Gene GhGSTL3 and VIGS vector, host cell and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a gene GhGSTL3 as well as a VIGS vector, a host cell and application of the gene GhGSTL3. The nucleotide sequence of the gene GhGSTL3 is as shown in SEQ ID NO. 1. The invention discloses that the gene GhGSTL3 participates in regulating and controlling the drought stress response of the upland cotton for the first time, the drought resistance of the upland cotton can be enhanced, and the gene can be used for cultivating new varieties of drought-resistant plants and has potential application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene GhGSTL3 and a VIGS vector, a host cell and application thereof. Background Art

[0002] As an important global cash crop and a major source of natural fiber, cotton occupies a core position in my country's textile industry. my country's cotton is mainly grown in the Xinjiang Uygur Autonomous Region, where the output accounts for 91% of the country's total. However, the drought and lack of rain in the Xinjiang Uygur Autonomous Region and the lack of water resources have become key factors restricting cotton production. Therefore, improving cotton quality and drought resistance has become a breeding focus. Flavonoids can increase the water absorption and water storage capacity of plant roots, thereby improving the survival ability of plants under drought stress.

[0003] Among plant secondary metabolites, flavonoids have attracted widespread attention for their diverse biological functions. These compounds are usually found in organs such as flowers, leaves, and seeds, stored in the vacuoles of plant cells in the form of glycosides, and exert their biological functions in the cytoplasm in a free form. It can not only participate in pigment synthesis to regulate the color of plant organs, but also regulate root growth, signal transduction, auxin transport and other processes. More importantly, flavonoids can also help plants resist various biological and abiotic stresses.

[0004] Therefore, it is extremely important to explore the genes related to flavonoids in cotton. Summary of the invention

[0005] In order to improve the stress resistance of cotton, the present invention provides a gene GhGSTL3 associated with upland cotton fiber quality and drought resistance. The gene GhGSTL3 provided by the present invention can regulate the content of flavonoid compounds, thereby improving upland cotton fiber quality and drought resistance.

[0006] A gene GhGSTL3 for regulating the content of flavonoid compounds, the nucleotide sequence of the gene GhGSTL3 is shown as SEQ ID NO.1, and the coding region sequence thereof is shown as SEQ ID NO.4.

[0007] The present invention reveals for the first time that the upland cotton gene GhGSTL3 is involved in regulating the drought stress response of upland cotton, and can enhance the drought resistance of upland cotton. The gene GhGSTL3 provided by the present invention provides a valuable resource for breeding new varieties of drought-resistant upland cotton, and at the same time lays a theoretical foundation for studying the mechanism of upland cotton's response to drought stress and the molecular mechanism of resisting adverse environments.

[0008] The present invention provides a VIGS vector containing the gene GhGSTL3, which is obtained by inserting the gene GhGSTL3 fragment shown in SEQ ID NO.4 into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2.

[0009] Furthermore, the amplification primers for the gene GhGSTL3 fragment shown in SEQ ID NO.4 include GhGSTL3-F shown in SEQ ID NO.2 and GhGSTL3-R shown in SEQ ID NO.3.

[0010] The present invention provides a recombinant cell, wherein the recombinant cell is obtained by transforming a VIGS vector into a host cell.

[0011] The invention provides application of a gene GhGSTL3, a VIGS vector or a recombinant cell in cotton breeding.

[0012] Furthermore, the gene GhGSTL3 is used to upregulate the content of flavonoid compounds, thereby improving the fiber quality and / or drought resistance of upland cotton.

[0013] Furthermore, the VIGS carrier is used to increase the content of H2O2 and malondialdehyde in upland cotton.

[0014] The present invention also provides a method for improving drought resistance of upland cotton, characterized in that the gene GhGSTL3 fragment shown in SEQ ID NO.4 is inserted into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain a VIGS vector, which is transformed into a host cell, the positive plasmid is extracted and transformed into Agrobacterium, and the cotyledons of upland cotton seedlings are infected with Agrobacterium to obtain drought-resistant transgenic upland cotton.

[0015] Furthermore, the infection requires a virus suspension, which is obtained by resuspending an Agrobacterium solution containing pTRV1 in VIGS buffer to obtain a mixed solution 1, resuspending an Agrobacterium solution containing a VIGS vector in VIGS buffer to obtain a mixed solution 2, and mixing the mixed solution 1 and the mixed solution 2 and then activating them.

[0016] Furthermore, the VIGS buffer contains MgCl2, MES and AS, the solvent is deionized water and the pH is 5.6-6.0.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The present invention reveals for the first time that the upland cotton gene GhGSTL3 is involved in regulating the drought stress response of upland cotton, and can enhance the drought resistance of upland cotton. The gene GhGSTL3 provided by the present invention provides a valuable resource for breeding new drought-resistant upland cotton varieties, and at the same time lays a theoretical foundation for studying the mechanism of upland cotton's response to drought stress and the molecular mechanism of resisting adverse environments.

[0019] 2. The present invention picks the main stem functional leaves of cotton in the flowering period to detect the content of flavonoid compounds in the cotton leaves, uses GWAS analysis to identify SNP sites highly correlated with flavonoids, determines the candidate gene GhGSTL3, and successfully constructs a virus-induced gene GhGSTL3 silencing vector. The present invention finds that Hap A The material has longer fibers, higher breaking strength, better yield and drought resistance. At the same time, silencing of the GhGSTL3 gene will make cotton more sensitive to drought, revealing that the GhGSTL3 gene is involved in regulating the drought stress response of upland cotton. This gene can be used to breed new varieties of drought-resistant plants and has potential application value.

[0020] 3. The present invention uses VIGS technology to silence the GhGSTL3 gene in upland cotton TM-1 seedlings, and finds that after drought stress, the GhGSTL3-silenced plants showed a certain degree of wilting compared with the control plants, and the H2O2 and malondialdehyde contents of the GhGSTL3-silenced plants were significantly higher than those of the control group, indicating that the upland cotton gene GhGSTL3 can enhance the drought resistance of cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The content of flavonoid compounds in the fourth leaf of the core germplasm population of upland cotton at the peak of flowering period.

[0023] Figure 2The GWAS results and haplotype analysis of the gene GhGSTL3; in the figure, a is a Manhattan plot, the X-axis represents the 26 chromosomes of upland cotton, the scale represents the length of the corresponding stain, and the vertical axis represents the logarithm of the P-value of the association analysis significance value. The blue dotted line represents the suggestive significance level threshold, and the orange dotted line represents the statistical significance level threshold. The point in the figure represents an independent SNP; b is the linkage disequilibrium analysis of the chromosome interval where the gene GhGSTL3 is located. The upper part is a partially enlarged Manhattan plot. The gene structure and physical position of the gene GhGSTL3 on the chromosome are marked on the x-axis, green represents exons, and the SNP site A09:74698014 connected by the dotted line is used for subsequent haplotype division. The lower part is the SNP linkage correlation R value within the interval. The redder the color, the stronger the linkage relationship between the two SNPs. Figure c shows that 383 population materials were divided into two haplotypes by A09:74698014. The first row represents the difference between morin, quercetin and hesperidin in leaves between the two haplotype materials. The second row represents the difference between the two quality traits of fiber length and fiber strength between the two haplotypes. The first two in the third row represent the difference between the lint yield and seed cotton yield between the two haplotypes. The last one represents the difference in drought resistance coefficient (fruit branch length) between the two haplotypes. The numbers above the X-axis represent the number of materials, and the significance of the difference is calculated by a two-tailed student's t-test.

[0024] Figure 3 The first row shows the subcellular localization results of cotton protoplasts, the cell nucleus is marked with marker gene NLS-RFP, and the scale bar length is 50 μm. The second row shows the subcellular localization results of tobacco leaves, and the scale bar length is 10 μm.

[0025] Figure 4 The figures are the phenotypic comparison and statistical difference diagrams between the GhGSTL3 gene silencing and the control group; in the figure, the upland cotton standard line TM-1 was used as the experimental material, a is the drought test phenotype diagram; b is the statistical diagram of the difference in hydrogen peroxide content between the GhGSTL3 gene silencing strain and the normal strain; c is the statistical diagram of the difference in malondialdehyde content between the GhGSTL3 gene silencing strain and the normal strain; the significance of the difference was calculated by two-tailed student's t-test, and the scale length was 8 cm. DETAILED DESCRIPTION

[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0027] Example 1: Analysis of flavonoid accumulation in leaves of upland cotton

[0028] 383 core germplasm populations of upland cotton were used as materials and planted in Anyang City, Henan Province. All materials were planted in the experimental field in sequence, with two replicates. Samples of the main stem functional leaves (the fourth leaf from the bottom) were taken during the flowering period, quickly frozen with liquid nitrogen, and then stored in a -80°C refrigerator.

[0029] The main stem functional leaves (the fourth leaf from the bottom) were taken as samples, with 0.5 g of fresh weight for each material, and two biological replicates were set. Then, through targeted metabolomics, the contents of 16 flavonoid compounds in cotton leaves were detected using liquid chromatography-mass spectrometry.

[0030] (1) Sample preparation: fresh materials were placed in 2 mL EP tubes, immediately frozen in liquid nitrogen, and stored in a -80°C ultra-low temperature refrigerator. The day before sample preparation, freeze-dried the corresponding tissue material for 16 h, accurately weighed 0.100 g with a 1 / 10,000 balance, crushed into powder with a ball mill, added with extract at a ratio of 0.1 g / mL, vortexed for 15 min, centrifuged in a refrigerated centrifuge at 4°C and 15,000 rpm for 30 min, filtered with a 0.22 μm filter membrane, and 180 μL was placed in a vial for testing using a liquid chromatography-mass spectrometry instrument QTrap4000. The extract was 80% methanol water by volume, containing chrysin as an internal standard.

[0031] (2) On-machine detection: This experimental instrument uses an ESI ion source. The retention time (RT / s) of the detected Q1 parent ion and Q3 fragment ion is compared with the retention time of the standard. The detected ions are qualitatively analyzed. If the retention time is the same, it can be determined to be the same compound. The peak area is integrated, and the concentration of the detected ions is absolutely quantified based on the standard curve. The mobile phases used in the experiment are phase A with a volume fraction of 0.05% formic acid aqueous solution and phase B with a volume fraction of 0.05% formic acid acetonitrile. The experiment uses flavonoid standards as external standards, sets a concentration gradient, and makes a standard curve. At the same time, chrysin in the extract is used as an internal standard to eliminate machine noise and reduce instrument errors.

[0032] Results: A total of 16 flavonoids from 7 categories were detected in the leaves. It was found that the content of flavonols was high, while the content of other flavonoids was low, indicating that the metabolism of flavonols in the leaves was relatively active. At the same time, it was found that the accumulation of flavonols had obvious group specificity, such as Figure 1 shown.

[0033] Example 2: Discovery of key genes regulating flavonoid content in cotton leaves

[0034] (1) Descriptive statistical analysis: By sorting out the data distribution characteristics of all detected flavonoid compounds in the population and performing logarithmic transformation on the absolute content data of each flavonoid, it was found that the flavonoid content in the leaves conformed to a normal or approximately normal distribution, which was suitable for subsequent GWAS analysis.

[0035] (2) Metabolite-based genome-wide association analysis: A large amount of data was obtained by targeted metabolomics measurement of flavonoid metabolites in leaves of 383 natural population materials of upland cotton, and mGWAS was performed on them together with the resequencing genome data. Using 1,076,652 high-quality SNP data, ensuring that the minor allele frequency was >0.05 and the missing rate was <0.2, mGWAS was performed using a mixed linear model, and 3778 SNP sites that were highly associated with flavonoids above the medium significance threshold were identified.

[0036] (3) Determination of candidate genes: Based on the above results, a total of 13 QTLs co-associated with multiple compounds were identified, including 73 candidate genes. Among them, the gene involved in glutathione S-transferase (GhA09G180100) was designated as gene GhGSTL3, which is co-associated with hesperidin, morin and quercetin. Analysis of significant SNPs related to gene GhGSTL3 showed that the SNP (A09: 74698014) located in the coding region of gene GhGSTL3 was divided into two types in the population, and its natural variation can lead to the conversion of glutamate at position 119 into lysine. According to this SNP, the population can be divided into two haplotypes: haplotype A (Hap A ) and haplotype G(Hap G ). A The leaves of the material have higher content of hesperidin, morin and quercetin; and its fibers are longer and stronger, while the yield and drought resistance are also better. Figure 2 shown.

[0037] Example 3: Functional verification of gene GhGSTL3.

[0038] The nucleotide sequence of gene GhGSTL3 is shown in SEQ ID NO.1:

[0039] .

[0040] 1. Protoplast subcellular localization

[0041] By combining the GFP tag with the GhGSTL3 protein and the localization of the NLS-RFP tag, it was found that the protein was localized in the nucleus and cytoplasm, e.g. Figure 3 shown.

[0042] VIGS Experiment

[0043] 1. VIGS vector construction

[0044] (1) Cloning of target gene fragment: Use PCR technology to amplify the target gene fragment. Select a sequence with a coding region length of about 300-500 bp, design primers F and R based on the coding region sequence analysis, and amplify the coding region of the gene. The upstream primer GhGSTL3-F used is shown in SEQ ID NO.2; the downstream primer GhGSTL3-R is shown in SEQ ID NO.3.

[0045] The amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec, 34 cycles; and final extension at 72°C for 5 min.

[0046] The amplification primers are:

[0047] SEQ ID NO. 2: CGGGAATTCATGGCTACTCCAAGTGTAGAGT.

[0048] SEQ ID NO. 3: AAAGGTACCGTCAGCATCATCAGGTAGAAGA.

[0049] The target gene fragment is shown in SEQ ID NO.4:

[0050] ATGGCTACTCCAAGTGTAGAGTATTTGCCTCCTCCATTGGATGCTACTGCAGAGCAACCTGCTATCTTTGATGGAACAATCAGGTTGTATCTGGCTTATCCTTGCCCTTACGCACAGCGCGTGTGGATCGCCAGGAATTGTAAGGGTTTGCAAGACAAGATTAAGTTGGT TCCTTTGAACCTTCAAAATAGACCTGCTTGGTACAAGGAAAAAGTTTACCCTGAAAACAAGGTGCCGTCCTTGGAACATAATGGCAAAGTCATTGGGGAGAGTCTTGATTTGATTAAATATGTTGATAGCAACTTCGAAGGGCCGTCTCTTCTACCTGATGATGCTTGAC.

[0051] (2) Construction of VIGS vector: Using restriction endonucleases EcoR1 and Kpn1, the pTRV2 vector and the gene encoding sequence SEQ ID NO.4, the cloned SEQ ID NO.4 sequence was then inserted into the pTRV2 vector using DNA recombination technology to obtain the VIGS vector, which was then sequenced to ensure that the vector was constructed correctly.

[0052] (3) Transformation of host cells: The universal vector pTRV1 and the constructed VIGS vector were transformed into Escherichia coli and identified.

[0053] 2. Virus reproduction and infection

[0054] (1) Transformation of Agrobacterium: pTRV1 vector and VIGS vector were extracted from Escherichia coli and transformed into Agrobacterium GV3101.

[0055] (2) Virus propagation: The Agrobacterium solution containing pTRV1 was resuspended in VIGS buffer to obtain mixed solution 1, and the Agrobacterium solution containing the VIGS vector was resuspended in VIGS buffer to obtain mixed solution 2. Mixed solution 1 and mixed solution 2 were mixed in equal proportions and activated at 28°C for 3 h to obtain a virus suspension. The VIGS buffer contained 10 mmol / L MgCl2, 10 mmol / L MES and 200 μmol / L AS. The solvent was deionized water and the pH was 5.6.

[0056] (3) Virus infection: Weigh an equal amount of soil to cultivate seedlings. One week later, inject the virus suspension obtained by propagation into the cotyledons of 1-week-old upland cotton TM-1 seedlings. The upland cotton TM-1 seedlings are used as the receptor material for gene silencing. In this experiment, TRV::00 (empty vector) is used to infect the receptor material as a negative control.

[0057] 3. Drought resistance testing

[0058] After infection, the soil was allowed to fully absorb water, and excess water was poured off after one day until drought stress occurred. It was observed that the leaves of the gene-silenced material wilted to a certain extent under drought conditions. The contents of H2O2 and malondialdehyde (MDA) were measured at the same time. The kits used were H2O2TestKit and MDATestKit produced by Grace Biotechnology, with item numbers G0112W and G0110W respectively. The measurement method was carried out in full accordance with the kit manual. The results showed that the contents of H2O2 and malondialdehyde (MDA) increased significantly compared with the control group, indicating that the expression of the gene GhGSTL3 can indeed improve the drought resistance of cotton plants, such as Figure 4 shown.

[0059] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0060] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A gene GhGSTL3 for regulating the content of flavonoids, characterized in that: The nucleotide sequence of the gene GhGSTL3 is shown in SEQ ID NO.1, and the coding region sequence thereof is shown in SEQ ID NO.

4.

2. A VIGS vector comprising the gene GhGSTL3 according to claim 1, characterized in that: The gene GhGSTL3 fragment shown in SEQ ID NO.4 was inserted into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain it.

3. The VIGS vector of the gene GhGSTL3 according to claim 2, characterized in that: The primers for amplifying the gene GhGSTL3 fragment shown in SEQ ID NO.4 include GhGSTL3-F shown in SEQ ID NO.2 and GhGSTL3-R shown in SEQ ID NO.

3.

4. A recombinant cell, characterized in that The recombinant cell is obtained by transforming the VIGS vector according to claim 3 into a host cell.

5. Use of the gene GhGSTL3 according to claim 1, the VIGS vector according to any one of claims 2 to 3, or the recombinant cell according to claim 4 in cotton breeding.

6. The use according to claim 5, characterized in that: The gene GhGSTL3 is used to increase the content of flavonoid compounds and improve the fiber quality and / or drought resistance of upland cotton.

7. The use according to claim 5, characterized in that: The VIGS carrier is used to increase the content of H2O2 and malondialdehyde in upland cotton.

8. A method for improving drought tolerance of upland cotton, characterized in that: The gene GhGSTL3 fragment shown in SEQ ID NO.4 described in claim 1 is inserted into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain a VIGS vector, which is transformed into a host cell, and the positive plasmid is extracted and transformed into Agrobacterium, and the cotyledons of upland cotton seedlings are infected with Agrobacterium to obtain drought-resistant transgenic upland cotton.

9. The method for improving drought tolerance of upland cotton according to claim 8, characterized in that: The infection requires a virus suspension, which is obtained by resuspending a pTRV1 Agrobacterium solution in VIGS buffer to obtain a mixed solution 1, resuspending a VIGS vector Agrobacterium solution in VIGS buffer to obtain a mixed solution 2, and mixing the mixed solution 1 and the mixed solution 2 and activating them.

10. The method for improving drought tolerance of upland cotton according to claim 9, characterized in that: The VIGS buffer contains MgCl2, MES and AS, the solvent is deionized water and the pH is 5.6-6.0.

Images