Plant drought resistance related protein TaDi19-1 and application of a coding gene thereof

By cloning and regulating the TaDi19-1 protein gene in wheat, the problem of insufficient drought resistance in wheat was solved. It was achieved that the drought resistance of wheat could be improved or reduced by overexpression or knockout, proving its application value in breeding.

CN121342948BActive Publication Date: 2026-05-12SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
Filing Date
2025-12-19
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the drought resistance of wheat, leading to reduced wheat yields under drought conditions, and there is a lack of effective methods for improving drought resistance through genetic modification.

Method used

By cloning and utilizing the TaDi19-1 protein and its encoding gene in wheat, their activity or expression level can be regulated to construct overexpression or knockout plants, thereby enhancing or weakening their drought resistance.

Benefits of technology

By overexpressing the TaDi19-1 gene to weaken wheat drought resistance and knocking out the TaDi19-1 gene to enhance wheat drought resistance, the importance of TaDi19-1 in breeding has been demonstrated, which can cultivate plant varieties with stronger or weaker drought resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121342948B_ABST
    Figure CN121342948B_ABST
Patent Text Reader

Abstract

The application provides a plant drought resistance related protein TaDi19-1 and an application of a coding gene thereof, and belongs to the technical field of genetic engineering.The application provides an application of a plant drought resistance related protein, a nucleic acid molecule coding the plant drought resistance related protein, a primer pair for amplifying the nucleic acid molecule or biological material containing the nucleic acid molecule in regulating the drought resistance related performance of a plant, and the plant drought resistance related protein TaDi19-1 contains an amino acid sequence shown in SEQ ID No.1.The application constructs an overexpression plant by introducing the coding gene into a wheat genome for overexpression, and the overexpression plant has weakened drought resistance performance compared with a wild type plant;the coding gene is knocked out, and the obtained mutant plant has enhanced drought resistance performance compared with the wild type plant.It is proved that the protein TaDi19-1 or the gene TaDi19-1 negatively regulates the drought resistance performance of a plant, and can be applied to breeding of drought resistance plant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of a plant drought resistance-related protein TaDi19-1 and its encoding gene. Background Technology

[0002] Plants encounter various natural environments during their growth, some of which, such as drought, waterlogging, and pests and diseases, often cause significant yield reductions. Developing stress-resistant crop varieties is one of the important goals of agricultural science and technology research. Currently, a crucial breeding method involves genetically engineering crops with various stress-resistance genes to obtain new stress-resistant crop varieties.

[0003] wheat( Triticum aestivum L As a major source of carbohydrates and protein, wheat is also affected by drought, making it one of the main factors contributing to reduced wheat yields. Studies have shown that the key to genetic improvement of crop drought resistance lies in the cloning and utilization of superior drought-resistant genes. Therefore, the discovery of drought-resistant genes in wheat is of great significance for breeding drought-resistant wheat varieties and increasing wheat yields. Summary of the Invention

[0004] This invention provides an application of the plant drought resistance-related protein TaDi19-1 and its encoding gene, wherein TaDi19-1 and its encoding gene negatively regulate plant drought resistance-related properties.

[0005] This invention provides the application of plant drought resistance-related proteins, nucleic acid molecules encoding said plant drought resistance-related proteins, primer pairs for amplifying said nucleic acid molecules, or biological materials containing said nucleic acid molecules in regulating plant drought resistance-related properties. The plant drought resistance-related proteins are shown in any of the following: amino acid sequences as shown in SEQ ID No. 1 or based on the amino acid sequence shown in SEQ ID No. 1 with a tag attached.

[0006] In one specific embodiment of the present invention, the nucleic acid molecule is shown in any of the following forms:

[0007] (1) The nucleotide sequence is shown in SEQ ID No. 2;

[0008] (2) The fragment consisting of positions 1-642 in the nucleotide sequence shown in SEQ ID No. 2;

[0009] (3) A nucleic acid molecule that has more than 70% homology with (1) or (2) and encodes the plant drought resistance-related protein;

[0010] (4) A nucleic acid molecule that hybridizes under strict conditions with the sequences shown in (1), (2) or (3) and encodes the plant drought resistance-related protein.

[0011] In one specific embodiment of the present invention, the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4.

[0012] In one specific embodiment of the present invention, the type of biological material includes recombinant vectors containing the nucleic acid molecules, expression cassettes, transgenic cell lines, recombinant bacteria, or recombinant viruses.

[0013] In one specific embodiment of the present invention, the regulation includes reducing the activity or content of the plant drought resistance-related proteins to improve the plant's drought resistance-related performance;

[0014] Reducing the expression level of the nucleic acid molecule or knocking out the nucleic acid molecule can improve the drought resistance-related properties of plants.

[0015] In one specific embodiment of the present invention, the knockout method includes the CRISPR-Cas9 method, and the nucleotide sequence of the designed sgRNA is shown in SEQ ID No. 5 and SEQ ID No. 6.

[0016] This invention provides a method for improving plant drought resistance-related properties, including reducing the activity or content of plant drought resistance-related proteins, or reducing the expression level of nucleic acid molecules encoding the plant drought resistance-related proteins, or knocking out the nucleic acid molecules; the plant drought resistance-related proteins are any of the following: the amino acid sequence is as shown in SEQ ID No. 1 or a tag is attached to the amino acid sequence shown in SEQ ID No. 1.

[0017] In one specific embodiment of the present invention, the nucleic acid molecule is shown in any of the following forms:

[0018] (1) The nucleotide sequence is shown in SEQ ID No. 2;

[0019] (2) The fragment consisting of positions 1-642 in the nucleotide sequence shown in SEQ ID No. 2;

[0020] (3) A nucleic acid molecule that has more than 70% homology with (1) or (2) and encodes the plant drought resistance-related protein;

[0021] (4) A nucleic acid molecule that hybridizes under strict conditions with the sequences shown in (1), (2) or (3) and encodes the plant drought resistance-related protein.

[0022] Beneficial Effects: This invention provides the application of plant drought-resistance-related proteins, nucleic acid molecules encoding said plant drought-resistance-related proteins, primer pairs for amplifying said nucleic acid molecules, or biological materials containing said nucleic acid molecules in regulating plant drought-resistance-related properties. The plant drought-resistance-related protein TaDi19-1 contains the amino acid sequence shown in SEQ ID No. 1. This invention also provides the encoding gene of said protein TaDi19-1, and constructs overexpression plants by introducing the encoding gene into the wheat genome. Compared with wild-type plants, the overexpression plants exhibit weakened drought resistance. Furthermore, by using gene editing to knock out the encoding gene, the resulting mutant plants exhibit enhanced drought resistance compared to wild-type plants. This demonstrates that the protein TaDi19-1 or the gene described in this invention... TaDi19-1 Negative regulation of drought resistance in plants can be applied to the breeding of drought-resistant plant varieties. Attached Figure Description

[0023] Figure 1 for TaDi19-1 Gene expression patterns under drought stress;

[0024] Figure 2 Analysis of the transcriptional activation activity of TaDi19-1 protein in yeast cells;

[0025] Figure 3 Subcellular localization of the TaDi19-1-GFP fusion protein;

[0026] Figure 4 The results of qRT-PCR for T3 generation overexpressing wheat lines;

[0027] Figure 5 The phenotype of T3 generation overexpressing wheat lines after drought treatment and rehydration for 3 days;

[0028] Figure 6 The survival rate of T3 generation overexpressing wheat lines after drought treatment and rehydration for 3 days is statistically shown.

[0029] Figure 7 Infrared thermal imaging results of T3 generation overexpressing wheat plants under normal growth and drought stress conditions;

[0030] Figure 8 The leaf temperature of the transgenic wheat plants under normal growth and drought stress conditions in Example 3;

[0031] Figure 9 The results of target editing for T3 generation wheat lines;

[0032] Figure 10 Phenotypes of T3 generation wheat lines after drought treatment and rehydration for 3 days;

[0033] Figure 11 The survival rate of T3 generation edited wheat lines after drought treatment and rehydration for 3 days is statistically analyzed.

[0034] Figure 12 Infrared thermal imaging results of T3 generation wheat plants under normal growth and drought stress conditions;

[0035] Figure 13 The leaf temperature of wheat plants under normal growth and drought stress conditions was edited in Example 3. Detailed Implementation

[0036] This invention provides the application of plant drought resistance-related proteins, nucleic acid molecules encoding said plant drought resistance-related proteins, primer pairs for amplifying said nucleic acid molecules, or biological materials containing said nucleic acid molecules in regulating plant drought resistance-related properties. The plant drought resistance-related proteins are shown in any of the following: amino acid sequences as shown in SEQ ID No. 1 or based on the amino acid sequence shown in SEQ ID No. 1 with a tag attached.

[0037] The protein described in this invention is derived from wheat ( Triticum aestivum L. In this invention, it is named TaDi19-1, which has the amino acid sequence shown in SEQ ID No. 1.

[0038] In this invention, the protein TaDi19-1 can also be linked to various tags, such as the tags shown in Table 1 linked to the amino terminus or carboxyl terminus.

[0039] Table 1. Sequence of Labels

[0040]

[0041] This invention provides a CDS sequence encoding the protein TaDi19-1, which is 684 bp in length and has the nucleotide sequence shown in SEQ ID No. 2.

[0042] The present invention may also be the gene. TaDi19-1 The truncated fragment, such as the DNA molecule represented by positions 1-642 of the gene shown in SEQ ID No. 2. It can also be a DNA molecule encoding the protein shown in SEQ ID No. 1 that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with SEQ ID No. 2 or the truncated fragment; and a DNA molecule that hybridizes under stringent conditions to the DNA sequence defined by the complete fragment, truncated fragment, or homologous fragment described above and encodes the aforementioned protein.

[0043] In this invention, the stringent conditions may be any of the following: 1): hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4 and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS.

[0044] 2): Hybridization was performed at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS.

[0045] 3): Hybridization was performed at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS.

[0046] 4): Hybridize at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinse at 50°C in 0.1×SSC and 0.1% SDS.

[0047] 5): Hybridize at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinse at 65°C in 0.1×SSC and 0.1% SDS.

[0048] 6): Hybridize in a solution of 6×SSC, 0.5% SDS at 65°C, then wash the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0049] The present invention also provides a set of primer pairs for amplifying the above-mentioned nucleic acid molecules, including an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No. 4.

[0050] In one embodiment of the present invention, RNA is extracted from the wheat cultivar Chinese Spring, reverse transcribed into cDNA, and then amplified using primer pair F / R to obtain the gene. TaDi19-1 The nucleotide sequence is shown in SEQ ID No. 2.

[0051] F (SEQ ID No. 3): 5'-ATGGACTCGGAGCACTGGATC-3';

[0052] R (SEQ ID No. 4): 5'-TTATTGGTCTCTGAATAGGGT-3'.

[0053] The present invention also provides a biomaterial comprising the above-mentioned nucleic acid molecules.

[0054] The types of biomaterials described in this invention include recombinant vectors, expression cassettes, transgenic cell lines, recombinant bacteria, or recombinant viruses containing the nucleic acid molecules.

[0055] This invention can construct a gene containing the stated gene using common plant expression vectors in the art. TaDi19-1 The recombinant expression vectors of this invention may include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pROKII, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pCAMBIA3301, pWMB006, pWMB0010, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors of this invention may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall tumor inducing (Ti) plasmid gene (e.g., carmine synthase). Nos The untranslated regions transcribed at the 3' ends of genes (such as soybean storage protein genes) have similar functions. When constructing recombinant plant expression vectors using the genes described above, any type of enhancing promoter (such as the CAMV 35S promoter of cauliflower mosaic virus, the ubiquitin promoter of maize), constitutive promoter, or tissue-specific expression promoter (such as seed-specific expression promoters) can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. In addition, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), or antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methatrexate dhfrGenes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent marker genes (such as herbicide resistance genes) and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose.

[0056] In one embodiment of the present invention, the base vector of the recombinant vector pCAMBIA3301-GZ is pCAMBIA3301, and the DNA fragment shown in SEQ ID No. 2 is inserted into pCAMBIA3301. BamHI Between the restriction enzyme sites, it can be used for the gene. TaDi19-1 Overexpression.

[0057] In another embodiment of the present invention, the base vector of the recombinant vector pBUE411-KO is pBUE411, and the sequences of sgRNA1 and sgRNA2 are inserted between the HindIII and AscI restriction sites of the base vector pBUE411, which can be used for the gene. TaDi19-1 Knockout.

[0058] sgRNA1 (SEQ ID No. 5):ATTTGCAGGTGCTTCTGGGAGG;

[0059] sgRNA2 (SEQ ID No. 6): AACAAGTACCCATGTTGCATGG.

[0060] This invention also provides the application of the above-mentioned plant drought resistance-related proteins, nucleic acid molecules, primer pairs, or biological materials in regulating plant drought resistance-related properties.

[0061] In this invention, the activity or content of the aforementioned plant drought resistance-related proteins is reduced to improve plant drought resistance-related performance; the activity or content of the aforementioned plant drought resistance-related proteins is increased to reduce plant drought resistance-related performance; the expression level of the aforementioned nucleic acid molecules is reduced or the aforementioned nucleic acid molecules are knocked out to improve plant drought resistance-related performance; the expression level of the aforementioned nucleic acid molecules is increased or the aforementioned nucleic acid molecules are knocked out to reduce plant drought resistance-related performance.

[0062] The present invention also provides a set of sgRNAs that knock out the above-mentioned nucleic acid molecules, the nucleotide sequences of which are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0063] The present invention also provides a method for improving plant drought resistance-related properties, including reducing the activity or content of the above-mentioned plant drought resistance-related proteins, or reducing the expression level of the above-mentioned nucleic acid molecules or knocking out the above-mentioned nucleic acid molecules.

[0064] The present invention does not specifically limit the method for regulating the content or activity of the protein and the expression level of the gene. Conventional methods in the art can be used for regulation. For example, in the embodiments of the present invention, sgRNA can be introduced into the target plant to edit the mRNA encoding the protein, thereby reducing the content or activity of the protein in the target plant, reducing the expression level of the nucleic acid molecule encoding the above protein in the target plant, or knocking out the gene.

[0065] The present invention does not specifically limit the species of the target plant; it can be a monocotyledonous plant or a dicotyledonous plant. For example, in one embodiment, the monocotyledonous plant wheat (… Triticum aestivum The example given is L., but it should not be considered as the entire scope of protection of this invention.

[0066] In the embodiments of this invention, it was found that when the protein TaDi19-1 encoding gene was introduced into wheat, the drought resistance of the transgenic plants was weakened; when the protein TaDi19-1 encoding gene was knocked out from wheat, the drought resistance of the transgenic plants was enhanced. This proves that the protein TaDi19-1 is of great significance in breeding and research to improve plant drought resistance and can be used to cultivate drought-resistant plant varieties.

[0067] To further illustrate the present invention, the application of a plant drought resistance-related protein TaDi19-1 and its encoding gene provided by the present invention is described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0068] Unless otherwise specified, the experimental methods used in the embodiments of the present invention are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0069] The biomaterials used in the following examples are as follows:

[0070] Vector pBUE411: documented in the literature: Liu Y, Chen B, Qin Z, Jiang P, Yang Y, et al. TaFAR5-TaFAR3 module regulates cuticular wax biosynthesis and drought tolerance in wheat. New Phytologist 2025. Available to the public from Northwest A&F University;

[0071] Vector pCAMBIA3301: Documented in the literature: Regulatory changes in TaSNAC8-6AAreas associated with drought tolerance in wheat seedlings. Plant Biotechnol J2019. Available to the public from Northwest A&F University;

[0072] The vector pTF486 is described in the literature: ABA-induced sugar transporter TaSTP6 promotes sweat susceptibility to stripe rust. Plant Physiol. 2019, 181(3):1328-1343. It is available to the public from Northwest A&F University.

[0073] Agrobacterium tumefaciens GV3101+pSoup strain: described in the literature: Scholthof HB, Alvarado VY, Vega-Arreguin JC, Ciomperlik J, Odokonyero D, et al. (2011) Identification of an ARGONAUTE for antiviral RNA silencing in Nicotiana benthamiana. PlantPhysiol 156: 1548-1555, available to the public from Northwest A&F University;

[0074] Agrobacterium tumefaciens strain GV3101: documented in the literature: Jing Y, Zhang D, Wang X, Tang W, Wang W, et al. (2013) Arabidopsis Chromatin remodeling factor PICKLE interacts with transcription factor HY5 to regulate hypocotyl cell elongation. PlantCell 25: 242-256, available to the public from Northwest A&F University;

[0075] Chinese Spring wheat variety: Recorded in literature: Regulatory changes TaSNAC8-6A These are associated with drought tolerance in wheat seedlings. PlantBiotechnol J 2019. Available to the public from Northwest A&F University;

[0076] Wheat variety Fielder: documented in the literature: Regulatory changes in TaSNAC8-6A Areas associated with drought tolerance in wheat seedlings. Plant Biotechnol J2019. Available to the public from Northwest A&F University.

[0077] Example 1: Obtaining the protein TaDi19-1 and its encoding gene

[0078] I. Cloning of protein TaDi19-1 and its encoding gene

[0079] Seeds of the wheat cultivar Chinese Spring were germinated at 25℃ for three days. The germinated seeds were then transferred to nutrient soil or nutrient solution for two weeks of cultivation. The whole plant was then quick-frozen in liquid nitrogen, ground, and total RNA was extracted. Reverse transcription was performed to obtain cDNA. Using this cDNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 3 and SEQ ID No. 4. The amplified product was subjected to agarose gel electrophoresis, and a 684 bp DNA fragment was isolated and purified for sequencing. Its sequence is shown in SEQ ID No. 2 and named the gene. TaDi19-1 The encoded amino acid sequence is shown in SEQ ID No. 1, and the protein is named TaDi19-1.

[0080] two, TaDi19-1 Gene expression analysis under drought stress

[0081] Chinese Spring wheat cultivar seeds were germinated at 25℃ for three days. Germinated seeds were then transferred to nutrient soil or nutrient solution for two weeks of cultivation, followed by the following treatments: For drought stress, seedlings at the three-leaf stage were placed on a drying table (temperature 20℃; humidity 50%). Seedlings treated for 0, 1, 3, 6, 12, 24, and 48 hours were then flash-frozen in liquid nitrogen. All samples were ground, total RNA was extracted, and reverse transcription was performed to obtain cDNA. Using this cDNA as a template, real-time quantitative PCR (qRT-PCR) was performed using primer pairs for analysis. TaDi19-1 Gene expression patterns.

[0082] qRT-PCR-F (SEQ ID No. 12): 5'-CATGCAACATGGGTACTTGTTCAAG-3';

[0083] qRT-PCR-F (SEQ ID No. 13): 5'-GGCATTATTGTTGCTCGACCTATGTC-3';

[0084] FC2 (SEQ ID No. 14): 5'-AAATCTGGCATCACACTTTCTAC-3';

[0085] RC2 (SEQ ID No. 15): 5'-GTCTCAAACATAATCTGGGTCATC-3'.

[0086] The results are as follows Figure 1 As shown, TaDi19-1 The gene was induced to be normally expressed in wheat seedlings by drought stress.

[0087] Example 2: Analysis of the transcriptional activation activity of TaDi19-1 protein

[0088] Using Chinese Spring (CS) cDNA as a template, PCR amplification was performed using primer pair consisting of SEQ ID No. 3 and SEQ ID No. 4, resulting in a 684bp PCR product as shown in SEQ ID No. 2.

[0089] The PCR product was cloned and ligated into the yeast expression vector pGBKT7 (Clontech, 630489). EcoRI and BamHI Between the two restriction enzyme sites, a recombinant vector (expressing TaDi19-1 protein) was obtained. This recombinant vector was then transformed into yeast strain AH109 (Shanghai Sixin Biotechnology Co., Ltd., addgene 0278; containing reporter genes HIS3 and ADE2). Using the empty vector pGBKT7 as a control, recombinant yeast strains pGBKT7-TaDi19-1 and pGBKT7-Control were obtained, respectively. The AH109 recombinant yeast strains were plated on auxotrophic culture media, and the transcriptional activation activity of the TaDi19-1 protein was analyzed by observing plaque growth.

[0090] The results are as follows Figure 2 As shown, the recombinant yeast strain TaDi19-1 can grow on SD / -Trp (single deficiency) medium. On SD / -TH (double deficiency) and SD / -THA (triple deficiency) auxotrophic media, yeast strains containing the pGBKT7-Control plasmid (pGBKT7-Control) cannot grow normally, while the recombinant yeast strain pGBKT7-TaDi19-1 can grow normally. This indicates that the TaDi19-1 protein possesses transcriptional activation activity.

[0091] Example 3: Subcellular localization of TaDi19-1-GFP fusion protein

[0092] Using Chinese Spring (CS) cDNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 3 and SEQ ID No. 4. The target gene was cloned and ligated into the expression vector pTF486. SpeI and AvrII Between the two restriction enzyme sites, wheat (Chinese Spring) protoplasts were transformed, with empty vector pTF486 as a control, and the results were observed under a laser confocal microscope.

[0093] The results are as follows Figure 3 As shown, green fluorescence was distributed throughout the cell in protoplasts transformed with the empty vector pTF486, while green fluorescence was only distributed in the nucleus and cytoplasm in protoplasts transformed with the TaDi19-1-GFP fusion protein vector, indicating that TaDi19-1 is a nucleocytoplasmic localization protein.

[0094] Example 4: Overexpression of gene TaDi19-1 reduces wheat drought resistance

[0095] 1. Construction of recombinant vectors

[0096] The DNA fragment shown in SEQ ID No. 2 was cloned into pCAMBIA3301. BamHI The recombinant vector was obtained by sequencing between the restriction enzyme sites (located downstream of the Ubi promoter) and confirmed to be expressed by sequencing. The recombinant vector expresses the TaDi19-1 protein shown in SEQ ID No. 1.

[0097] 2. Obtaining recombinant Agrobacterium tumefaciens

[0098] The recombinant vector was transformed into Agrobacterium tumefaciens strain EHA105 to obtain recombinant Agrobacterium Y containing the recombinant vector.

[0099] The empty vector pCAMBIA3301 was transformed into Agrobacterium tumefaciens strain EHA105 to obtain recombinant Agrobacterium CK containing the empty vector pCAMBIA3301.

[0100] 3. Obtaining wheat overexpression lines

[0101] Recombinant Agrobacterium Y was transformed into the wheat variety Fielder (hereinafter also referred to as wild-type wheat) using Agrobacterium-mediated gene transformation to obtain T0 generation plants, which were then planted in a greenhouse (16h light / 8h dark). T0 generation plants were identified as positive by PCR, and after self-pollination, T1 generation seeds were obtained. T1 generation plants were then identified as positive by PCR, and after self-pollination, T2 generation seeds were obtained. Simultaneously, positive and negative seedlings were randomly selected and subjected to qRT-PCR detection according to step 4 to determine overexpression. TaDi19- 1 The expression level was determined. T2 generation plants were then identified by PCR to obtain positive plants, and T3 generation seeds were obtained after self-pollination.

[0102] The recombinant Agrobacterium CK was transformed into the wheat variety Fielder using the method described above until the T3 generation pCAMBIA3301 wheat line was obtained.

[0103] T0 generation represents the plants that grow from the current generation after transformation; T1 generation represents the seeds produced by self-pollination of T0 generation and the plants that grow from them; T2 generation represents the seeds produced by self-pollination of T1 generation and the plants that grow from them; T3 generation represents the seeds produced by self-pollination of T2 generation and the plants that grow from them.

[0104] The specific steps of the Agrobacterium-mediated gene transformation method described above are as follows:

[0105] Recombinant Agrobacterium Y was inoculated into YEB liquid medium containing 25 mg / L spectinomycin and cultured at 28°C with shaking until OD reached. 600The value was 0.5. Wheat embryos were placed in a 2 mL centrifuge tube filled with preservation solution (10 mL of 10×LS Ajor, 1 mL of 100×LS Minor, 1 mL of 100×Fe-EDTA, 1 mL of 100×Vitamin, 10 mL of Glucose and 0.5 g of MES were dissolved in an appropriate amount of water and then diluted to 1 L with water). The tubes were heat-treated at 46 °C for 3 min and centrifuged at 4 °C and 2000 rpm for 10 min. Add the prepared recombinant Agrobacterium to the treated immature embryos and culture in the dark at 22°C for 3 days. Then transfer to selective medium (dissolve 100 mL of 10×LS Major, 10 mL of 100×LS Minor, 10 mL of 100×Fe-EDTA, 10 mL of 100×Vitamin, 5 mL of 2,4-D, 40 g of Maitose, 0.5 g of Glutamine, 0.75 g of MgCl2·6H2O, 1.95 g of MES and 5 g of Agarose in an appropriate amount of water, and then bring the volume to 1 L with water; sterilize at 121°C for 15 min; then add 10 g / L Ascorbic acid, 50 μL of 100 mM AgNO3 solution and 1 mL of 150 g / L Timentin) and culture in the dark at 28°C for 7-10 days. Screening was performed using different concentrations of glufosinate (0.1–3.0 mg / L). The final culture medium was transferred to differentiation medium (100 mL of 10×LS Major, 10 mL of 100×LS Minor, 10 mL of 100×Fe-EDTA, 10 mL of 100×Vitamin, 50 mL of 100 mg / L Zeatin solution, 100 μL of 100 mM CuSO4·5H2O solution, 20 g Sucrose, 0.5 g MES, and 3 g Gelrite were dissolved in an appropriate amount of water, then diluted to 1 L; sterilized at 121°C for 15 min; then 250 μL of 20 g / L PPT and 1 mL of 250 g / L Carbenicillin were added). After differentiation, the culture medium was transferred to rooting medium (100 mL of 10×LS Major, 10 mL of 100×LS Minor, 10 mL of 100×Fe-EDTA, 10 mL of...). Dissolve 100×Vitamin, 2 mL of 100 mg / L IBA solution, 15 g Sucrose, 0.5 g MES and 3 g Gelrite in an appropriate amount of water, adjust the pH to 5.8, and then bring the volume to 1 L with water; sterilize at 121℃ for 15 min; then add 250 μL of 20 g / L PPT and 1 mL of 250 g / L Carbenicillin for culture, and after reaching a certain size, transfer to nutrient soil.

[0106] 4. qRT-PCR detection of wheat overexpression

[0107] Take the wild-type wheat obtained in step 3 and T3 generation. TaDi19-1 Total RNA was isolated from wheat lines (OE1-OE3) using the TRIZOL (Biotopped) method. Genomic contamination was then eliminated using the DNAseI (Takara) method, followed by concentration determination using a Nanodrop 1000 (Thermo Scientific product, USA). 5 μg of each RNA sample was run on 0.8% agarose gel. 1 μg of total RNA was used to synthesize cDNAs using recombinant M-MLV reverse transcriptase with 1 μg of Oligo(dT)23 (Promega) as a primer. Specific primers F2 and R2 were used to target the gene. TaDi19-1 The cDNA was quantified by qRT-PCR, using the wheat gene TaActin1 as an internal control. The results are as follows: Figure 4 As shown.

[0108] The sequences of the primers mentioned above are as follows:

[0109] F2 (SEQ ID No. 16): 5'-CATGCAACATGGGTACTTGTTCAAG-3';

[0110] R2 (SEQ ID No. 17): 5'-GGCATTATTGTTGCTCGACCTATGTC-3';

[0111] FC2 (SEQ ID No. 14): 5'-AAATCTGGCATCACACTTTCTAC-3';

[0112] RC2 (SEQ ID No. 15): 5'-GTCTCAAACATAATCTGGGTCATC-3'.

[0113] Figure 4 The results show that T3 generation conversion TaDi19-1 Target gene in wheat lines OE1-OE3 TaDi19-1 The expression level of was significantly higher than that of wild-type WT.

[0114] 5. Phenotypic analysis of drought resistance in wheat overexpression

[0115] Take T3 as the replacement TaDi19-1Wheat lines (OE1, OE2, OE3) and wild-type wheat (WT) plants were transferred to pots containing 250g of nutrient soil. After 21 days of growth under normal conditions, a drought treatment (i.e., watering was stopped) was applied. After 20-30 days, when phenotypic differences became obvious (OE1, OE2, and OE3 lines showed obvious leaf drying while WT plants showed severe leaf wilting), rehydration was initiated. Three days after rehydration, the survival rate of each line was recorded (plants that showed normal growth and could be harvested were defined as surviving plants, and plants that showed severe drought damage and could not grow or be harvested were defined as dead plants; the survival rate was the percentage of surviving plants in each line out of the total number of plants). The experiment was repeated three times, with at least 45 plants from each line in each replicate. The average value was used for statistical analysis.

[0116] The results are as follows Figure 5 As shown, it can be seen that the T3 generation is converted TaDi19-1 The survival rate of wheat lines after rehydration is lower than that of wild-type wheat.

[0117] Three days after rehydration, the survival rates of each plant line were calculated as follows: Figure 6 As shown, it can be seen that the T3 generation is converted TaDi19-1 The survival rate of wheat lines after rehydration was 25%–35%, significantly lower than that of wild-type wheat.

[0118] Depend on Figure 7 and Figure 8 It can be seen that under normal growth conditions, T3 generation transformation... TaDi19-1 The leaf temperature of wheat lines was no different from that of wild-type wheat, and under drought stress, the T3 generation transition... TaDi19-1 The leaf temperature of wheat lines was significantly lower than that of wild-type wheat. Therefore TaDi19-1 Genes may play an important role in the process of stomatal closure in response to drought.

[0119] Example 5, Knockout TaDi19-1 Enhance wheat drought resistance

[0120] 1. Construction of recombinant vectors

[0121] The DNA fragments shown in SEQ ID No. 5 and SEQ ID No. 6 were inserted into the basic vector pBUE411. HindIII and AscI The recombinant vector pBUE411-KO was obtained between the restriction enzyme sites.

[0122] 2. Obtaining recombinant Agrobacterium tumefaciens

[0123] The recombinant vector was transformed into Agrobacterium tumefaciens strain EHA105 to obtain recombinant Agrobacterium W containing the recombinant vector pBUE411-KO.

[0124] 3. Obtaining wheat knockout materials

[0125] Recombinant Agrobacterium W was transformed into the wheat variety Fielder using Agrobacterium-mediated gene transformation to obtain T0 generation plants, which were then grown in a greenhouse (16h light / 8h darkness). T0 generation plants were identified as positive by PCR, and after self-pollination, T1 generation seeds were obtained. T1 generation plants were then identified as edited plants by high-throughput sequencing, and after self-pollination, T2 generation seeds were obtained. The target editing status was confirmed by high-throughput sequencing. T2 generation plants were then identified as positive by PCR, and after self-pollination, T3 generation seeds were obtained.

[0126] T0 generation represents the plants that grow from the current generation after transformation; T1 generation represents the seeds produced by self-pollination of T0 generation and the plants that grow from them; T2 generation represents the seeds produced by self-pollination of T1 generation and the plants that grow from them; T3 generation represents the seeds produced by self-pollination of T2 generation and the plants that grow from them.

[0127] The specific steps of the Agrobacterium-mediated gene transformation method described above are as follows:

[0128] Recombinant Agrobacterium W was inoculated into YEB liquid medium containing 25 mg / L spectinomycin and cultured at 28°C with shaking until OD reached. 600 The concentration was 0.5. Wheat embryos were placed in 2 mL centrifuge tubes filled with preservation solution and heat-treated at 46℃ for 3 min, followed by centrifugation at 4℃ and 2000 rpm for 10 min. The prepared recombinant Agrobacterium was added to the treated embryos and cultured in the dark at 22℃ for 3 days. The embryos were then transferred to selection medium and cultured in the dark at 28℃ for 7–10 days. Selection was performed using different concentrations of glufosinate (0.1–3.0 mg / L), and the embryos were finally transferred to differentiation medium. After differentiation, they were transferred to rooting medium and cultured until they reached a certain size, at which point they were transplanted into nutrient soil.

[0129] 4. High-throughput sequencing detection of knockout wheat materials

[0130] Take the wild-type wheat and T3 generation obtained in step 3. TaDi19-1 The wheat knockout lines (KO1-KO3) were used to extract total DNA using the CTAB method. 1 μg of total DNA was taken and the target sequence was detected by PCR using specific primers PAM1-F / R and PAM2-F / R. The target editing status was then detected by high-throughput sequencing.

[0131] The sequences of the primers mentioned above are as follows:

[0132] PAM1-F (SEQ ID No. 18): 5'-ggagtgagtacggtgtgcGGTTTGTGCAAGTCTAAAA-3';

[0133] PAM1-R (SEQ ID No. 19): 5'-gagttggatgctggatggTCCAAAGTTAGAGAAGCTC-3';

[0134] PAM2-F (SEQ ID No. 20): 5'-ggagtgagtacggtgtgcCTGAGCCGGGATCTACG-3';

[0135] PAM2-R (SEQ ID No. 21): 5'-gagttggatgctggatggAGGAGAGTAACAGGAAAGAAGA-3'.

[0136] Knockout material target editing status as follows Figure 9 As shown.

[0137] 5. Phenotypic analysis of drought resistance in knockout wheat materials

[0138] Take T3 generation TaDi19-1 Wheat lines (KO1, KO2, KO3) and wild-type wheat (WT) plants were knocked out and transferred to pots containing 250g of nutrient soil. After 21 days of growth under normal conditions, a drought treatment (i.e., watering was stopped) was applied. After 20-30 days, when phenotypic differences became obvious (WT plants showed obvious leaf drying while KO1, KO2, and KO3 plants showed severe leaf wilting), rehydration was initiated. Three days after rehydration, the survival rate of each line was recorded (plants that showed normal growth and could be harvested were defined as surviving plants, and plants that showed severe drought damage and could not grow or be harvested were defined as dead plants; the survival rate was the percentage of surviving plants in each line out of the total number of plants). The experiment was repeated three times, with at least 45 plants from each line in each replicate. The average value was used for statistical analysis.

[0139] The results are as follows Figure 10 As shown, T3 generation TaDi19-1 The survival rate of knockout wheat lines after rehydration was higher than that of wild-type wheat.

[0140] Three days after rehydration, the survival rates of each plant line were calculated as follows: Figure 11 As shown, T3 generation TaDi19-1 The survival rate of the knockout wheat lines after rehydration was 81-85%, which was significantly higher than that of wild-type wheat.

[0141] Depend on Figure 12 and Figure 13 It can be seen that under normal growth conditions, the T3 generation... TaDi19-1 The leaf temperature of the knockout wheat lines was no different from that of wild-type wheat, and the T3 generation under drought stress... TaDi19-1 The leaf temperature of the knockout wheat lines was significantly higher than that of the wild-type wheat. This further proves... TaDi19-1Genes may play an important role in the process of stomatal closure in response to drought.

[0142] In summary, the protein TaDi19-1 and its encoding gene have the function of regulating plant drought resistance, and over-knockout in plants... TaDi19-1 Genes can enhance a plant's drought resistance.

[0143] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of plant drought resistance-related proteins, nucleic acid molecules encoding said plant drought resistance-related proteins, or biomaterials containing said nucleic acid molecules in regulating plant drought resistance-related properties, characterized in that, The plant drought resistance-related proteins are shown in any of the following: the amino acid sequence is as shown in SEQ ID No. 1 or a tag is attached to the amino acid sequence shown in SEQ ID No. 1; The nucleic acid molecule is any of the following: a nucleotide sequence as shown in SEQ ID No. 2 or a fragment consisting of positions 1-642 of the nucleotide sequence shown in SEQ ID No. 2; Knocking out the nucleic acid molecules improves drought resistance-related properties in plants; the plant is wheat.

2. The application according to claim 1, characterized in that, The types of biomaterials include recombinant vectors, expression cassettes, transgenic cell lines, recombinant bacteria, or recombinant viruses containing the nucleic acid molecules.

3. The application according to claim 1, characterized in that, The knockout method includes the CRISPR-Cas9 method, and the nucleotide sequence of the designed sgRNA is shown in SEQ ID No. 5 and SEQ ID No.

6.

4. A method for improving drought resistance-related properties of plants, characterized in that, This includes knocking out nucleic acid molecules; The nucleic acid molecule is any of the following: a nucleotide sequence as shown in SEQ ID No. 2 or a fragment consisting of positions 1-642 of the nucleotide sequence shown in SEQ ID No. 2; The plant in question is wheat.