Application of tomato SlCHLH gene in regulation and control of chlorophyll synthesis and / or fruit maturation

Abstract

The invention discloses an application of a tomato SlCHLH (Solanum lycopersicum SlCHLH) gene in regulation and control of chlorophyll synthesis and / or fruit maturation. The CDS coding sequence of the SlCHLH gene is as shown in SEQ ID NO. 1. A cultivated tomato Ailsa Craig (AC) is used as a background material, and a chlorophyll defect mutant is directionally screened by utilizing chemical mutagenesis of ethyl methanesulfonate, so that the mutant mut26 is obtained, and the mutant mut26 shows plant chlorosis and fruit late-maturing phenotypes. Genetic positioning analysis and functional complementation experiments show that a mut26 mutation site is located on a chlorophyll synthesis related gene SlCHLH, and it is found that an slchlh gene in mut26 has a nucleotide coding sequence shown as SEQ ID NO.2. According to the invention, the function of the SlCHLH gene in tomato is researched, and the gene affects the chlorophyll content of tomato plants, regulates a reverse signal generated by chloroplast and affects the ripening process of fruits.

Description

Technical Field

[0001] The invention belongs to the fields of molecular biology and genetic engineering, and specifically relates to an application of a tomato SlCHLH gene in regulating chlorophyll synthesis and / or fruit ripening. Background Art

[0002] Chloroplasts originated from the endosymbiotic behavior of non-photosynthetic eukaryotic cells engulfing cyanobacteria. After that, the genome of cyanobacteria was largely lost or transferred to the nuclear genome of the host cell, but a small number of genes were retained to form the chloroplast genome. Chloroplasts are semi-autonomous organelles with independent protein synthesis equipment, but some protein complexes in chloroplasts are co-encoded by the chloroplast genome and the nuclear genome, which requires intracellular signal exchange. Reverse signaling refers to the regulation of nuclear gene expression by plastids (including chloroplasts) by transmitting signals to the nucleus to meet their own growth and development needs. At present, studies have revealed at least four ways to transmit reverse signals: (1) accumulation of tetrapyrrole intermediates; (2) inhibition of plastid gene expression; (3) changes in plastid redox state; and (4) production of reactive oxygen species (Wu and Bock., 2021; Jan et al., 2022). Active reverse signals often appear in the formation of chloroplasts and in response to stress, but whether they are involved in other biological processes and the detailed signal transmission mechanism still need to be further clarified.

[0003] Tomato (Solanum lycopersicum) is a model plant for studying the development and maturation of fleshy fruits. It is deeply loved by researchers because of its advantages such as short growth cycle, rich germplasm resources, detailed genome information and mature genetic transformation system. At the same time, berry vegetables such as tomatoes are prone to damage or rot during post-harvest storage and transportation due to their short maturation cycle, which brings unnecessary losses to agricultural production. With the vigorous development of related technologies such as genetic engineering, transgenic breeding is increasingly recognized by the public. Extending the shelf life and storage resistance of fruits through transgenic breeding has become a hot topic of research at home and abroad. Tomato is a respiratory climacteric fruit, and its ripening process is accompanied by enhanced respiration and release of ethylene. In addition to tomatoes, fruits such as apples (Malus domestica) and bananas (Musa paradisiaca) are also respiratory climacteric fruits. Therefore, studying the influencing factors of tomato fruit ripening is of great significance for the selection and improvement of respiratory climacteric fruit varieties. Summary of the invention

[0004] The present invention aims to provide an application of a SlCHLH gene in regulating tomato chlorophyll synthesis and fruit ripening. The present invention utilizes molecular biology, genetic engineering and other related technologies to locate and complement the genetic genes of a tomato chlorotic mutant mut26 obtained by EMS mutagenesis, and identifies a gene, SlCHLH, that is involved in regulating tomato chlorophyll synthesis and tomato fruit ripening. The SlCHLH gene is introduced into the mutant mut26 to restore its plant chlorosis and fruit late-ripening phenotype. Therefore, by changing the function of SlCHLH, the ripening and time to market of tomatoes can be reasonably regulated to serve agricultural production. Currently, there is no relevant report on the gene of the present invention in regulating ripening.

[0005] The technical solution of the present invention is as follows:

[0006] First aspect:

[0007] The application of SlCHLH gene in regulating chlorophyll synthesis and / or respiratory climacteric fruit ripening, the nucleotide coding sequence (CDS, Coding sequence) of the SlCHLH gene is shown in SEQ ID NO.1.

[0008] The climacteric fruit includes tomato, apple, banana, avocado or mango.

[0009] The SlCHLH gene regulates SlACS2 (SGN accession number: Solyc01g095080), SlACS4 (SGN accession number: Solyc05g050010), SlACO1 (SGN accession number: Solyc07g049530), SlNR (SGN accession number: Solyc09g075440), SlE4 (SGN accession number: Solyc03g111720), S The expression of one or more genes among lE8 (SGN accession number: Solyc09g089580), SlPL (SGN accession number: Solyc03g111690), SlRIN (SGN accession number: Solyc05g012020), SlPSY1 (SGN accession number: Solyc03g031860) and SlHY5 (SGN accession number: Solyc08g061130) regulates fruit ripening.

[0010] Second aspect:

[0011] A recombinant plasmid, wherein the recombinant plasmid uses the plant expression vector pHellsgate8 as a skeleton and expresses SlCHLH Pro:: SlCHLH The nucleotide sequence of gDNA, SlCHLH Pro:: SlCHLHThe nucleotide sequence of gDNA is shown in SEQ ID NO.3.

[0012] The third aspect:

[0013] Use of the recombinant plasmid as described above in regulating chlorophyll synthesis and / or tomato fruit ripening.

[0014] Furthermore, the method for constructing the recombinant plasmid comprises the following steps:

[0015] 1) Using the plant expression vector pHellsgate8 as the backbone, the vector pHellsgate8 was cut with restriction endonucleases SacI and XbaI to obtain the linearized vector Linear pHellsgate8;

[0016] 2) Using the genomic DNA of cultivated tomato AC as a template, the amplification primers SlCHLH-Fw and SlCHLH-Rv containing homology arms were used for amplification to obtain the target fragment SlCHLH Pro:: SlCHLH gDNA; SlCHLH Pro:: SlCHLH The nucleotide sequence of gDNA is shown in SEQ ID NO.3;.

[0017] 3) Using homologous recombination, the target fragment SlCHLH Pro:: SlCHLH gDNA was connected to the linearized vector LinearpHellsgate8 to obtain the recombinant plasmid pHellsgate8-SlCHLH.

[0018] A fourth aspect: application of a mutant gene of the SlCHLH gene in the breeding of late-maturing tomato varieties, wherein the mutant gene of the SlCHLH gene is slchlh, and its nucleotide coding sequence is shown in SEQ ID NO.2.

[0019] Fifth aspect:

[0020] A method for obtaining a chlorotic mutant comprises the following steps:

[0021] The cultivated tomato AC was induced to produce the chlorotic mutant mut26 by EMS mutagen.

[0022] The steps for mutagenesis of cultivated tomato AC using EMS mutagen are as follows:

[0023] 1) Use EMS mutagen stock solution as solute and phosphate buffer as solution to prepare EMS working solution, sterilize and set aside;

[0024] 2) Shake the cultivated tomato AC seeds in water for 8-20 hours;

[0025] 3) After the shaking is completed, the seeds are dried and placed in the EMS working solution prepared in step 1, shaken in the dark for 12-20 hours, and then rinsed with clean water to terminate the mutagenesis and obtain the M1 mutagenized tomato strain;

[0026] 4) Self-pollinating the M1 mutagenized tomato strain to obtain the M2 mutagenized tomato strain;

[0027] 5) Planting M2 mutagenized tomato lines for phenotypic statistics; self-pollinating the M2 mutagenized tomato lines with the chlorotic phenotype to obtain the M3 mutagenized tomato lines; planting the M3 mutagenized tomato lines for M3 phenotype verification; retaining the M3 mutagenized tomato lines that can repeat the M2 chlorotic phenotype to construct a mutant library.

[0028] The present invention also provides a method for detecting a tomato reverse signal mutant, comprising the following steps:

[0029] 1) Sow sterilized tomato seeds evenly on 1 / 2MS medium and culture in the dark for 3 days until the seeds turn white.

[0030] 2) Select tomato seeds with the same degree of whitening and place them on MS medium (MS powder 4.4g / L + 2% sucrose + 0.8% agar powder, pH = 5.8) containing or not containing 5μM NF (norflurazon, a carotenoid biosynthesis inhibitor used to block chloroplast development to detect reverse signals) reagent, 9 seeds per dish, and 2 dishes of each material. Then place them vertically in an artificial climate box (24h light treatment, light intensity of 100μmol·m -2 ·s -1 ), and RNA was extracted and reverse transcribed into cDNA after 5 days of treatment.

[0031] 3) Real-time fluorescence quantitative PCR was used to compare the expression levels of tomato photosynthesis-associated nuclear genes in different materials after NF treatment.

[0032] The present invention clarifies that the slchlh gene is a key candidate gene that causes the mutant mut26 to lack chlorophyll and delay fruit ripening:

[0033] 1) The background material of the tomato chlorotic mutant mut26 was cultivated tomato AC. Mut26 was hybridized with wild currant tomato LA1589 to obtain the F1 generation, and then self-pollinated to obtain the F2 generation genetic mapping population. By observing the phenotype of the F1 and counting and calculating the segregation ratio of wild-type individuals and mutant individuals in the F2 generation, it was determined that it was a mutant controlled by a recessive single gene.

[0034] 2) Extract DNA from each individual plant of mut26, LA1589, F2 wild-type and F2 mutant plants, construct 4 corresponding DNA pools for Bulk Segment Analysis (BSA) and draw Manhattan plots. Within the range beyond the 99% confidence interval, the sequencing results of the pool of mutant mut26 genetic background material AC were combined and the candidate mutation site SlCHLH was screened according to reasonable standards.

[0035] The SlCHLH gene of the present invention has a nucleotide coding sequence as shown in SEQ ID NO.1; it is highly homologous to the GUN5 (GENOMES UNCOUPLED5) gene (TAIR accession number: AT5G13630) in the model plant Arabidopsis thaliaba, and encodes the H subunit (SlChlH) protein in the magnesium chelatase (MgCh) complex in the chlorophyll synthesis pathway.

[0036] 1) Sequence analysis of the SlCHLH gene showed that the SlCHLH gene had an open reading frame (ORF) of 4146 bp, encoding a protein containing 1381 amino acids. The predicted molecular weight of the protein was 153.71 kDa, and its amino acid sequence was highly conserved in crops such as soybean (Glycine max), tobacco (Nicotiana tabacum), and sorghum (Sorghum bicolor). Gene mapping results showed that the 398th proline of the SlChlH-M protein in the chlorotic mutant mut26 mutated to serine, which is a candidate mutation that causes the chlorotic and delayed fruit ripening phenotype of mut26.

[0037] 2) Extract the genomic DNA sequence (genome DNA, gDNA) of SlCHLH from AC, a total of 8209 bp, including 1968 bp upstream of the gene (including the promoter), 334 bp downstream, and all exon and intron sequences. The plant expression vector pHellsgate8 was double-digested with restriction endonucleases SacI and XbaI to obtain a linearized fragment, and then the linearized vector Linear pHellsgate8 and the target fragment were ligated by homologous recombination enzymes. SlCHLH Pro:: SlCHLH gDNA was connected to obtain the recombinant plasmid pHellsgate8-SlCHLH.

[0038] The target vector was further transferred into Agrobacterium GV3101, and the mutant mut26 was used as the background material. The Agrobacterium-mediated tomato genetic transformation system was used to obtain transgenic positive strains (#6 and #25) through kanamycin screening and PCR (polymerase chain reaction) identification.

[0039] 3) By comparing the transcription levels of PhANGs genes in cultivated tomato AC, chlorotic mutant mut26 and restorer line (#6) seedlings under NF treatment, it was found that NF treatment significantly inhibited the transcription level of PhANGs in AC, the inhibition of related genes in mutant mut26 was significantly weakened (SlCAB1B and SlCAB1C) or not inhibited (SlRBCS1 and SlRBCS2A), while restorer line #6 restored the transcription inhibition of PhANGs relative to mutant mut26. The above results indicate that mut26 partially blocked the transcription inhibition of tomato PhANGs genes caused by reverse signals, thus confirming that mut26 is a tomato reverse signal mutant.

[0040] 4) By investigating and recording the fruit phenotypes of tomato AC, chlorotic mutant mut26 and restorer line (#6), it was found that the fruits of mutant mut26 were light green in the expansion and green maturity period (32dpa and 35dpa) compared with AC, and the maturity period (38-44dpa) showed a significant delay in fruit maturity (about 3d). The restorer line #6 restored the chlorotic and late-maturing phenotypes of mutant mut26 fruits to the wild-type level, confirming the function of SlCHLH gene in regulating tomato chlorophyll synthesis and tomato fruit ripening. Compared with AC of the same period, the ethylene release, carotenoid content and soluble solids content in mutant mut26 fruits were significantly reduced, and the rate of chlorophyll degradation was also significantly slowed down. In addition, mutant mut26 also reduced the expression levels of genes positively correlated with ripening in early ripening fruits, including genes SlACS2 (SGN accession number: Solyc01g095080), SlACS4 (SGN accession number: Solyc05g050010), SlACO1 (SGN accession number: Solyc07g049530), SlNR (SGN accession number: Solyc09g075440), SlE4 (SGN accession number: Solyc09g075440), and SlS4 (SGN accession number: Solyc09g075440). The mutant mut26 inhibited the expression of maturation-related nuclear genes by blocking the SlCHLH-mediated reverse signaling.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] The chlorophyll synthesis gene SlCHLH of the present invention is applied to tomatoes and other climacteric fruits, such as apples, bananas, avocados and mangoes. At present, the research on the ripening mechanism of climacteric fruits focuses on the genes or transcription factors related to the ethylene signal transduction pathway. The present invention provides a new direction for studying fruit ripening, that is, it establishes the connection between the reverse signal of chloroplasts and the fruit ripening process, and lays a theoretical foundation for the subsequent regulation of chloroplast reverse signals by transgenic means or chemical reagents to change fruit ripening, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0044] Figure 1It is the structure diagram of tomato SlCHLH gene; the underlined bases represent the difference bases of SlCHLH gene in cultivated tomato AC and chlorotic mutant mut26, and the corresponding amino acids encoded are in brackets.

[0045] Figure 2 This is the structure diagram of the plant expression vector pHellsgate8 (A), the gene fragment expressed in the transgenic tomato SlCHLH Pro:: SlCHLH gDNA structure diagram (B) and PCR identification results of positive transgenic tomatoes (C); in Figure (A), CaMV35Spromoter represents the cauliflower mosaic virus 35S promoter, ccdB represents the lethal protein encoding gene, KanR represents the kanamycin resistance gene, NOS promoter represents the nopaline synthase promoter, and NOS terminator represents the nopaline synthase terminator; LB T-DNA repeat represents the left border of the transfer DNA; RB T-DNA repeat represents the right border of the transfer DNA; SmR represents spectinomycin resistance; in Figure (B), LB and RB represent the left and right borders of the target gene connected to the plant expression vector pHellsgate8, respectively, and Fw and Rv indicate the positions of the forward and reverse primers used to identify positive seedlings, respectively; in Figure (C), '+' represents the recombinant plasmid pHellsgate8-SlCHLH.

[0046] Figure 3 This is a comparative diagram of the fold change of tomato PhANGs gene expression levels in cultivated tomato AC, chlorotic mutant mut26, and transgenic restorer line (#6) seedlings after NF treatment. The expression level of tomato PhANGs genes in each material without NF treatment was 1, and the internal reference gene was SlACTIN (SGN accession number: Solyc03g078400). The average of three biological replicates was taken, and the error bars represent the standard error (SE).

[0047] Figure 4 The figure is a comparative diagram of the relative expression level of SlCHLH (A) and the protein level of SlChlH (B) in AC fruits at different maturity stages (swelling stage, green ripe stage, color breaking stage, yellow ripe stage and red ripe stage). In Figure (A), the expression level of SlCHLH in AC fruits at the swelling stage was set as 1, SlACTIN was used as the internal reference gene, and the average value of three biological replicates was taken, and the error bars represent the standard error (SE); in Figure (B), Actin protein was used as the internal reference protein, and the asterisk indicates the nonspecific band.

[0048] Figure 5These are representative fruit photos of cultivated tomato AC, chlorotic mutant mut26 and transgenic restorer line (#6) at different times after anthesis (days post anthesis, dpa) (32 dpa, 35 dpa, 38 dpa, 41 dpa and 44 dpa).

[0049] Figure 6 This is a schematic diagram of the comparison of ethylene release rates in the fruits of cultivated tomato AC and the chlorotic mutant mut26 at different fruit ripening stages (32 dpa, 35 dpa, 38 dpa, 41 dpa and 44 dpa), nd means not detected. The mean of three biological replicates is taken, and the error bars represent the standard error (SE).

[0050] Figure 7 This is a schematic diagram of the comparison of chlorophyll (A) and carotenoid (B) contents in the fruits of cultivated tomato AC and chlorotic mutant mut26 at different stages; Figure (A) Chlorophyll detection selected 32dpa, 35dpa, 38dpa, 41dpa and 44dpa fruit exocarp; Figure (B) Carotenoid detection selected 44dpa fruit exocarp detection β-carotene, lutein and lycopene, nd means failure to detect, different lowercase letters represent significant differences at the P<0.05 level. The average of three biological replicates was taken, and the error bar represents the standard error (SE).

[0051] Figure 8 This is a schematic diagram of the comparison of soluble solids content in the fruits of cultivated tomato AC and chlorotic mutant mut26 at 44 dpa. Different lowercase letters represent significant differences at the P<0.05 level, n>40.

[0052] Fig. 9 The relative expression levels of ripening-related genes in cultivated tomato AC and chlorotic mutant mut26 at different developmental stages (35 dpa and 38 dpa). The internal reference gene is SlACTIN (SGN accession number: Solyc03g078400). The mean of three biological replicates was taken, and the error bars represent the standard error (SE). DETAILED DESCRIPTION

[0053] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0054] In the following embodiments:

[0055] Wild currant tomato LA1589: (Quoted from the American Tomato Genetic Resource Center, http: / / tgrc.ucdavis.edu / )

[0056] Tomato chlorotic mutant mut26: (a chlorotic mutant screened by EMS mutagenesis in the cultivated tomato AC background)

[0057] Cultivated tomato AC: (Quoted from the agricultural and animal husbandry B2B online trading platform, https: / / www.agriexpo.cn / )

[0058] pHellsgate8 plasmid: (BioVector plasmid vector strain cell protein antibody gene storage center, http: / / www.biovector.net / )

[0059] Agrobacterium strain GV3101: (Zeye Biotechnology, Shanghai)

[0060] Escherichia coli DH5α: (Zeye Biotechnology, Shanghai)

[0061] Actin and ChlH antibodies (PhytoAB, USA)

[0062] Table 1 Primer sequences of the present invention

[0063]

[0064]

[0065] Example 1: Location of candidate genes

[0066] 1. Obtaining the chlorotic mutant mut26

[0067] Through EMS chemical mutagenesis, cultivated tomato AC was used as the background material to screen chlorophyll-deficient mutants, thereby obtaining a chlorotic mutant named mut26. The following steps are included:

[0068] 1) Using EMS mutagen stock solution as solute and 0.1 mol / L phosphate buffer (pH=7.0) as solution, prepare 200 mL of 1% (W / V) EMS working solution, sterilize by high pressure (121° C., 15 min) and set aside.

[0069] 2) Place 300 AC seeds of uniform size in 200 mL of deionized water and shake them in a constant temperature shaker for 8 h (28° C., 130 r / min).

[0070] 3) After the shaking, the seeds were dried with absorbent paper and placed in the prepared EMS working solution. The seeds were shaken in a light-proof constant temperature shaking box for 12 h (28°C, 130 r / min). After the shaking, the seeds were rinsed with running water for 2 h to terminate the mutagenesis and obtain the M1 mutagenized tomato line.

[0071] 4) Planting the M1 mutagenized tomato lines and self-pollinating them to obtain the M2 mutagenized tomato lines; planting 10 plants of each M2 mutagenized tomato line as a family for phenotypic investigation; self-pollinating the M2 mutagenized tomato plants with the chlorotic phenotype to obtain the M3 mutagenized tomato lines, and sowing the M3 mutagenized tomato lines to verify the M3 phenotype; retaining the M3 mutagenized tomato lines that can repeat the M2 chlorotic phenotype to construct a mutant library.

[0072] 5) The chlorotic mutant mut26 was selected from the mutant library as the research object. Field phenotypic investigation found that the chlorotic phenotype of mut26 lasted throughout the vegetative and reproductive growth periods, manifested as yellowing of the base of true leaves in the seedling stage, light green leaves in the late development stage, yellow stigma in the flowering stage, and light green fruits in the green maturity stage.

[0073] 2. Hybridization of the chlorotic mutant mut26 and the wild currant tomato LA1589

[0074] One day in advance, the unopened flower buds of the mutant mut26 were emasculated. The next morning, the pollen of the wild currant tomato LA1589 in full bloom (as the male parent) was picked with sterilized tweezers and inoculated on the emasculated stigma of the mutant mut26 (as the female parent), and marked. After the hybrid fruit matured, the F1 generation seeds were collected. The F1 generation material was self-pollinated to obtain the F2 generation seeds.

[0075] 3. The chlorosis phenotype of the F2 mutant mut26×wild currant tomato LA1589 hybrid population was counted and a bulked-segregant analysis (BSA) was performed.

[0076] In the spring of the following year, 20 plants of AC tomato, mutant mut26 and wild currant tomato LA1589 were sown, 50 F1 materials of hybrid combination mut26×LA1589 and 200 F2 self-pollinated materials were collected, and the phenotypes were statistically analyzed. Based on the chlorophyll-related phenotypes of mutant mut26 at seedling stage, flowering stage and green-ripe fruit stage, we found that the F1 individuals all showed a normal green phenotype similar to the father LA1589 by investigating the leaf, stigma and fruit phenotypes, and the number ratio of wild-type individuals (with normal green leaves, fruits and green stigma phenotypes) to mutant individuals (with chlorotic leaves, yellow stigma and light green fruit phenotypes) in the F2 generation was about 3:1, so it was speculated that the chlorotic mutant mut26 was a recessive mutant controlled by a single gene.

[0077] After confirming the segregation law of chlorosis mutation, we selected 6 plants of cultivated tomato AC, mutant mut26 and wild currant tomato LA1589, and 30 plants of F2 wild-type and mutant individuals. DNA was extracted from these plants, and the DNA quality was tested by NanoDrop micro-spectrophotometer and agarose gel electrophoresis to ensure DNA integrity and quantity, and five corresponding DNA pools were formed in equal proportions. The five DNA pools were subjected to high-throughput sequencing, and the sequencing results of mut26, LA1589, F2 wild-type and F2 mutant pools were selected for BSA and Manhattan plots were drawn (Paisono, Shanghai). The specific parameters are as follows: the reference genome is SL2.50 (http: / / solgenomics.net), and the sequencing depth is 20× (AC, mut26 and LA1589) and 30× (F2 mutant pool and F2 wild-type pool).

[0078] After sequencing and splicing, filter the population SNP (single nucleotide polymorphism) and calculate the SNP-index value according to the following requirements:

[0079] (1) Keep the homozygous and inconsistent SNP sites of LA1589 and mut26;

[0080] (2) removing the spots with sequencing depth lower than 5× in the above five mixed pools;

[0081] (3) Retain any site with a SNP-index value higher than 0.3 in the mixed pool.

[0082] (4) The SNP-index value of the wild-type pool was subtracted from the SNP-index value of the F2 mutant pool to obtain the delta SNP-index value and draw a Manhattan plot. The 99% confidence level was selected as the screening threshold, and the interval where the candidate gene was located was obtained, which was located on chromosome 4 and was about 50 Mb.

[0083] In the candidate interval, we further integrated the mixed pool sequencing results of AC, and based on the previous phenotypic investigation, we formulated the following screening criteria: Because tomatoes are diploid plants and mut26 is a recessive single gene controlled mutant, this site is homozygous and has a genotype of 0 / 0 in the parents AC and LA1589, homozygous and has a genotype of 1 / 1 in mut26 and the F2 generation mutant pool, and heterozygous and has a genotype of 0 / 1 or 0 / 0 in the F2 generation wild type (where the alleles consistent with the reference genome are marked as 0, and the inconsistent markers are marked as 1). According to the above criteria, a total of 30 SNP sites and 10 insertion-deletion (Indel) sites that meet the conditions were screened in the candidate interval, of which only one SNP site is located in the coding region, and the remaining SNP and Indel sites are all located in the non-coding region. Combined with the tomato database (https: / / solgenomics.net / ), it was found that the SNP site is a mutation from G to A at position 6038590 on chromosome 4 of the tomato genome (SL2.50). The genome annotation shows that SlCHLH is located on the negative strand of the genome. The SNP mutation is located in the first exon of the slchlh gene of the mut26 mutant, resulting in a mutation from C to T at position 1192 of the gene coding region (coding sequence, CDS, such as SEQ ID NO.1); the CDS sequence of slchlh in the mut26 mutant is SEQ ID NO.2; and the proline (Pro) at position 398 of its encoded protein SlChlH-M is replaced by serine (Ser) (such as Figure 1 ). The SlCHLH gene is a homologous gene of the Arabidopsis reverse signal gene GUN5, which encodes the H subunit of magnesium ion chelatase, a key enzyme in chlorophyll synthesis. Therefore, we inferred that the slchlh gene was the most likely candidate gene for the mutant mut26.

[0084] Example 2: Construction of plant expression vector

[0085] 1) Genomic DNA sequence (gDNA) of tomato SlCHLH SlCHLH Pro:: SlCHLH Cloning of gDNA (such as Figure 2 B and SEQ ID NO.3).

[0086] After the cultivated tomato AC leaves were frozen in liquid nitrogen and ground into powder, 0.1 g was weighed and transferred to a 1.5 mL centrifuge tube. DNA was extracted using a plant DNA extraction kit (Tiangen, China), and the DNA quality was tested using a NanoDrop micro-spectrophotometer and agarose gel electrophoresis. The qualified DNA was amplified with a high-fidelity enzyme (Nanjing Novozyme) in the reaction system: 25 μL of high-fidelity enzyme 2×Phanta Max Master Mix, 400 ng of DNA template, and 2 μL of each amplification primer with homologous recombination arms at a concentration of 10 μM (forward primer SlCHLH-Fw: 5'- CATCCAACGCGTTGGGAGCTC TTTCTCTCCCGTTCAGTTCTTAC-3', such as SEQ ID NO.4; and reverse primer SlCHLH-Rv: 5'- TCATTAAAGCAGGACTCTAGA GAGATGTCTACAAATGTCCCAAAA-3', such as SEQ ID NO.5; the underline is the homology arm sequence), add ddH2O to 50μL. The PCR reaction program is: 95℃3min; 95℃30s, 56℃30s, 72℃4.5min, 35cycles; 72℃5min. After the PCR reaction is completed, all PCR products are subjected to agarose gel electrophoresis and the position of the target band is determined by a blue light gel illuminator (about 8200bp). The gel block containing the target band is cut out and recovered with a gel recovery kit (Shanghai) and the target fragment is detected by NanoDrop micro spectrophotometer and agarose gel electrophoresis. SlCHLH Pro:: SlCHLH The quality of gDNA and the target fragments with qualified quality SlCHLH Pro:: SlCHLH gDNA was stored in a -20℃ refrigerator.

[0087] 2) Obtaining the linearized plant expression vector Linear pHellsgate8.

[0088] The pHellsgate8 (BioVector plasmid vector strain cell protein antibody gene storage center, http: / / www.biovector.net / ) expression vector was used as the backbone for construction. It has spectinomycin resistance when expressed in Escherichia coli and Agrobacterium, and has kanamycin resistance when expressed in plants. The plant expression vector pHellsgate8 (such as Figure 2A), the reaction system is: pHellsgate8 plasmid is 4μg, FastDigest buffer is 4μL, SacI and XbaI are 2μL each, and ddH20 is added to 40μL. After reacting at 37℃ for 1h, all the reaction products are subjected to agarose gel electrophoresis, and the uncut pHellsgate8 vector is used as a negative control (in agarose gel electrophoresis, the linearized vector moves slower than the uncut vector), and the position of the linearized vector LinearpHellsgate8 is observed by a blue light gel illuminator. The gel block containing the target band is cut out and recovered with a gel recovery kit (Shanghai) and the quality of the linearized vector Linear pHellsgate8 is detected by NanoDrop micro-spectrophotometer and agarose gel electrophoresis. The qualified linearized vector Linear pHellsgate8 is stored in a -20℃ refrigerator.

[0089] 3) The recombinant plasmid pHellsgate8-SlCHLH was constructed by homologous recombination.

[0090] The linearized vector fragment Linear pHellsgate8 and the target fragment were ligated using homologous recombination enzyme (Novozyme, Nanjing) SlCHLH Pro:: SlCHLH gDNA was connected. The reaction system was: 2 μL of 5×CE II Buffer, 1 μL of homologous recombinase ExnaseII, 100 ng of linearized expression vector, 100 ng of target fragment, and 10 μL of ddH20. After reacting at 37°C for 30 min, quickly place on ice for 5 min. After the reaction, the constructed recombinant plasmid was transferred into 50 μL of Escherichia coli DH5α using the heat shock method (42°C, 15 s; 10 min on ice). 1 mL of LB liquid culture medium without antibiotics was added and activated at 37°C shaker (180 r / min) for 1 h. After activation, centrifuge with a centrifuge (9000 r / min, 1 min) and discard the supernatant, mix with 100 μL of LB liquid culture medium without antibiotics and spread on a LB solid culture medium plate containing 100 μg / mL spectinomycin and invert and culture overnight at 37°C incubator. The next day, a single clone was picked and activated in 500 μL LB liquid medium containing 100 μg / mL spectinomycin for 6 h (37°C shaker, 180 r / min). After activation, the bacterial solution was identified by PCR (such as SEQ ID NO. 7) using specific primers containing the vector and the SlCHLH gene (forward primer Fw: 5'-TATGACCATGATTACGCCAAGC-3', such as SEQ ID NO. 6; and reverse primer Rv: 5'-CACAGTTGATGACGCAGTTATTA-3', such as SEQ ID NO. 7). Figure 2B). Bacterial liquid PCR was amplified using Taq enzyme (Novozyme, Nanjing), and the reaction system was: 2×Taq Plus Master Mix II 10μL, bacterial liquid 1μL, 10μM concentration of the above-mentioned amplification primers Fw and Rv 0.5μL each, ddH2O 8μL. The PCR reaction program was: 95℃3min; 95℃15s, 55℃20s, 72℃1min, 35cycles; 72℃7min. After the PCR reaction, 5 μL of the reaction solution was subjected to agarose gel electrophoresis and detected by a blue light gel illuminator. The E. coli monoclonal bacterial solution with accurate band position (PCR product length is about 700 bp) was activated overnight with 5 mL of LB liquid culture medium containing 100 μg / mL spectinomycin (37°C shaker, 180 r / min). Then, the plasmid was extracted with a plasmid extraction kit (Omega, USA) and sequenced (Qingke, Shanghai) for identification. The recombinant plasmid pHellsgate8-SlCHLH that was correctly identified by sequencing was stored in a -20°C refrigerator, and the corresponding E. coli bacterial solution was added with an appropriate amount of glycerol and stored in a -80°C refrigerator for standby use.

[0091] Example 3 Agrobacterium transformation

[0092] The recombinant plasmid pHellsgate8-SlCHLH was transferred into the competent cell of Agrobacterium tumefaciens GV3101 by heat shock method, and the steps were as follows: 1000 ng of the recombinant plasmid pHellsgate8-SlCHLH was added to the competent cell of GV3101 and incubated on ice for 10 min; heat shock at 37°C for 5 min and incubated on ice for 10 min; 800 μL of LB liquid medium without antibiotics was added and activated on a shaker at 28°C for 12 h (200 r / min); after activation, the mixture was centrifuged (9000 r / min) min, 1min) and discard the supernatant, mix with 100 μL of LB liquid culture medium without antibiotics and apply to LB solid culture medium containing 100 μg / mL spectinomycin, 50 μg / mL gentamicin, 50 μg / mL rifampicin; after inverted culture in a 28°C incubator for 3 days, pick a single clone and activate it on 500 μL of LB liquid culture medium containing 100 μg / mL spectinomycin, 50 μg / mL gentamicin, 50 μg / mL rifampicin for 6 hours (28°C shaker, 200r / min). After activation, take the Agrobacterium bacterial solution for bacterial solution PCR verification, the PCR amplification enzyme is Taq enzyme, and the identification primer is the forward primer Fw: 5'-TATGACCATGATTACGCCAAGC-3' such as SEQ ID NO.6; and the reverse primer Rv: 5'-CACAGTTGATGACGCAGTTATTA-3', such as SEQ ID NO.7. The qualified positive Agrobacterium monoclonal bacterial liquid was added with an appropriate amount of glycerol and stored in a -80°C refrigerator. At the same time, it was streaked and activated on LB solid culture medium plates containing 100 μg / mL spectinomycin, 50 μg / mL gentamicin, and 50 μg / mL rifampicin in preparation for the subsequent construction of tomato transgenic materials.

[0093] Example 4: Genetic transformation of tomato

[0094] The stable genetic transformation system of tomato selected the Agrobacterium-mediated genetic transformation method. The explant was the cotyledon of the mutant mut26, and the Agrobacterium strain was GV3101 in Example 3 that correctly expressed the recombinant plasmid pHellsgate8-SlCHLH.

[0095] The specific steps are as follows:

[0096] 1) Vaccination

[0097] The seeds of mutant mut26 were soaked in 50°C warm water for 20 minutes and then moved to a sterile operating table. After the water was poured out, the seeds were washed with 75% alcohol for 1 minute; the alcohol was poured out, and the seeds were washed with a sodium hypochlorite solution with an effective chlorine content of 2% for 15 minutes, with continuous mixing during the process; the sodium hypochlorite solution was poured out, and the seeds were washed with sterile water for 5 times, and then sown in a 1 / 2MS solid culture box (MS powder 2.2 g / L + sucrose 15 g / L + agar powder 8 g / L, pH = 5.8), and placed in a culture room with a constant temperature (25°C) and a photoperiod of 12 h light / 12 h dark.

[0098] 2) Explant and bacterial culture preparation

[0099] When the seedlings in the culture box grow to the cotyledons flattened (6d), each cotyledon is cut into 2 explants, placed in a co-culture medium (organic matter-free MS powder 4.4g / L + 6-BA 6mg / L + acetosyringone 660μmol / L + agar powder 8g / L, pH = 5.8) and cultured overnight in the dark. The Agrobacterium bacterial solution prepared in Example 3) is added to 30mL of LB liquid culture medium containing 100μg / mL spectinomycin, 50μg / mL gentamicin, and 50μg / mL rifampicin, and shaken overnight on a shaker (28°C, 200r / min) until the bacterial solution concentration is OD 600 =0.5.

[0100] 3) Infection

[0101] After centrifugation of the bacterial solution (4000r / min, 4min), the supernatant was discarded and mixed with 30mL of suspension (MS powder 4.4g / L + sucrose 30g / L, pH=5.8), and then infected with explants cultured overnight for 4min. The explants were blotted dry with filter paper and placed back on the co-culture medium in the dark for 2d.

[0102] 4) Screening

[0103] The infected explants were transferred to the screening medium (MS powder 4.4g / L + auxin 100μg / mL + zeatin riboside 2.0mg / L + kanamycin 100mg / L + cephalosporin 360mg / L, pH = 5.8), and cultured for about 15 days under constant temperature, 12h light / 12h dark conditions. Afterwards, the explants with adventitious buds were transferred to the subculture medium (MS powder 4.4g / L + zeatin riboside 0.2g / L + kanamycin 100mg / L + cephalosporin 360mg / L, pH = 5.8), and subcultured every two weeks.

[0104] 5) Rooting culture

[0105] When the adventitious buds grew to 2 cm, they were cut off from the root base and transferred to rooting medium (MS powder 4.4 g / L + indolebutyric acid 2 mg / L + kanamycin 50 mg / L + cephalosporin 360 mg / L, pH = 5.8) to induce rooting.

[0106] 6) When the adventitious roots of the seedlings grow well, take out the seedlings and move them into nutrient soil containing vermiculite and perlite, and cover them with plastic film to keep them moist.

[0107] 7) PCR positive detection of transgenic positive seedlings (such as Figure 2 C).

[0108] DNA was extracted from seedling leaves, and the quality and concentration of DNA were detected by NanoDrop micro-spectrophotometer and agarose gel electrophoresis. The chlorotic mutant mut26 was used as a negative control, and the Taq enzyme, primers and PCR amplification system were the same as step (3) in Example 2, and the amount of DNA template added was 200 ng. The qualified transgenic restoration lines (#6 and #25) were grown in an artificial climate box for 3 weeks and then moved to a greenhouse for field management.

[0109] Example 4: Investigation of tomato reverse signaling phenotype

[0110] Norflurazon (NF) is a carotenoid biosynthesis inhibitor that can cause photooxidative damage to chloroplasts under light and cause developmental arrest. It is often used to detect chloroplast reverse signals. Sterilized seeds (cultivated tomato AC, chlorotic mutant mut26 and transgenic restorer line #6) were placed on 1 / 2MS medium and cultured in the dark for 3 days until the seeds turned white. Seeds with the same germination degree were selected and spread on the bottom of MS medium with NF added (MS powder 4.4g / L + 2% sucrose + 0.8% agar powder, pH = 5.8, containing NF reagent with a final concentration of 5μM), 9 seeds were inoculated per dish, and 2 dishes were inoculated for each material. MS medium without NF was used as a control. The inoculated MS medium was placed vertically in an artificial climate box (continuous white light treatment, light intensity of 100μmol·m -2 ·s -1 ), RNA was extracted after 5 days of treatment, and the expression levels of reverse signal marker genes (photosynthesis-associated nuclear genes, PhANGs) were detected by quantitative real-time PCR (qRT-PCR).

[0111] After grinding the seedlings to be tested into powder in liquid nitrogen, 0.1 g was weighed and placed in a 1.5 mL centrifuge tube. RNA was extracted using a plant RNA extraction kit (Omega, USA), and the RNA quality was tested by NanoDrop micro-spectrophotometer and agarose gel electrophoresis. The qualified RNA was synthesized into cDNA with consistent concentration using an RNA reverse transcription kit (Quanshijin, Beijing). qRT-PCR was performed using Yisheng fluorescent quantitative PCR enzyme and BIO-RAD real-time fluorescent quantitative PCR instrument, with the tomato internal reference gene SlACTIN (SGN accession number: Solyc03g078400) as the internal reference, and 2 -ΔΔCt Calculation method Data processing was performed to calculate the fold change of the expression level of tomato PhANGs (SlCAB1B, SlCAB1C, SlRBCS1 and SlRBCS2A) genes. qRT-PCR detection primers were designed using the online software Primer 5, and the sequence information is shown in Table 1. The reaction system is: real-time fluorescence quantitative PCR enzyme qPCRSYBR Green Master Mix was 10 μL, forward and reverse primers at a concentration of 10 μM were added in 0.4 μL, template DNA was added in 2 μL, and ddH2O was added to 20 μL. The reaction program was 95°C for 5 min; 95°C for 10 s, 60°C for 20 s, 72°C for 20 s, and 40 cycles; the default settings of the instrument were used in the melting curve stage.

[0112] like Figure 3 As shown in the figure, NF treatment significantly inhibited the expression of PhANGs in cultivated tomato AC, and this phenomenon was regulated by the reverse signal produced by chloroplasts. However, the change in PhANGs of the chlorotic mutant mut26 after NF treatment was significantly weaker than that of cultivated tomato AC, and the change in PhANGs in the restorer line #6 was slightly stronger than that of cultivated tomato AC. The above results confirmed that the chlorotic mutant mut26 blocked the transcriptional downregulation of PhANGs caused by the reverse signal, thus proving that mut26 is a tomato reverse signal mutant.

[0113] Example 5: Investigation of tomato fruit ripening phenotype

[0114] To further explore the function of SlCHLH in fruit ripening, we selected cultivated tomato AC fruits at different stages (swelling stage, green ripening stage, color breaking stage, yellow ripening stage and red ripening stage) to detect the transcription level of SlCHLH and the changes in the protein level of SlChlH. The plant protein extraction method was based on the method reported by Liu Xiaorui (Liu Xiaorui, 2020), and the relevant primer sequences for real-time fluorescence quantitative PCR are shown in the table below. The results are shown in Figure 4 As shown ( Figure 4The relative expression level (A) and protein level (B) of SlCHLH in AC fruits at different maturity stages (swelling stage, green ripening stage, color breaking stage, yellow ripening stage and red ripening stage) are shown in Figure (A). The transcription level of SlCHLH in AC fruits at the swelling stage was set as 1, SlACTIN was used as the internal reference gene, and the average value of three biological replicates was taken. The error bar represents the standard error (SE). The primers for SlCHLH detection were designed using the online software Primer 5, and the sequence information is shown in Table 1. In Figure (B), Actin protein was used as the internal reference protein, and the asterisk indicates the nonspecific band. During the ripening process of cultivated tomato AC fruits, the transcription level of SlCHLH and the corresponding protein level were significantly upregulated in the color breaking stage, peaked in the yellow ripening stage, and decreased in the red ripening stage. The above results suggest the positive regulatory function of the SlCHLH gene in the fruit ripening process.

[0115] Tomato materials (cultivated tomato AC, chlorotic mutant mut26 and restorer line #6) planted in the field were marked during the flowering period and the time was recorded, with marking every 3 days. After the AC fruits marked for the first time reached the red ripe stage (RR), the fruits were harvested uniformly and the status of the fruits at different days post anthesis (dpa) were compared. Figure 5 As shown in the figure, the sampling time points are: 44dpa, 41dpa, 38dpa, 35dpa and 32dpa, among which the cultivated tomato AC reaches mature green stage (MG) at 35dpa, breaks color (Br) at 38dpa, and red ripen (RR) at 44dpa. The fruits of the chlorotic mutant mut26 are delayed in maturing by about 3 days compared with AC, while the restorer line #6 restores the late-maturing phenotype of mut26. The mut26 fruits at 32dpa and 35dpa show a light green phenotype compared with AC fruits, and the color of the restorer line #6 fruits at the same time is consistent with AC. The above results indicate that the SlCHLH gene positively regulates the chlorophyll content and ripening process of tomato fruits.

[0116] Example 6: Determination of fruit ethylene release

[0117] After picking the test fruits (cultivated tomato AC and chlorotic mutant mut26) at 32-44dpa for a total of 5 periods, 3 biological replicates were set for each material in each period. For each biological replicate, 3 fruits with the same degree of maturity were selected and treated overnight at room temperature to remove the ethylene release caused by picking stress. After standing, the fruits were weighed and placed in a 1L gas collector and sealed for 3h. The gas in the collector was extracted with a 20mL syringe and transferred to a 50mL aluminum foil gas collection bag. A 1ppm ethylene gas standard (Weichuang, Shanghai) and a gas chromatograph (Shimadzu, Japan) were used for detection. The specific steps are as follows: Use a 1mL syringe to extract 0.5mL of gas from an aluminum foil gas collection bag and inject it into the gas chromatograph. Each sample was tested twice, and the peak time and peak area were recorded. The ethylene release of the sample to be tested was calculated by comparing it with the peak area of ​​the standard ethylene. Figure 6 As shown in the figure, from 32 dpa to 44 dpa, the ethylene release rates of cultivated tomato AC and mutant mut26 showed a trend of first increasing and then decreasing, and the ethylene release rate of cultivated tomato AC was significantly higher than that of mutant mut26, indicating that the SlCHLH gene can affect ripening by changing the amount of ethylene release.

[0118] Example 7: Determination of chlorophyll and carotenoid content in fruits

[0119] After picking the tested fruits (cultivated tomato AC and chlorotic mutant mut26) at 32-44dpa for a total of 5 periods, 3 biological replicates were set for each material, with 3 fruits in each replicate. After the middle of the outer peel was ring-cut, it was ground into powder in liquid nitrogen and stored in a -80℃ refrigerator (for detecting pigment content and related gene expression levels).

[0120] Determination of chlorophyll: Weigh 0.1g of the tissue to be tested (ground powder of the outer peel of cultivated tomato AC and the chlorotic mutant mut26 in 5 periods from 32 to 44dpa) and place it in a 2mL centrifuge tube, and add 1.5mL of acetone (80%, v / v). After inversion and mixing, place it in the dark for 3h until the tissue powder turns white, and mix it every 30min. After the extraction, centrifuge at 8000r / min for 1min, draw 1mL of supernatant into a cuvette, and select 1mL of 80% acetone extract as a blank control. The spectrophotometer detects the absorbance at 663nm and 646nm, and the total chlorophyll amount is calculated by the following formula: C T :17.32×OD 646 +7.18×OD 663 .like Figure 7As shown in A, compared with cultivated tomato AC, the chlorophyll degradation rate of the chlorotic mutant mut26 was significantly weakened from 32 dpa to 44 dpa, which is consistent with its late-maturing phenotype, and the chlorophyll content of the fruit was significantly lower than that of AC in the early stage of maturity (32 dpa and 35 dpa).

[0121] Determination of carotenoids: (1) Weigh 500 mg of the tissue to be tested (ground powder of the outer peel of cultivated tomato AC at 44 dpa and the chlorotic mutant mut26) into a 15 mL clean centrifuge tube; (2) Add 1.5 mL of methanol and 200 μL of potassium hydroxide (60%, w / v), and mix by inversion for 3 min; (3) Incubate the centrifuge tube in a 60°C water bath for 30 min, mix three times during the incubation, and then cool to room temperature; (4) Add 1.5 mL of Tris-NaCl buffer, mix by inversion, and then cool at 4°C for 10 min. min, mix twice during this period; (5) add 4 mL of pre-cooled chloroform, mix by inversion on ice for 10 min, then centrifuge at 4000 r / min in a 4°C pre-cooled centrifuge for 10 min; (6) use a 5 mL syringe to draw the lower clear liquid and place it in a new 15 mL centrifuge tube to avoid drawing other impurities, and operate on ice during this period; (7) add 4 mL of chloroform to the remaining phase and extract it again, as in step 5, and place the drawn lower clear liquid in the centrifuge tube of step 6; (8) use chloroform to make the collected liquid dilute to 10 mL, which can be directly used for ultra-high performance liquid chromatography (UPLC) detection. (9) carotenoid standards lycopene, β-carotene (Sigma-Aldrich, USA) and lutein (Yuanye Biotechnology, Shanghai) are diluted according to a certain ratio and the dissolution curve is drawn. (10) Record the peak time and peak area of ​​the sample to be tested, and calculate the carotene content of each group of samples by drawing the dissolution curve of the carotenoid standard sample. The results are as follows Figure 7 As shown in B, the lycopene and β-carotene content in the fruit of the chlorotic mutant mut26 at 44 dpa was significantly lower than that of cultivated tomato AC, while there was no significant difference in lutein. The content of total carotenoids in the fruit of the mut26 mutant at 44 dpa was lower than that of AC.

[0122] Example 8: Detection of soluble solids in fruits

[0123] Take fresh samples of the tested fruits (44dpa cultivated tomato AC and chlorotic mutant mut26 fruits), squeeze the juice with a juicer and filter it with gauze. Drop the filtrate on the spotting table of a digital sugar meter (ATAGO, Japan), record the soluble solid content of the tested sample (expressed as a percentage), and after changing the sample, rinse the spotting table with ddH2O and wipe it clean with lens paper. The results are shown in Figure 8As shown, the soluble solids content in the fruits of the chlorotic mutant mut26 at 44 dpa was significantly lower than that of cultivated tomato AC.

[0124] Example 9: Detection of expression levels of genes related to fruit ripening

[0125] The exocarp RNA of the tested fruits (cultivated tomato AC and chlorotic mutant mut26 at 35 and 38 dpa) was extracted and the relative expression levels of tomato ripening positively related genes SlACS2, SlACS4, SlACO1, SlNR, SlE4, SlE8, SlPL, SlRIN, SlPSY1 and SlHY5 in different samples were detected by qRT-PCR. The qRT-PCR primers were designed using the online software Primer5, and the sequence information is shown in Table 1. The results are shown in Table 1. Fig. 9 As shown in the figure, the above genes were significantly induced from 35dpa to 38dpa in cultivated tomato AC fruit, while the induction level was reduced in the chlorotic mutant mut26, which was consistent with its late-maturing phenotype. The above results show that compared with the AC control, the induction of genes related to fruit ripening in the reverse signal mutant mut26 was significantly weakened, indicating that the reverse signal regulatory gene SlCHLH is involved in regulating the expression of ripening-related genes and thus affects the ripening process of tomato fruit.

[0126] The invention discloses an application of a tomato SlCHLH gene in regulating chlorophyll synthesis and / or fruit ripening, and the CDS coding sequence of the SlCHLH gene is as shown in SEQ ID NO.1. The invention obtains a mutant mut26 by using cultivated tomato Ailsa Craig (AC) as background material and directional screening of chlorophyll-deficient mutants by chemical mutagenesis with ethyl methanesulfonate (EMS), which exhibits plant chlorosis (yellowing of the base of true leaves in the seedling stage, light green leaves in the later development stage, yellow stigma in the flowering stage and light green fruits in the green ripening stage) and a late-ripening fruit phenotype. Genetic positioning analysis and functional complementation experiments show that the mut26 mutation site is located on the chlorophyll synthesis-related gene SlCHLH, and it is found that the slchlh gene in mut26 has a nucleotide coding sequence as shown in SEQ ID NO.2. The invention studies the function of the SlCHLH gene in tomatoes, which affects the chlorophyll content of tomato plants, regulates the reverse signal produced by chloroplasts, regulates the expression of ripening-related genes in fruits and the release of ethylene, and finally affects fruit ripening. The present invention utilizes functional genomics-related technologies to modify the genomic DNA sequence of the SlCHLH gene in AC ( SlCHLH Pro:: SlCHLHgDNA, as shown in SEQ ID NO.0, 3) was constructed into the plant expression vector pHellsgate8 by homologous recombination to form a recombinant plasmid pHellsgate8-SlCHLH, which was then expressed in Agrobacterium GV3101 and transferred into the mutant mut26 by Agrobacterium-mediated tomato cotyledon genetic transformation, restoring its plant chlorosis and fruit late-maturing phenotype. Therefore, artificial intervention in the function of SlCHLH can extend the shelf life of tomatoes and save agricultural production costs, which is of great significance in production practice.

[0127] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. Application of the SlCHLH gene in regulating chlorophyll synthesis and / or respiratory climacteric fruit ripening, characterized in that: The nucleotide coding sequence of the SlCHLH gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The climacteric fruit includes tomato, apple, banana, avocado or mango.

3. The use according to claim 1, characterized in that: The SlCHLH gene regulates SlACS2 (SGN accession number: Solyc01g095080), SlACS4 (SGN accession number: Solyc05g050010), SlACO1 (SGN accession number: Solyc07g049530), SlNR (SGN accession number: Solyc09g075440), SlE4 (SGN accession number: Solyc03g111720), SlE 8 (SGN accession number: Solyc09g089580), SlPL (SGN accession number: Solyc03g111690), SlRIN (SGN accession number: Solyc05g012020), SlPSY1 (SGN accession number: Solyc03g031860) and SlHY5 (SGN accession number: Solyc08g061130) to regulate respiratory climacteric fruit ripening.

4. A recombinant plasmid, characterized in that: The recombinant plasmid uses the plant expression vector pHellsgate8 as a backbone to express SlCHLH Pro:: SlCHLH The nucleotide sequence of gDNA, SlCHLH Pro:: SlCHLH The nucleotide sequence of gDNA is shown in SEQ ID NO.

3.

5. Use of the recombinant plasmid as claimed in claim 4 in regulating chlorophyll synthesis and / or tomato fruit ripening.

6. A method for constructing a recombinant plasmid, characterized in that: The steps include: 1) Using the plant expression vector pHellsgate8 as the backbone, the vector pHellsgate8 was cut with restriction endonucleases SacI and XbaI to obtain the linearized vector Linear pHellsgate8; 2) Using the genomic DNA of cultivated tomato AC as a template, amplification was performed using the amplification primers SlCHLH-Fw, as shown in SEQ ID NO.4, and SlCHLH-Rv, as shown in SEQ ID NO.5, containing homology arms to obtain the target fragment. SlCHLH Pro:: SlCHLH gDNA; SlCHLH Pro:: SlCHLH The nucleotide sequence of gDNA is shown in SEQ ID NO.3;. 3) The target fragment SlCHLH Pro:: SlCHLH gDNA was connected to the linearized vector Linear pHellsgate8 to obtain the recombinant plasmid pHellsgate8-SlCHLH.

7. Application of a mutant gene of the SlCHLH gene in breeding of late-maturing tomato varieties, characterized in that: The mutant gene of the SlCHLH gene is slchlh, and its nucleotide coding sequence is shown in SEQ ID NO.

2.

8. A method for obtaining a chlorotic mutant, characterized in that: The following steps are involved: The cultivated tomato AC was mutated by EMS mutagen to obtain a chlorotic mutant mut26, which includes a mutant gene slchlh. The nucleotide coding sequence of the slchlh is shown in SEQ ID NO.

2.

9. The method for obtaining the chlorotic mutant according to claim 8, characterized in that: The steps of mutagenizing cultivated tomato AC with EMS mutagen are as follows: 1) Use EMS mutagen stock solution as solute and phosphate buffer as solution to prepare EMS working solution, sterilize and set aside; 2) Shake the cultivated tomato AC seeds in water for 8-20 hours; 3) After the shaking is completed, the seeds are dried and placed in the EMS working solution prepared in step 1, shaken in the dark for 12-20 hours, and then rinsed with clean water to terminate the mutagenesis and obtain the M1 mutagenized tomato strain; 4) Self-pollinating the M1 mutagenized tomato strain to obtain the M2 mutagenized tomato strain; 5) Planting M2 mutagenized tomato lines for phenotypic statistics; self-pollinating the M2 mutagenized tomato lines with the chlorotic phenotype to obtain the M3 mutagenized tomato lines; planting the M3 mutagenized tomato lines for M3 phenotype verification; retaining the M3 mutagenized tomato lines that can repeat the M2 chlorotic phenotype to construct a mutant library.

Images