SNP (Single Nucleotide Polymorphism) molecular marker related to low temperature resistance of rice and application of SNP molecular marker in rice breeding

Abstract

The invention discloses an SNP molecular marker related to rice low temperature resistance and application thereof in rice breeding, the SNP molecular marker related to rice low temperature resistance comes from an exon of a LOCOs10g 28120 gene and is located at the 14603265bp position of the 10th chromosome of rice, allelic genes are C and G, and the SNP molecular marker related to rice low temperature resistance can be used for predicting rice low temperature resistant germination, and can be used for predicting rice low temperature resistant germination. Therefore, the marker can be used for low-temperature-resistant and direct-seeding molecular breeding marker-assisted breeding of rice. The invention also provides a primer pair for detecting the SNP molecular marker and a screening method of the SNP molecular marker.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and crop breeding, and relates to a SNP molecular marker related to low temperature tolerance of rice and an application thereof in rice breeding. Background Art

[0002] Rice is the most important food crop in my country, and more than half of the population in my country relies on rice as their staple food. Direct-seeding rice, which saves labor, time and effort, is gaining more and more attention, and the planting area is getting larger and larger. Rice is a temperature-sensitive crop, and low temperature and cold damage can cause serious reductions in rice production. Since the sowing season is often affected by low temperature and cold damage, uneven seed germination, missing seedlings and broken ridges are caused. Therefore, direct-seeding rice varieties are required to have a high germination rate under low temperature conditions. Early rice sowing in double-season rice areas in southern China such as Guangdong often encounters low temperature weather, which requires rice seeds used for direct seeding to have strong low-temperature germination ability. Cold tolerance during germination, also known as low-temperature germination ability, is an important cold-tolerant trait that direct-seeded rice should possess. Therefore, it is of great significance to identify new cold-tolerant genes, develop molecular markers closely related to cold tolerance, and use new genes or aggregate with known excellent cold-tolerant genes through molecular marker-assisted selection for breeding cold-tolerant rice varieties.

[0003] Molecular localization of rice cold tolerance using DNA molecular markers found that rice cold tolerance is a complex trait controlled by quantitative trait loci (QTL). Liu et al. (2013a) identified seven QTLs using the F2:3 population of the cold-tolerant variety IL112 and the cold-sensitive variety guicha2. They then explored candidate genes associated with cold tolerance using microarray hybridization analysis and narrowed the number of candidate genes to four. Transgenic rice overexpressing one of the candidate genes, LOC_Os07g22494 (LTT7), showed strong low temperature tolerance at the early seedling stage. Ma et al. cloned the world's first rice cold tolerance gene COLD1 and elucidated its working mechanism, providing a reference for cold tolerance research. With the development of whole genome sequencing technology, it is possible to compare gene variations in different germplasm resources at the whole genome level. At the same time, combined with phenotypic identification data, the use of linkage analysis and association analysis (GWAS) and other analytical methods can efficiently discover new genes and favorable alleles contained in germplasm resources.

[0004] Chitinase is a hydrolase with chitin as substrate. It plays an important role in plant defense system by degrading chitin to resist fungal pathogens. Recent studies have shown that chitinase is also involved in the abiotic stress response of plants and helps plants survive in adversity. LOC_Os10g28120 has the structural characteristics of class IIIb chitinase and belongs to the GH18 family. In Arabidopsis, some chitinases, such as EVM0022783, EVM0020238 and EVM0003645, may drive the binding of MYC / ICE1 (CBF expression inducer 1) in the promoter region when strongly induced by low temperature and osmotic stress.

[0005] Single Nucleotide Polymorphisms (SNPs) mainly refer to DNA sequence polymorphisms at the genomic level caused by the variation of a single nucleotide. SNPs are widely distributed in the rice genome. With the advancement of high-throughput sequencing technology, SNPs have become a new generation of molecular markers. Functional markers are a new type of molecular marker developed based on polymorphic motifs within functional genes that cause phenotypic trait variation. Since they come from functional motifs within genes, such markers can determine the presence or absence of target alleles in different genetic backgrounds or different rice germplasm resources without further verification. Summary of the invention

[0006] The first objective of the present invention is to provide a SNP molecular marker related to low temperature tolerance of rice in view of the deficiencies of the prior art.

[0007] A SNP molecular marker related to low temperature tolerance of rice is from the exon of the LOC_Os10g28120 gene. The SNP molecular marker is located at the 14603265 bp position of chromosome 10 of rice, and the alleles are C and G. The SNP molecular marker is significantly correlated with the low temperature phenotype of rice, and the low temperature tolerance of rice varieties with a site genotype of C / C is significantly stronger than that of rice varieties with a site genotype of G / G.

[0008] The second object of the present invention is to provide the use of the above-mentioned SNP molecular markers related to low temperature tolerance of rice in identifying the low temperature tolerance trait of rice.

[0009] The third object of the present invention is to provide the application of the above-mentioned SNP molecular markers related to low temperature tolerance of rice in rice genetic breeding.

[0010] Furthermore, in the application, the locus genotype of the SNP molecular marker is C.

[0011] The SNP molecular marker in the present invention is located in the exon of the LOC_Os10g28120 gene. LOC_Os10g28120 belongs to chitinase, which participates in the abiotic stress response of plants, helps plants survive in adverse conditions, and may respond to low temperature stress.

[0012] Specifically, taking the breeding of new rice varieties with strong cold resistance as an example, the LOC_Os10g28120 gene (the base type of the SNP molecular marker is C) containing strong cold resistance can be transferred into rice varieties through genetic engineering to improve the cold resistance of rice. The SNP site of the LOC_Os10g28120 gene (the base type of the SNP molecular marker is G) in cold-sensitive rice can also be subjected to site-directed mutation to transform it into a new rice variety with strong cold resistance.

[0013] The fourth object of the present invention is to provide a primer pair for detecting the SNP molecular marker related to the low temperature tolerance of rice, comprising: SEQ ID NO.1: 5'-GTCGACTACGAGCACTTCAACG-3'; SEQ ID NO. 2: 5'-CTGGGCAAATATATCCCGCTTATTCA-3'.

[0014] A fifth object of the present invention is to provide a method for identifying the low temperature tolerance trait of rice, comprising the following steps: 1) Extracting genomic DNA from the rice sample to be tested; 2) using the genomic DNA of the rice sample to be tested as a template, and using the primer pair of the SNP molecular marker related to the low temperature tolerance of rice to perform PCR amplification reaction to obtain an amplified product fragment; 3) Detecting the base type at the SNP molecular marker associated with the low temperature tolerance trait of rice in the PCR amplification product fragment.

[0015] Further, step 3) is specifically as follows: The base type at the 332nd bp of the PCR amplification product fragment was detected. The low temperature tolerance of C base type rice was stronger than that of G base type rice.

[0016] The sixth object of the present invention is to provide a method for screening the SNP molecular markers related to the low temperature tolerance of rice, specifically: Perform SNP detection on several rice samples; The detected SNPs were used to perform genome-wide association analysis on rice samples, and a SNP molecular marker that was tightly linked to the low temperature tolerance trait of rice was obtained. The SNP molecular marker was from the exon of the LOC_Os10g28120 gene, located at the 14603265 bp position of rice chromosome 10, and the base was C or G.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a SNP molecular marker that is extremely significantly correlated with the low temperature tolerance of rice, which is located at the 14603265 bp position of chromosome 10 of rice in the rice genome. Experiments have shown that the SNP site is significantly correlated with the germination rate of rice under low temperature stress conditions. The SNP site can be used as a functional molecular marker to screen low temperature resistant rice resources and varieties, play an important role in direct seeding rice molecular breeding, and accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a frequency histogram of the low temperature resistance germination potential traits of the rice test population identified in Example 1; Figure 2 is the Manhattan plot of the genome-wide association analysis of the low temperature tolerance germination potential trait of rice in Example 1; Figure 3 It is a box plot of germination potential of samples with different genotypes at Chr10:14603265 locus of LOC_Os10g28120 gene in Example 1; Figure 4 This is the base peak diagram of the sequencing results of 10 rice materials collected in Example 2. DETAILED DESCRIPTION

[0019] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the materials, reagents, etc. used in the examples can be obtained from commercial sources.

[0020] Example 1. Acquisition and identification of SNP molecular markers tightly linked to low temperature germination tolerance in rice 1. Obtaining SNP molecular markers tightly linked to low temperature germination tolerance in rice 1. This experiment selected 208 rice varieties from the China National Rice Research Institute.

[0021] 2. 208 materials, each material has 2 biological replicates, and 30 seeds are taken for each replicate (empty seeds, shrunken seeds and moldy seeds are picked out, and the seeds are placed in a 42℃ oven for 3 days before the experiment). The seeds are soaked in 5% NaClO for surface disinfection for 15 minutes, and then rinsed thoroughly with distilled water. The seeds are spread on a disposable culture dish with qualitative filter paper, 5 ml of distilled water is added, the culture dish lid is covered, and they are placed in a constant temperature and light incubator at 14℃ for culture, and the control is cultured at 30℃ (the light setting is 8h of light and 16h of darkness). The number of seeds that germinate is investigated every day. The investigation ends after the germination of the control and treatment is stable at 4d and 15d, respectively, and the germination rate, relative germination rate, germination potential, relative germination potential and germination index are calculated for genome-wide association analysis (GWAS).

[0022] 3. Use GEMMA software (https: / / www.xzlab.org / software.html) for genome-wide association analysis. Use mixed linear models for analysis and use population structure and kinship matrix between materials as covariates. Combine genotype and phenotype values ​​to calculate the statistical test value P of SNP. Use P<0.001 as the standard to screen genetic loci related to phenotypic traits. In order to further analyze the significant SNPs with a close distance, the significant SNPs with a distance of ≤ 200kb were merged, and the most significant SNP in the interval was selected as QTL. Query candidate genes within 200kb upstream and downstream of QTL. A SNP site significantly associated with rice cold germination tolerance was discovered through genome-wide association analysis. The SNP site is located at position 14603265 of chromosome 10 of rice, which is also the 332nd position of SEQ ID NO.3. The base type of R at this position is C or G, which leads to different low-temperature phenotypes of rice: when the SNP is C, the seedling germination potential is higher, that is, it has a stronger resistance to low-temperature germination; when the SNP is G, the seedling germination potential is lower, that is, the resistance to low-temperature germination is poor.

[0023] SEQ ID NO.3: GTCGACTACGAGCACTTCAACGACGACGGCGGCGCCGGCGTCGACACGTTCGTGGAGTGCATCGGCGCCTCCTCACCGAGCTCAAGGCGCGGCACCCGAACATCACCACCTCCATCGCGCCGTTCGAGGACGCCGTGGTGCAGCGCTACTACCAGCCGCTGTGG CGGCGCTACGCCGGCGTGATCGACCTCGTCAACTTCCAGTTCTACGGCTACGGCGACAACACCGACGTGCCGACGTACGTGATGTTCTACGACGAGCAGGCGGCGAACTACCCGGGCGGCAAGGTGCTCGCCAGCTTCAAGACCGGCGACGTCGCCGGGCTGCTCT R GCCGGAGCAGGGGATCGCCGGAGCGAAGGAGTTGCACGGCAGGGGAAGCTGCCGGGATTGTTCATCTGGTCGCGGGACAGCTCAAAGGTCAGCAGCTATGGCTTTGAGTACGAGATCAAGGCTCAGGAGATCATCGCCAACCACTGATCGCTGATCGGACGGTCGAGATATCGCTGTGGTTGGATTTGGTATGAATGAATGACTGAATAAGCGGATATATTTGCCCAG 4. Primers were designed for the SNP sites obtained in step 3. The primer sequences are as follows: SEQ ID NO.1: 5'-GTCGACTACGAGCACTTCAACG-3'; SEQ ID NO.2: 5'-CTGGGCAAATATATCCCGCTTATTCA-3' The frequency histogram of the low temperature resistance germination potential traits of the rice test population identified in Example 1 is as follows Figure 1 ; Manhattan plot of genome-wide association analysis of rice germination potential traits for low temperature tolerance Figure 2 ; The box plot of germination potential of samples with different genotypes at the Chr10:14603265 locus of LOC_Os10g28120 gene is shown in Figure 3 .

[0024] 2. Methods for identifying rice cold tolerance based on SNP molecular markers The method for identifying the low temperature tolerance of the rice to be tested based on SNP molecular markers is to detect whether the base type of the SNP site (14603265th position of chromosome 10) in the rice to be tested is C or G: the low temperature tolerance of the C base type rice is stronger than that of the G base type rice. The C base type rice is a homozygous body with the deoxyribonucleotide at the 14603265th position of chromosome 10 of the rice genome being C; the G base type rice is a homozygous body with the deoxyribonucleotide at the 14603265th position of chromosome 10 of the rice genome being G.

[0025] The specific steps of detecting whether the base type of the SNP site in the rice to be tested (position 14603265 of chromosome 10) is C or G are as follows: extract rice genomic DNA, use the genomic DNA as a template, and use SEQ ID NO.1 and SEQ ID NO.2 for PCR amplification to obtain PCR amplification products: sequence the PCR amplification products, and determine whether the base type of the SNP site in the rice to be tested is C or G based on the sequencing results.

[0026] Example 2: Application of SNP molecular markers tightly linked to low temperature germination tolerance in rice Another 10 rice materials were selected as the rice to be tested, and the base types of the rice to be tested were detected according to the method in step 2 of Example 1.

[0027] The results are shown in Table 1. Among the 10 rice materials, 5 materials had a base type of C at the SNP site, and 5 materials had a base type of G at the SNP site. It was also found that the average low-temperature germination potential of the rice materials with a base type of C at the SNP site was 77.33%, and the average low-temperature germination potential of the rice materials with a base type of G was 0.67%, and the difference between the two was extremely significant.

[0028] The results show that the survival rate of rice seedlings with the base type C of the SNP site is significantly higher than that of rice with the base type G, indicating that the low temperature germination resistance of rice with the base type C is significantly stronger than that of rice with the base type G. The present invention further proves that the SNP site can be used as an effective genetic marker in rice molecular marker-assisted selection to improve the low temperature germination resistance of rice and accelerate the breeding process of direct-seeded rice.

[0029] Figure 4 This is the base peak diagram of the sequencing results of 10 rice materials.

[0030] Table 1 The germination potential phenotypes of low temperature tolerance of 10 rice materials Material No. Low temperature germination potential Base type QC76 76.67% C QC35 86.67% C QC50 76.67% C QC82 73.33% C QC68 73.33% C QC202 0.00% G QC146 3.33% G QC138 0.00% G QC15 0.00% G QC14 0.00% G The embodiments of the present disclosure have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

[0031] The above are only optional embodiments of the present disclosure and are not intended to limit the present disclosure. For those skilled in the art, the present disclosure may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. A SNP molecular marker related to low temperature tolerance in rice, characterized in that: The SNP molecular marker comes from the exon of the LOC_Os10g28120 gene, is located at the 14603265 bp position of chromosome 10 of rice, and has C and G alleles.

2. Use of the SNP molecular marker associated with low temperature tolerance of rice as claimed in claim 1 in identifying the low temperature tolerance trait of rice.

3. Use of the SNP molecular marker associated with low temperature tolerance of rice as claimed in claim 1 in rice genetic breeding.

4. The use according to claim 2 or 3, characterized in that: The genotype of the SNP molecular marker site is C.

5. A primer pair for detecting the SNP molecular marker related to low temperature tolerance of rice according to claim 1, characterized in that: include: Upstream primer: 5′-GTCGACTACGAGCACTTCAACG-3′; Downstream primer: 5′-CTGGGCAAATATATCCGCTTATTCA-3′.

6. The primer pair according to claim 5, characterized in that: The nucleotide sequence of the PCR amplification product fragment of the primer pair is shown in SEQ ID NO.3, and the SNP molecular marker is located at the 332 bp position in the sequence.

7. A method for identifying the low temperature tolerance trait of rice, characterized in that: The method comprises the following steps: Step 1), extracting genomic DNA of the rice sample to be tested; Step 2), using the genomic DNA of the rice sample to be tested as a template, using the primer pair described in claim 5 to perform a PCR amplification reaction to obtain an amplified product fragment; Step 3), detecting the base type of the SNP molecular marker related to the low temperature tolerance trait of rice in the PCR amplification product fragment.

8. The method according to claim 7, characterized in that Step 3) is specifically: The base type at the 332nd bp of the PCR amplification product fragment was detected. The low temperature tolerance of C base type rice was stronger than that of G base type rice.

9. A method for screening SNP molecular markers related to low temperature tolerance of rice as claimed in claim 1, characterized in that: The method comprises the following steps: Perform SNP detection on several rice samples; The detected SNPs were used to perform genome-wide association analysis on rice samples, and a SNP molecular marker that was tightly linked to the low temperature tolerance trait of rice was obtained. The SNP molecular marker was from the exon of the LOC_Os10g28120 gene, located at the 14603265 bp position of rice chromosome 10, and the alleles were C and G.

Images