Eriocheir sinensis white spot virus QPCR (Quantitative Polymerase Chain Reaction) kit as well as use method and application thereof
By designing a kit of specific primer pairs and fluorescence quantitative PCR technology, the problem of complexity and specificity of white spot virus infection detection in Chinese mitten crab breeding industry is solved, and rapid and accurate virus detection is achieved, helping the breeding industry to effectively Monitor and control the spread of the virus.
Patent Information
- Application Number
- CN202411900730.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-02-18
AI Technical Summary
In the Chinese mitten crab breeding industry, white spot virus (WSSV) infection leads to large-scale deaths. The existing detection methods have problems such as complex operation and poor specificity, making it difficult to effectively monitor and control the spread of the virus.
A QPCR kit of Chinese mitten crab white spot virus was designed, and the specific primer pairs (WSSV-F and WSSV-R) and fluorescence quantitative PCR technology was used to achieve rapid and accurate detection of WSSV.
This kit can quickly and easily detect whether Chinese mitten crabs are infected with white spot virus. It has the advantages of strong specificity and good repetition. It can effectively help the breeding industry monitor and control the spread of the virus and reduce economic losses.
Smart Images
Figure CN119464580A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biological detection, and particularly relates to a Chinese mitten crab white spot virus QPCR kit and a use method and application thereof. Background Art
[0002] White spot syndrome virus (WSSV) is the most harmful virus in shrimp and crayfish aquaculture today, and is now widely prevalent in shrimp farms. WSSV mainly invades subcutaneous tissue, epidermal stratum corneum tissue, antennal glands, hematopoietic tissue, gills, hemolymphatic organs and other tissues and organs, and obvious swollen cells can be seen in severely diseased tissues. Tissue sections of the gills and hepatopancreas of the Chinese mitten crab were observed, and a large number of swollen cells were seen in both the gills and hepatopancreas, which were consistent with the shrimp tissue lesions caused by WSSV. In recent years, with the continuous deterioration of the aquaculture environment, the pathogenicity of WSSV has shown an increasing trend, and its host range is also expanding. Electron microscopic observations showed that WSSV is spindle-shaped, with virus particles about 210-380nm long and 70-167nm wide. One side is thick and flat and the other side is thin. The thin side has a long flagellum-like structure. It is the animal virus with the largest genome discovered so far. In 2000, scientists sequenced the entire genome of the mainland strain. The viral genome is a double-stranded circular DNA molecule with an A+T content of 59% and a genome size of 305kb.
[0003] Chinese mitten crab (Eriocheir sinensis), also known as river crab, belongs to the genus Eriocheir, family Grapsidae, order Decapoda, class Crustacea, and is an important economic crab. At present, the aquaculture of Chinese mitten crab is developing rapidly and has formed a large-scale. With the continuous increase in consumption, in order to improve the economic benefits of aquaculture, a multi-species mixed aquaculture model is often adopted in production, such as mixed aquaculture of Procambarus clarkii and Chinese mitten crab. However, in recent years, after entering June, a large number of deaths of Procambarus clarkii often occur, and then a large number of Chinese mitten crabs in the same aquaculture pond die. In severe cases, all Procambarus clarkii and Chinese mitten crabs in the entire pond die, causing huge economic losses to farmers and seriously threatening the healthy and sustainable development of Chinese mitten crab aquaculture. Therefore, investigating and detecting the infection of Chinese mitten crab with WSSV during aquaculture will help improve the success of Chinese mitten crab aquaculture. Summary of the invention
[0004] The present invention aims to provide a Chinese mitten crab white spot virus QPCR kit and a use method and application thereof, wherein the kit can detect the situation of Chinese mitten crab being infected with WSSV during the breeding process.
[0005] The objective of the present invention is achieved through the following technical solutions:
[0006] The invention provides a primer pair for detecting white spot virus of Chinese mitten crab, the primer pair comprising an upstream primer WSSV-F as shown in SEQ ID NO: 1 and a downstream primer WSSV-R as shown in SEQ ID NO: 2.
[0007] The present invention also provides a Chinese mitten crab white spot virus QPCR kit, wherein the amplification reaction system of the Chinese mitten crab white spot virus QPCR kit comprises a primer pair for detecting the Chinese mitten crab white spot virus.
[0008] Furthermore, the final concentration of the primer pair is 2 mM to 10 mM.
[0009] Furthermore, the amplification reaction system also includes enzyme solution and reaction buffer.
[0010] Furthermore, the enzyme solution is DNA polymerase, and the reaction buffer is 2X Premix Ex Taq Mix.
[0011] Furthermore, the amount of each substance used in the amplification reaction system is 10 μL of 2X PremixEx Taq Mix, 0.5 μL of upstream and downstream primers, and 3 μL of sample DNA template.
[0012] Furthermore, the amplification reaction conditions of the Chinese mitten crab white spot virus QPCR kit are pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing and extension at 60°C for 30s and collecting fluorescence signals, which are repeated for 40 cycles.
[0013] The present invention also provides a detection method of the Chinese mitten crab white spot virus QpCR kit, comprising the following steps:
[0014] (1) Using a commercial nucleic acid extraction kit to extract nucleic acid from the sample to be tested;
[0015] (2) configuring the amplification reaction system according to the amount of each substance in the amplification reaction system;
[0016] (3) placing the amplification reaction system prepared in step (2) in a fluorescent quantitative PCR instrument, performing an amplification reaction using the amplification reaction conditions, and collecting signals;
[0017] (4) Check the amplification curves in the corresponding channels respectively. A reaction with a good curve within 36 cycles is directly judged as positive, and a reaction after 36 cycles is directly judged as negative. At the same time, the positive control has obvious amplification, while the negative control has no amplification.
[0018] The present invention also provides an application of the primer pair or the Chinese mitten crab white spot virus QPCR kit in detecting the Chinese mitten crab white spot virus.
[0019] The beneficial effects of the present invention are:
[0020] The invention designs PCR primers respectively for the conservative sequence of the white spot virus of Chinese mitten crab, constitutes a primer group and a probe group specifically for the virus, and forms a fluorescent quantitative PCR detection kit for detecting the white spot virus of Chinese mitten crab. The detection method has the advantages of simple operation, strong specificity and good repeatability, and the result can be determined according to the amplification curve immediately after the reaction is completed, so that the white spot virus of Chinese mitten crab can be detected and identified at the same time. The method can save time and cost, reduce pollution, and has extremely high application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0022] Figure 1 This is a fluorescence quantitative PCR detection curve of Chinese mitten crab white spot virus in Example 1 of the present invention;
[0023] Figure 2 This is the electrophoresis diagram of PCR amplification of white spot virus nucleic acid of Chinese mitten crab in Example 2 of the present invention;
[0024] Figure 3 This is a fluorescence quantitative PCR detection curve of Chinese mitten crab white spot virus in Example 2 of the present invention;
[0025] Figure 4 This is a PCR detection curve diagram for sensitivity detection of white spot virus in Chinese mitten crab in Example 3 of the present invention. DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.
[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0031] The fluorescent quantitative PCR instruments used for detecting white spot virus of Chinese mitten crab in the following embodiments include but are not limited to: ABI series, Bio-Rad series, Rocheightcycler, Hangzhou Biori series, etc. The nucleic acid extraction kit used was purchased from Qingdao Insite Biotechnology Co., Ltd.
[0032] The present invention is specifically described below by way of examples.
[0033] Example 1
[0034] The Chinese mitten crab white spot virus QPCR kit prepared in Example 1 includes DNA polymerase and reaction buffer. The DNA polymerase and reaction buffer directly use commercially available 2X Premix Ex Taq Mix. A negative control may be provided. The negative control is 0.01 mol / L, pH 7.2 PBS buffered saline. In addition, the following primer pairs are included:
[0035] Upstream primer WSSV-F (SEQ ID NO. 1): 5′CCCAGTCGGGGGATAACTAC 3′;
[0036] Downstream primer WSSV-R (SEQ ID NO. 2): 5′ACTAGCTAATCCCACCTGGGTTC 3′.
[0037] The final concentration of the above primers is 2mM to 10mM.
[0038] The detection method of the above-mentioned Chinese mitten crab white spot virus QPCR kit prepared in this Example 1 is carried out according to the following steps:
[0039] (1) Extracting nucleic acid from the sample to be tested: using a commercial nucleic acid extraction kit to extract nucleic acid from the sample to be tested;
[0040] (2) Prepare the amplification reaction system: The system is: 20 μL PCR amplification reaction solution, including 10 μL 2X Premix Ex Taq Mix, 0.5 μL of each primer, 6 μL sterile water, and 3 μL of the sample nucleic acid to be tested. The details are shown in Table 1.
[0041] Table 1 Amplification reaction system
[0042] Composition Dosage 2X Premix Ex Taq Mix 10μL Upstream primer WSSV-F (10nM) 0.5μL Downstream primer WSSV-R (10mM) 0.5μL Sample DNA template 3μL Add sterile water to 20μL
[0043] (3) Fluorescence quantitative PCR amplification: The prepared amplification reaction system in the PCR tube was placed in a fluorescence quantitative PCR instrument for amplification reaction. The amplification reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 30 seconds, and collecting fluorescence signals for 40 cycles.
[0044] (4) Result determination: After the fluorescence quantitative PCR reaction is completed, the amplification curve of the corresponding channel is obtained ( Figure 1 ), observe whether the target detection fluorescence signal in the specific PCR reaction system forms an amplification curve. If the fluorescence curve has an S-shaped amplification curve formed by the FAM signal and the ct value of the channel is less than 36, it means that the Chinese mitten crab white spot virus is present in the sample to be tested.
[0045] Example 2
[0046] According to the Chinese mitten crab white spot virus QPCR kit and the supporting detection method prepared in Example 1 of the present invention, 13 strains of Chinese mitten crab white spot virus were detected by fluorescence quantitative PCR, and the specific process is as follows:
[0047] 1) Sample nucleic acid extraction: 13 samples were to be extracted, including 13 samples of Chinese mitten crab white spot virus, which were extracted using commercial bacterial nucleic acid extraction kits to obtain the samples to be tested;
[0048] 2) Take 3 μL of the above-mentioned sample to be tested and the PCR reaction solution in the detection kit, mix them separately, add them to the PCR reaction tube, mix them by pipetting, and place them on the fluorescent quantitative PCR instrument for reaction;
[0049] 3) The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 30 seconds, and collecting fluorescence signals for 40 cycles;
[0050] 4) Result analysis: First, electrophoresis can be used to determine whether the size of the PCR product meets the experimental expectations (specific results are as follows Figure 2 The result is judged by the size of the fluorescence amplification curve Ct value to determine whether the sample contains Chinese mitten crab white spot virus. Figure 3 When the Ct value is ≤36 and shows obvious exponential growth, the result is positive; when the Ct value of the amplification curve is >36 or there is no Ct value, the result is negative; in order to have a reference when judging the test results; a negative control needs to be set for the Chinese mitten crab white spot virus fluorescent PCR detection kit when testing samples.
[0051] Example 3 Specific detection of WSSV primer pairs
[0052] WSSV, reovirus, and herpes simplex virus genomic DNA were used as templates, and WSSV primer pairs (primer pair 1 composed of nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2) were used as primers. Amplification was performed according to the amplification system and reaction conditions in Example 1, and the amplification results were detected by electrophoresis. The test results are shown in Table 2. It can be seen from the table that only the result using WSSV genomic DNA as a template is positive, and the results of other groups are negative. This shows that the WSSV primer pair has high specificity.
[0053] Table 2 Quantitative PCR specificity test
[0054]
[0055] Example 4 Sensitivity Detection of WSSV Primers
[0056] The OD was measured by spectrophotometer, and the concentration of WSSV genomic DNA obtained in Example 1 was 12000 μg / μL. Before the experiment, the concentration was adjusted to 3 μg / mL, and the WSSV sample was diluted 10 times (from 3×10 -2 ng to 3×10 -7 ng), using WSSV genomic DNA as a template, amplification was performed according to the PCR reaction system and amplification system of Example 1. The results are shown in Figure 4It can be seen that when the content of WSSV genomic DNA is greater than 3×10 -7 ng can achieve effective amplification.
[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.
Claims
1. A primer pair for detecting white spot virus of Chinese mitten crab, characterized in that: The primer pair includes an upstream primer WSSV-F as shown in SEQ ID NO: 1 and a downstream primer WSSV-R as shown in SEQ ID NO:
2.
2. A QPCR kit for white spot virus of Chinese mitten crab, characterized in that: The amplification reaction system of the Chinese mitten crab white spot virus QPCR kit comprises a primer pair for detecting the Chinese mitten crab white spot virus.
3. The Chinese mitten crab white spot virus QPCR kit according to claim 2, characterized in that The final concentration of the primer pair is 2 mM to 10 mM.
4. The Chinese mitten crab white spot virus QPCR kit according to claim 2, characterized in that: The amplification reaction system also includes enzyme solution and reaction buffer.
5. The Chinese mitten crab white spot virus QPCR kit according to claim 4, characterized in that The enzyme solution is DNA polymerase, and the reaction buffer is 2X Premix Ex Taq Mix.
6. The Chinese mitten crab white spot virus QPCR kit according to claim 1, characterized in that The amount of each substance used in the amplification reaction system is 10 μL of 2X PremixEx Taq Mix, 0.5 μL of upstream and downstream primers, and 3 μL of sample DNA template.
7. The Chinese mitten crab white spot virus QPCR kit according to claim 1, characterized in that: The amplification reaction conditions of the Chinese mitten crab white spot virus QPCR kit are: pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing and extension at 60°C for 30s and collecting fluorescence signals, for a total of 40 cycles.
8. The detection method of the Chinese mitten crab white spot virus QPCR kit according to any one of claims 2 to 7, characterized in that: The following steps are involved: (1) Using a commercial nucleic acid extraction kit to extract nucleic acid from the sample to be tested; (2) configuring the amplification reaction system according to claim 6; (3) placing the amplification reaction system prepared in step (2) in a fluorescent quantitative PCR instrument, performing an amplification reaction using the amplification reaction conditions described in claim 7, and collecting signals; (4) Check the amplification curves in the corresponding channels respectively. A reaction with a good curve within 36 cycles is directly judged as positive, and a reaction after 36 cycles is directly judged as negative. At the same time, the positive control has obvious amplification, while the negative control has no amplification.
9. Use of the primer pair according to claim 1 or the Chinese mitten crab white spot virus QPCR kit according to any one of claims 2 to 7 in detecting Chinese mitten crab white spot virus.