQ ID Nos: 3 to 6.

[0014] Preferably, the ligation system in step (2) is 1uL of linearized vector, 6uL of inserted fragment, 4uL of 5×CE MultiS Buffer Exnase MultiS, and 2uL of ddH2O.

[0015] Preferably, the reaction conditions for the connection in step (2) are 37° C. for 30 min.

[0016] Preferably, the primers for PCR verification in step (3) are query_L1, query_R1, query_L2, query_R2, and the sequences of query_L1, query_R1, query_L2, query_R2 are shown in SEQ ID Nos: 7 to 10.

[0017] Preferably, the PCR reaction program in the PCR verification in step (3) is: 95°C, 3 min, 1 cycle; 95°C, 15 sec, 56°C, 15 sec, 72°C, 1 min, 30 cycles; 72°C, 5 min, 1 cycle; 16°C, forever, 1 cycle.

[0018] Preferably, the original Metarhizium is Metarhizium anisopliae, and its preservation number is CGMCC 3.11979.

[0019] The second aspect of the present invention provides a highly salt-resistant Metarhizium anisopliae strain obtained by the above construction method.

[0020] The third aspect of the present invention proposes the use of the above-mentioned highly salt-resistant Metarhizium strain in controlling pests in a high-salt environment.

[0021] The beneficial effects of the present invention are:

[0022] The present invention proposes a method for constructing a highly salt-resistant green muscardine strain that synthesizes glycine betaine, and proposes the application of the strain in pest control in a high-salt environment. Glycine betaine can improve the strain's ability to cope with high-salt environments and salt stress, and at the same time can improve the plant's drought resistance, ability to survive in a high-salt environment, and improve resistance. Therefore, in order to respond to national policies, increase the scope of application of green muscardine, and promote the vigorous development of biological pesticides, it is currently very necessary to construct a green muscardine that can be used in a high-salt and salt-stressed environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the PCR graph of the positive transformant strain of Metarhizium anisopliae in Example 3 of the present invention;

[0024] Figure 2 This is a comparison chart of the stress resistance of the recombinant Metarhizium and the original Metarhizium in a high-salt environment in Example 4 of the present invention;

[0025] Figure 3 This is the mass spectrum of the product of the recombinant green muscardine in Example 4 of the present invention in a high-salt environment. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0028] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0029] Embodiment 1:

[0030] Construction of betA and betB recombinant plasmids

[0031] According to the DNA sequence of choline dehydrogenase in the NCBI database, the choline dehydrogenase expression gene was synthesized and the target protein coding gene was amplified. The bet A gene ID is 881124, and the bet B gene ID is 881619. The specific CDS sequences are as follows

[0032] bet A:tcaggcccgc acggggttgc cgcgtaccgg cgcatccccg gccacgtagtacttcgccgt gctgcgcggc agcggctggc gaccgcggat cctgtcggcg atcttctcgg ccatcatgatggtggtggca ttgaggttgc cggtgatgat cagcggcatg atcgacgcatccaccactcg cagtccttccatgccatgga cccgtccctg gccatcgacc accgccatgt cgtcgctgcc catcttgcacgagcaggatgggtggaaagc ggtctcagca tggttgcgga tgaactcgtc gagttcggcg tccgactgcacgctcacccc agggctcaac tcgcggccccgataggggtc cagcgccggc tggttcatga tctcgcgggtcagccggatg ccgtcgcgga actcctgcca gtcctgctcg tgggacatgtagttgaacag gatgctcggatgctggcgcg ggtccctgga cttcaggtgg atgcgcccgc ggctcggcga gcgcatcgagcccatgtgcgcctggaagcc gtgctcctgc acgcccttgc tgccgttgta gttgatcgcc accgggaggaaatggaactg gatgttcggc cattcgaacgcttcgcgggt tcggatgaag ccgccggcct cgaactggttgctggcgccg aggcccttgc cgaggaacag ccactgggca ccgatggcaggctggttcca ccatttggtcgccgggtaga tcgacaccgg ctgcttgcag gcgtactgca ggtagagttc caggtgatcctgcaggttggcgccgacgcc cggcaggtca tgcaccaccg ggatgtccag gtcgcgcagc agggccgccgggccgacgcc ggagcgttgc agcaattgcggcgaggcgat cgcgccgctg cacaccaatacttcgcggcgggcgtgggcg gtgaccgggt tgtcgccgtt gcccaccagg taggagacgccgatggcgcg cttgccgctgaacaggatgc ggtcgctcag ggcgtgggtg acgatggtca ggttgggccg gccgcgggcctggtccaggtagccgcgccc ggtggcggcg cgacggccct ccggggtgac ggtccggtcc atggggccgaagccttcctg ctggtagccg ttgaggtcatcggttcgcgg gtagccggcc tgcacgccgg cctcgaccatcgcatggaac agtgggttgt tgccggcctt cggcgtggtc acgctgaccgggccgtcgcc gccatggtagtcgttggggc cgatgtcccg ggtttccgcc ttgcggaagt acggcaggcagtcgaggtagctccagtcctcgaggcccgg ctccttggcc cagccgtcga agtccagggc gttgccgcgg atgtagcacatgccgttgat cagcgaggag ccgcccaggcccttgccgcg accgcactcc atgcggcggt tgttcatgtagggctcgggg tcggtctcgt aggcccagttgtagcgccgc ccctgcagcgggaaggcaag ggccgccggcatctgggtgc ggaagtcgaa gcggtagtcg ggaccgccgg cttcgagcag caggacgctgacgtcggcatcttcggtgaggcgggtagcg agtacgttac cggcagagcc ggctccgatg atgatgtagtcgaattcctg ggacat(SEQ ID No:1)

[0033] bet B:atggcccgat tcgaagaaca gaagctctac attggcggtc gctacgtggaggccagcagt ggcgccacct tcgagaccat caacccggcc aacggcgaag tgctcgccaa ggtccagcgggcttccaggg aagacgtcga gcgggccgtg cagagcgccg tcgaggggcagaaggtgtgg gcggcgatgaccgccatgca gcgctcgcgc attctccgtc gcgccgtcga catcctccgc gagcgcaacgacgaactggctgccctggaa accctggata ccggcaagcc gctggcggaa acccgctcgg tggacatcgtcaccggcgcc gacgtgctcg agtactacgccggcctggtc ccggccatcg aaggcgagca gattcccctgcgcgaaacca gtttcgtcta cacccgccgc gagccgctgg gcgtggtcgccggcattggc gcctggaactacccggtgca gatcgccctg tggaaatccg ccccggccct cgctgccggc aacgcgatgatcttcaagcccagcgaagtc accccgctga cggccctcaa gctggccgag atctacaccg aggccggcgtgccggacggc gtgttcaacg tgctcaccggcagcggacgc gaagtcggcc agtggctgac cgagcacccgctgatcgaga agatctcctt caccggtggc acctccaccg gcaagaaagtcatggccagc gcttccagctcgtcgctgaa ggaagtgacc atggagctgg gcggcaagtc cccgctgatc atcttccccgacgcagacctcgaccgcgcc gccgacatcg ccgtcatggc caacttcttc agctccggcc aggtctgcaccaacggcacc cgggtgttca tccaccgttcccagcaggct cgcttcgaag ccaaggtactggagcgcgtgcagcgcatcc gtctcggcga cccgcaggac gagaacacca acttcggcccgctggtcagc ttcccgcacatggaaagcgt gctcggctac atcgagtccg gcaaggcgca gaaggctcgc ctgctgtgcggcggcgagcgtgtgaccgat ggagcgttcg gcaaaggtgc ctacgtcgcg ccgaccgtgt tcaccgattgccgcgacgacatgaccatcg tccgcgaggaaatcttcggc ccggtgatga gcatcctggt ctatgacgacgaagacgagg cgatccgccg cgccaacgat accgagtacg gcctcgccgccggcgtcgtg acccaggacctggcccgcgc ccaccgcgcc atccatcgcc tggaagccgg catctgctggatcaatacctggggcgagtcgccggcggaa atgccggcggaa gcggttacaa gcaatccggt gtcggtcgcg agaacggtctcaccaccctg gctcattaca ctcgcatcaagtccgtgcaa gtggagctgg gcgactacgc ctcggtgttctga(SEQ ID No: 2)

[0034] (I) Primer design

[0035] Primer name Sequence(5'-3') betA-F TCAGGCCCGCACGGGGTTGC (SEQ ID No: 3) betA-R ATGTCCCAGGAATTCGACTA(SEQ ID No: 4) betB-F ATGGCCCGATTCGAAGAACA(SEQ ID No: 5) betB-R TCAGAACACCGAGGCGTAGT (SEQ ID No: 6)

[0036] (II) Amplification of target protein gene fragment

[0037] The target gene fragment was amplified by PCR using Novagen 2×Taq Master Mix (Dye Plus) (P111). 1% agarose gel was used to verify whether the target fragment was correct, and the target fragment was purified and recovered using a gel recovery kit for subsequent experiments.

[0038] PCR amplification system (50uL):

[0039]

[0040]

[0041] BIO-RAD PCR Amplification Procedure:

[0042]

[0043] (III) Enzyme digestion of pET-28a(+) empty plasmid vector

[0044] Enzyme digestion system 50uL

[0045]

[0046] Reaction conditions of enzyme digestion: 37°C water bath digestion for 30 min, 1% agarose gel to verify whether the plasmid vector is completely digested, and the completely digested plasmid is purified and recovered using a gel recovery kit.

[0047] (IV) Fragment and plasmid ligation

[0048] 1uL of the digested plasmid was mixed with 3uL of each target gene fragment, and the mixture was connected using the ClonExpress MultiS One Step Cloning Kit (C113-01) of Novozymes, and the connection product was transformed into the competent Escherichia coli DH5α (Vidy Biotech DL1001), according to the method in the product manual.

[0049] Connection system and reaction conditions:

[0050]

[0051] (V) Colony PCR verification of positive transformants

[0052] When a single colony grows on the plate, pick up the colony with a sterile pipette tip and place it in 1 mL of fermentation medium for 6 hours. When the bacterial solution becomes turbid, perform colony PCR verification using the bacterial suspension as a template to verify whether the transformant is successfully connected. Verify the correct positive transformant, perform shake flask culture, extract the plasmid and proceed to the next step. The colony PCR verification primers for the positive transformant are the target gene amplification primers, and the PCR procedure is the same.

[0053] PCR amplification system (20uL):

[0054] Template DNA 0.4uL Primer F / R 0.8uL each 2×Taq Master Mix 10uL water 8uL Overall system 20uL

[0055] (VI) Extraction of betA and betB recombinant plasmids

[0056] The obtained positive transformants were inoculated into 30 mL of fermentation medium for overnight expansion. 4 mL of bacterial solution was extracted using the Endo-Free Plasmid Mini Kit (OMEGAD6948) plasmid extraction kit to extract the recombinant plasmid betA and stored at -20°C for later use.

[0057] Embodiment 2:

[0058] Transformation of Metarhizium anisopliae

[0059] The original strain used was Metarhizium anisopliae (accession number: CGMCC3.11979)

[0060] (I) Preparation of competent cells

[0061] The chemical transformation method was performed according to the instructions of Shanghai Sangon Biotechnology Super Competent Cell Preparation Kit.

[0062] Use the strain stored in the ultra-low temperature refrigerator to streak on the YPD plate, place it in a 37℃ incubator and culture it for 12-16 hours until the colony grows to 1-2mm in size. Pick a colony that is growing normally, inoculate it into 10-15ml fermentation medium, and culture it in a 37℃ shaker with full shaking (≥250rmp) for 12-16 hours. Take 0.5ml of the activated bacterial solution and inoculate it into the prepared 50ml BT Media, and shake it in a 37℃ shaker until the bacterial solution OD reaches 0. 600 =0.5-0.6. Centrifuge at 4°C, 3500-5000rpm for 5min to collect bacterial precipitate. Gently resuspend the bacterial precipitate with 16ml ice-cold BT Buffer A for every 50ml culture, and place on ice for 10-15min. Centrifuge at 4°C, 3500-500rpm for 2-5min to collect bacterial precipitate. Gently resuspend the bacterial precipitate with 4ml ice-cold BT Buffer B for every 50ml bacterial precipitate, and dispense 100μl per tube into 1.5ml centrifuge tubes precooled on ice. The bacterial cells can be used directly for transformation or stored in an ultra-low temperature refrigerator after quick freezing with liquid nitrogen.

[0063] (II) Transformation of recombinant plasmid into Metarhizium anisopliae

[0064] Thaw the competent cells taken out of the ultra-low temperature freezer on ice. Add 100pg-10ng of betA and betB plasmids to be transformed to each competent tube, mix gently, and let stand on ice for 30min. Incubate the centrifuge tube in a 42℃ water bath for 45-90sec, and immediately put it on ice for 2-3min after taking it out. Add 800-900μl of kanamycin-free fermentation medium preheated to 37℃, and mix by inversion. Incubate slowly on a 37℃ shaker for 45-60min.

[0065] Embodiment 3:

[0066] Screening of positive transformants of Metarhizium anisopliae

[0067] (I) Strain screening

[0068] After the strains were spread on a culture medium containing kanamycin and cultured for 24 hours, plates with a higher survival rate of the strains were selected and the strains on the plates were selected for PCR verification.

[0069] (II) PCR verification of positive transformants

[0070] The PCR verification primers for positive transformants are query_L1, query_R1, query_L2, query_R2. The PCR system is 20uL.

[0071] Table 3 is the primers for positive transformant verification

[0072] Primer name Sequence(5'-3') query_L1 TAATACGACTCACTATAGGG(SEQ ID No: 7) query_R1 GCTAGTTATTGCTCAGCGG (SEQ ID No: 8) query_L2 gccatcgaccaccgccatgt(SEQ ID No: 9) query_R2 gcctgcaagcagccggtgtc(SEQ ID No: 10)

[0073] PCR amplification system

[0074]

[0075]

[0076] PCR reaction procedure

[0077]

[0078] The amplified target fragment was detected by agarose gel (1%)

[0079] Experimental Results Figure 1 This indicated that the plasmid was successfully transformed into Metarhizium anisopliae.

[0080] Embodiment 4:

[0081] Identification of the ability of salt resistance and glycine betaine production of positive transformants of Metarhizium anisopliae

[0082] YPD medium was used to adjust its salinity. Under the condition of ensuring that the pH of the medium was 9.0, NaCl was added to the medium exogenously to make the NaCl concentration in the medium 2.0 mol / L. Green muscardine was inoculated into the fermentation medium and cultured at 37°C in a constant temperature shaker at 200 r / min for 6 h. The bacterial OD 600 =1.0, then take 20mL of bacterial solution and add it to the above culture medium. Add wild-type Metarhizium muscardine bacterial solution (i.e., original Metarhizium muscardine strain) to the control group. After the culture medium is incubated at 37℃ for 4 days, observe the growth of the colony and identify the recombinant Metarhizium muscardine strain with strong salt resistance.

[0083] Experimental Results

[0084] Figure 2 ,3 The experimental results showed that the survival ability of the recombinant green muscardine strain in a high-salt environment was significantly improved compared with the original strain. Mass spectrometry results showed that the recombinant strain successfully produced glycine betaine.

[0085] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a highly salt-resistant Metarhizium anisopliae strain that synthesizes glycine betaine, characterized in that: First, the choline dehydrogenase and betaine aldehyde dehydrogenase coding genes are introduced into the expression vector to obtain the recombinant expression plasmid, and then the recombinant expression plasmid is transferred into the original green anisopliae, and then the recombinant expression plasmid is screened by kanamycin and verified by PCR. The nucleotide sequence of the choline dehydrogenase encoding gene is shown in SEQ ID No: 1, and the nucleotide sequence of the betaine aldehyde dehydrogenase encoding gene is shown in SEQ ID No:

2.

2. The construction method according to claim 1, characterized in that: The specific steps include: (1) According to the DNA sequences of choline dehydrogenase and betaine aldehyde dehydrogenase in the NCBI database, primers were designed and PCR was performed to amplify the genes encoding choline dehydrogenase and betaine aldehyde dehydrogenase; (2) connecting the choline dehydrogenase and betaine aldehyde dehydrogenase encoding genes to the pET-28a(+) empty plasmid vector, transforming the ligation product into the competent Escherichia coli DH5α, culturing, verifying the correct positive transformants, and then extracting the recombinant expression plasmid; (3) The chemical transformation method was used to prepare Metarhizium competent cells, and the recombinant expression plasmid was transferred into the Metarhizium competent cells. After culturing for a period of time, the cells were cultured in a culture medium containing kanamycin to screen out strains with a higher survival rate. PCR verification was then performed to obtain highly salt-resistant Metarhizium strains.

3. The construction method according to claim 1, characterized in that: In step (1), the amplification primers for the choline dehydrogenase encoding gene include betA-F and betA-R; the amplification primers for the betaine aldehyde dehydrogenase encoding gene include betB-F and betB-R; the sequences of betA-F, betA-R, betB-F, betB-R are shown in SEQ ID Nos: 3 to 6.

4. The construction method according to claim 1, characterized in that: The connection system in step (2) is 1uL of linearized vector, 6uL of inserted fragment, 4uL of 5×CE MultiS Buffer Exnase MultiS, and 2uL of ddH2O.

5. The construction method according to claim 1, characterized in that: The reaction conditions for the connection in step (2) are 37° C. for 30 min.

6. The construction method according to claim 1, characterized in that: The primers for PCR verification in step (3) are query_L1, query_R1, query_L2, query_R2, and the sequences of query_L1, query_R1, query_L2, query_R2 are shown in SEQ ID Nos: 7 to 10.

7. The construction method according to claim 1, characterized in that: The PCR reaction program in the PCR verification in step (3) is: 95°C, 3min, 1cycle; 95°C, 15sec, 56°C, 15sec, 72°C, 1min, 30cycles; 72°C, 5min, 1cycle; 16°C, forever, 1cycle.

8. The construction method according to claim 1, characterized in that: The original Metarhizium is Metarhizium anisopliae, and its preservation number is CGMCC 3.11979.

9. A highly salt-resistant Metarhizium anisopliae strain obtained by the construction method according to any one of claims 1 to 8.

10. Use of the highly salt-resistant Metarhizium anisopliae strain according to claim 9 in controlling pests in a high-salt environment.

Images