Molecular markers related to wheat ear length and grain number per ear and their application

Abstract

The present invention discloses molecular markers related to wheat spike length and number of grains per spike and their applications, belonging to the technical field of crop selection and breeding. The molecular marker is dCAPS-MTA180-DdeI, which marks the SNP site AX-110049563 significantly related to wheat spike length and number of grains per spike, and the nucleotide sequence is shown in SEQ ID NO: 5, and the corresponding genotype of the AX-110049563 site is TT, or the nucleotide sequence is shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the corresponding genotype of the AX-110049563 site is CC. The molecular marker can be widely used in molecular marker-assisted breeding and whole genome selection breeding of wheat spike length and number of grains per spike to accelerate the breeding process.

Description

Technical Field

[0001] The invention relates to molecular markers and applications thereof, in particular to molecular markers related to wheat ear length and ear grain number and applications thereof, belonging to the technical field of crop seed selection and breeding. Background Art

[0002] Wheat (Triticum aestivum) is an important food crop, and increasing wheat yield has always been the main research goal in the field of crops. Wheat spike length and number of grains per spike are important factors that determine wheat yield. Breeding wheat with a higher number of grains per spike is an important way to increase wheat yield. The traditional breeding process consumes a lot of time and energy. With the development of molecular biology and whole genome association analysis technology, the exploration of single nucleotide polymorphism (SNP) sites related to wheat spike length and number of grains per spike and the development of related functional markers can provide reliable molecular markers for the genetic improvement of wheat yield-related traits and genomic selection-assisted breeding, thereby reducing the workload of breeding.

[0003] Currently, in the research on wheat ears, there are still few reports on molecular markers related to wheat ear length and grain number per ear. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to wheat ear length and grain number per ear and its application, so as to provide effective gene resources and molecular markers for crop genetic improvement and genome selection-assisted breeding.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] The invention discloses an application of a molecular marker dCAPS-MTA180-DdeI related to wheat spike length and spike grain number in breeding wheat yield-related traits, wherein the molecular marker dCAPS-MTA180-DdeI marks a SNP site AX-110049563 significantly related to wheat spike length and spike grain number, wherein AX-110049563 is located on chromosome 5B, and the physical position corresponding to the Chinese Spring reference genome sequence RefSeq v2.1 is 550540826, and the genotype is CC or TT. The molecular marker dCAPS-MTA180-DdeI is obtained by digesting the product obtained by amplification with the upstream primer shown in SEQ ID NO:1 and the downstream primer shown in SEQ ID NO:2 with the restriction endonuclease DdeI, and the nucleotide sequence is shown in SEQ ID NO:5, and the corresponding genotype of the AX-110049563 site is TT, or the nucleotide sequence is shown in SEQ ID NO:3 and SEQ ID NO:4. As shown in NO:4, the corresponding genotype of the AX-110049563 locus is CC, and the yield-related traits are ear length and number of grains per ear.

[0007] The present invention is beneficial in that:

[0008] (1) Based on genome-wide association analysis, the present invention discovered a new SNP locus (AX-110049563) that is significantly correlated with wheat spike length and grain number per spike and is stable, and developed a molecular marker dCAPS-MTA180-DdeI, which can be widely used in molecular marker-assisted breeding and genome-wide selection breeding of wheat spike length and grain number per spike, thereby accelerating the breeding process;

[0009] (2) The molecular marker dCAPS-MTA180-DdeI developed by the present invention realizes the efficient conversion of chip markers to molecular markers, and has the advantages of stable amplification, high detection efficiency and low cost. It can be used for the genetic improvement of wheat spike length and spikelet number traits, providing an effective marker resource for molecular marker-assisted breeding, and facilitating the breeding of new high-yield wheat varieties;

[0010] (3) By applying the molecular marker dCAPS-MTA180-DdeI related to wheat spike length and spikelet number developed by the present invention, it is possible to determine whether synergistic variation exists at the spike length and spikelet number loci of the wheat variety (line) to be tested, thereby greatly improving the selection efficiency and quality of wheat varieties (lines), minimizing costs, and directly realizing the identification of target loci in wheat germplasm resources and breeding offspring, providing reliable molecular markers for the genetic improvement of wheat yield-related traits and genomic selection-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a graph showing the electrophoresis detection result of the molecular marker dCAPS-MTA180-DdeI on polyacrylamide gel;

[0012] Figure 2 This is the result of the association analysis between the AX-110049563 locus and the number of grains per ear trait. ** indicates that the difference is extremely significant at the P<0.05 level.

[0013] Figure 3 This is the result of the association analysis between the AX-110049563 locus and the ear length trait. ** indicates that the difference is extremely significant at the P<0.05 level. DETAILED DESCRIPTION

[0014] The present invention is described in detail below with reference to the accompanying drawings and embodiments.

[0015] 1. Acquisition of SNP loci

[0016] Combining the 55K chip data of 311 wheat varieties (lines) and the phenotypic data of spike length and spikelet number in three environments in three years (E1: Luancheng, Shijiazhuang in 2019, E2: Laishan, Yantai in 2020, and E3: Laishan, Yantai in 2021), the generalized linear model (GLM) of the R language GAPIT package was used for whole-genome association analysis. A new SNP site significantly associated with wheat spike length and spikelet number was stably detected in all three environments, recorded as AX-110049563. AX-110049563 is located on chromosome 5B, corresponding to the physical position 550540826 in the Chinese Spring reference genome sequence RefSeq v2.1, and the genotype is CC or TT.

[0017] 2. Molecular marker development

[0018] Based on the reference genome sequence RefSeq v2.1 of Chinese spring wheat, the dCAPS primer design tool of the Wheat Alliance was used to design primers for the above SNP site (AX-110049563). The designed primer is dCAPS-MTA180-DdeI-F / R, and the nucleotide sequence is as follows:

[0019] dCAPS-MTA180-DdeI-F:ACAAAATGTATCGATGGCAATCTCA (SEQ ID NO: 1);

[0020] dCAPS-MTA180-DdeI-R: TGTTCCGTCGTCCAGATTGG (SEQ ID NO: 2).

[0021] The above primers dCAPS-MTA180-DdeI-F / R are used to perform PCR amplification on the DNA of the wheat to be tested. After the PCR amplification product is digested with a restriction endonuclease (DdeI), the corresponding molecular marker dCAPS-MTA180-DdeI can be obtained.

[0022] 3. Natural Population Detection

[0023] The molecular marker dCAPS-MTA180-DdeI was used to identify the genotypes of AX-110049563 locus in 311 wheat varieties (lines).

[0024] 1. PCR amplification

[0025] The PCR product was obtained by PCR amplification of the DNA of the wheat variety to be tested using the primers dCAPS-MTA180-DdeI-F / R. The PCR amplification system was 10 μL, which specifically contained: 1 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 2×Taq PCR premix reagent, 3 μL ddH 2 O; amplify using a common amplification procedure, the steps are as follows:

[0026] (i) Denaturation at 95°C for 5 min;

[0027] (ii) 34 cycles: denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 1 min;

[0028] (iii) Extend at 72°C for 10 min; terminate amplification and store at 4°C.

[0029] 2. Enzyme digestion

[0030] The PCR product was digested with restriction endonuclease DdeI to obtain the digestion product. The digestion system was 10 μL, including: 3 μL PCR product, 0.2 μL restriction endonuclease DdeI, 1 μL 10×CutSmart buffer, 5.8 μL ddH 2 O; the reaction condition is incubation at 37°C for 3-4h.

[0031] 3. Polyacrylamide gel electrophoresis detection

[0032] The obtained enzyme digestion products were placed in a 6.0% non-denaturing polyacrylamide gel (each 100 mL of gel solution contains 5.85 g acrylamide and 0.15 g methylene acrylamide) for electrophoresis separation for 2 hours. The wheat genotype to be tested was determined based on the electrophoresis results:

[0033] (1) If the size of the enzyme digestion product is 151 bp (SEQ ID NO: 5), the genotype of the wheat to be tested at the AX-110049563 site is TT, recorded as T;

[0034] (2) If the size of the enzyme cleavage products is 22 bp (SEQ ID NO: 3) and 129 bp (SEQ ID NO: 4), the genotype of the wheat to be tested at the AX-110049563 locus is CC, which is recorded as C.

[0035] The gel electrophoresis results of some (6) wheat varieties (lines) are shown in Figure 1 The genotype identification results of all (311) wheat varieties (lines) are shown in Table 1.

[0036] Table 1 Genotype identification results of AX-110049563 locus in natural populations

[0037]

[0038]

[0039]

[0040]

[0041] 4. Genetic effects of traits at loci related to wheat ear length and grain number per ear

[0042] The spike length and kernel number per spike of 311 wheat natural populations were measured in three environments. The best linear unbiased estimator (BLUE) of each trait in three environments was calculated using the R language lme4 package. Based on the genotype identification results of the dCAPS marker (dCAPS-MTA180-DdeI) transformed by the above-mentioned SNP locus (AX-110049563) with stable and significant correlation with spike length and kernel number in wheat in 311 natural population materials and the phenotypic data in three environments, the genetic effect of the target locus on spike length and kernel number per spike was analyzed.

[0043] The results of the association analysis between the AX-110049563 locus and the number of grains per ear are shown in Table 2, and the results of the association analysis between the AX-110049563 locus and the ear length are shown in Table 3.

[0044] Table 2 Results of association analysis between AX-110049563 locus and number of grains per ear

[0045]

[0046] Note: BLUE indicates the best linear unbiased estimate of each trait under three environments; *** indicates P < 0.001, * indicates P < 0.05.

[0047] Table 3 Results of association analysis between AX-110049563 locus and ear length

[0048]

[0049] Note: BLUE indicates the best linear unbiased estimate of each trait under three environments; *** indicates P<0.001, and * indicates P<0.05.

[0050] The results of association analysis between AX-110049563 locus and number of grains per ear are shown in Figure 2 , and the results of the correlation analysis with spike length are shown in Figure 3 .

[0051] From Table 2 and Figure 2It can be seen that based on the comprehensive multi-environment data, the T genotype at the AX-110049563 locus increased the number of grains per ear by 5.51% to 10.59% compared with the C genotype. The T genotype has a higher yield and is an excellent haplotype.

[0052] From Table 3 and Figure 3 It can be seen that based on the comprehensive multi-environment data, the T genotype at the AX-110049563 locus has an increase in ear length of 6.05% to 11.13% compared with the C genotype. The T genotype has a higher yield and is an excellent haplotype.

[0053] The above results indicate that the AX-110049563 locus has important breeding application value for the genetic improvement of wheat ear length and grain number related traits.

[0054] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. Application of a molecular marker dCAPS-MTA180-DdeI associated with wheat spike length in breeding wheat yield-related traits, wherein the molecular marker dCAPS-MTA180-DdeI is obtained by transforming a SNP site AX-110049563 significantly associated with wheat spike length, wherein AX-110049563 is located on chromosome 5B, and the physical position corresponding to the Chinese Spring reference genome sequence RefSeq v2.1 is 550540826, and the genotype is CC or TT. The molecular marker dCAPS-MTA180-DdeI is obtained by amplifying a product obtained by using an upstream primer shown in SEQ ID NO:1 and a downstream primer shown in SEQ ID NO:2, and then digesting the product with restriction endonuclease DdeI, wherein the nucleotide sequence is shown in SEQ ID NO:5, and the corresponding genotype of the AX-110049563 site is TT, or the nucleotide sequence is shown in SEQ ID NO:3 and SEQ ID NO:

4. As shown in NO:4, the corresponding genotype of the AX-110049563 locus is CC, and the yield-related trait is ear length.

Images