A haplotype breeding marker related to pig feed utilization and meat production traits and application
By screening 19 SNP loci in the 8th chromosome region of pigs as genetic markers and performing haplotype analysis, the problems of feed utilization and meat production trait identification in pig breeding were solved, thus improving breeding efficiency and production benefits.
Patent Information
- Application Number
- CN202411773004.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-12-04
AI Technical Summary
Existing technologies struggle to efficiently identify genetic markers associated with pig feed utilization and meat production traits, leading to low breeding efficiency and unstable production benefits.
By cloning the gene sequence of the 104827658-104830494 segment of pig chromosome 8, 19 SNP sites were identified and named. Primers were designed for PCR amplification and sequencing. Genetic markers related to pig feed utilization and meat production traits were screened out, and haplotype analysis was performed to improve breeding accuracy.
It has significantly improved the efficiency of pig breeding, selected breeding pigs with excellent growth performance and meat quality characteristics, provided efficient and precise genetic improvement tools, optimized the genetic structure of pigs, and enhanced the competitiveness of the pork industry.
Smart Images

Figure CN119491056B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of bioengineering, and particularly relates to a haplotype breeding marker related to pig feed utilization rate and meat production traits and application. BACKGROUND
[0002] With the rapid development of global economy and the continuous growth of population, the breeding industry plays a crucial role in meeting the demand of human beings for meat and its products. Among them, the pig breeding industry occupies an important position in the livestock industry and is the main pillar industry of global meat production. At present, the industry pattern is mainly large-scale breeding supplemented by small and medium-sized breeding, and China is the largest pork producer and importer. Moreover, China has a large population and has a higher demand for pork. However, the industry is also facing problems such as frequent diseases, environmental pollution, feed safety and unstable production efficiency. Therefore, it is necessary to improve the pig breed and improve the breeding efficiency and improve the meat production traits [1-2] Most meat quality traits are quantitative traits, which are controlled by micro-effect polygenes and have main gene effects [3] Some scholars [4] With the help of animal genetics and molecular biology, the relationship between phenotype and genetics of meat quality traits has been explored, further confirming that genes can have an impact on specific meat quality traits. Thousands of quantitative trait loci (QTL) have been identified in pigs, and these loci have a wide range of economically important phenotypes. QTL analysis now commonly uses high-density single nucleotide polymorphisms (SNPs), and by taking advantage of long-range linkage disequilibrium (LD), higher-resolution QTL mapping is achieved, and its application has expanded from experimental crosses to inbred populations. Related phenotypes usually belong to the categories of growth, carcass, meat quality, reproduction and disease resistance. Some expression QTL (eQTL) studies have been conducted to identify genes that control important trait phenotypes by treating expression levels as response variables in QTL analysis [5] Marker-assisted selection (MAS) is a method that combines molecular genetics and traditional breeding techniques to accelerate genetic improvement of crops and livestock. This technique identifies molecular markers that are closely linked to the target traits, allowing accurate prediction of adult traits even at an early age. Therefore, breeders can eliminate individuals that do not carry the desired traits at an early selection stage, thereby improving breeding efficiency and selection accuracy [6]The meat production traits of pigs include specific index traits such as body length, back fat thickness, eye muscle area and daily gain, and numerous genetic genes will affect these traits. In order to realize molecular breeding, the premise is to reveal the molecular mechanism of meat production traits and identify related genes [7] In pig production, feed efficiency (FE) is an important trait, but FE measurement is cumbersome and expensive, and it is difficult to collect a large amount of data for accurate selection. Therefore, identifying single nucleotide polymorphisms (SNPs) related to FE, such as average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR), and using them for genetic evaluation are of great significance to improve prediction accuracy and promote genetic progress in pig breeding programs [8] .
[0003] At present, the physiological functions and regulatory mechanisms of many long non-coding RNAs (lncRNAs) in muscle are still to be explored. Some scholars [9] The expression profile of lncRNAs in the differentiation of C2C12 myoblasts was systematically characterized, and a highly expressed intronic lncRNA-SYISL was identified. Functionally, SYISL promotes myoblast proliferation and fusion, and inhibits myogenic differentiation, and gene knockout can greatly increase mouse muscle fiber density and muscle mass. Mechanistically, SYISL can recruit PRC2 proteins to cause trimethylation of histone H3 lysine 27 (H3K27me3) in the target gene promoter region, thereby inhibiting target gene expression. In summary, SYISL is a muscle development inhibitor and plays an important role in PRC2-mediated myogenesis. Therefore, functional variations of the SYISL gene are an important content of the study of the genetic basis of pig meat production traits. SUMMARY
[0004] The object of the present application is to screen genetic markers associated with pig feed utilization and meat production traits. By cloning the gene sequence of the 104827658-104830494 segment of pig chromosome 8 and using direct sequencing method to find SNP sites and genotyping method, the correlation with pig feed utilization and meat production traits is analyzed, thereby establishing new marker-assisted selection sites for pig feed utilization and meat production traits and improving pig muscle yield.
[0005] The present application is realized by the following technical solutions:
[0006] The application obtains the gene sequence of the 104827658-104830494 segment of the chromosome 8 of the pig, which is shown in the sequence table SEQ ID NO. 1, the fragment lengths are 714 bp, 985 bp and 787 bp respectively, and the sequences are shown in the sequence table SEQ ID NO. 2, the sequence table SEQ ID NO. 3 and the sequence table SEQ ID NO. 4 respectively. It is found that there are 19 nucleotide polymorphism (SNP) sites in the amplified fragment of the region by BLAST comparison on the NCBI website, which are specifically shown in the sequence table SEQ ID NO. 5. Figure 2 The mutations of the SNPs sites are specifically that the base at the 104828115th base of the chromosome 8 changes from G to C, the base at the 104828116th base changes from C to A, the base at the 104828148th base changes from C to G, the base at the 104828156th base changes from G to T, the base at the 104828200th base changes from G to T, the base at the 104828225th base changes from C to T, the base at the 104828229th base changes from G to A, the base at the 104828873th base changes from T to C, the base at the 104829029th base changes from G to A, the base at the 104829046th base changes from C to T, the base at the 104829307th base changes from T to A, the base at the 104829327th base changes from A to G, the base at the 104829460th base changes from A to G, the base at the 104829466th base changes from A to G, the base at the 104829500th base changes from A to G, the base at the 104829504th base changes from T to C, the base at the 104829535th base changes from T to G, the base at the 104829890th base changes from C to A, and the base at the 104829970th base changes from C to T.
[0007] According to the naming rules of the Ensembl database, the 19 mutation sites are named as rs698837059, rs702511014, rs711300964, rs707052512, rs696375896, rs708902283, rs691749030, rs343701254, rs320380315, rs326529139, rs340588370, rs322564742, rs342333906, rs324114921, rs334145347, rs341513531, rs328108976, rs326445452 and rs346394676.
[0008] The test material is selected as Large White. The whole genome DNA is extracted from the blood of Large White, and 3 pairs of primers are designed according to the pig gene sequence (NC_010450.4) published in the NCBI database. The sequences of the primer pairs are as follows:
[0009] Forward primer 1 (SEQ ID NO. 5): 5'-TAGGGTCAGTTTCAAGAGAAAGCATTC-3',
[0010] Reverse primer 1 (SEQ ID NO. 6): 5'-ACACAGGAGTTATGCACTTGTATCTCA-3'.
[0011] Forward primer 2 (SEQ ID NO. 7): 5'-CACTCATTCTGACTTGGCTGTTCC-3', Reverse primer 2 (SEQ ID NO. 8): 5'-CCTAAATGATGTGACCTTGAGATTTCC-3'.
[0012] Forward primer 3 (SEQ ID NO. 9): 5'-AAGCAGATGCCAATTCAAGAAGTTCAG-3', Reverse primer 3 (SEQ ID NO. 10): 5'-AACAGCCAAGTCAGAATGAGTGGTT-3'.
[0013] The above primer pairs can detect and genotype the SNPs site in the gene region of the 104827658-104830494 segment of pig chromosome 8.
[0014] After PCR amplification, purification of PCR products, cloning sequencing and sequence alignment analysis by the above primer pairs, 19 genetic markers associated with pig feed utilization and meat production traits are screened. The nucleotide sequences of the genetic markers are as follows, wherein the mutation sites are at positions 508, 509, 541, 549, 593, 618, 621 of SEQ ID NO. 2; positions 102, 258, 275, 536, 556, 689, 695, 729, 733, 764 of SEQ ID NO. 3; positions 183, 263 of SEQ ID NO. 4. The specific sequences are as follows:
[0015] SEQ ID NO. 1
[0016] TGTGTCCTCAATACGTGAACATAGAGTCGTTCCTCACTAAGGAGGACCCCGGTACA
[0017] CGGTCCGGTCCGACGGCCCGGACGGATGTCCGGGGAGACGTAGTGACTCTTGACT
[0018] TGTCATTTGGTCTCCACCGGTAAGAAGGTGTGAAGTATAATACATACATACTAGGG
[0019] AAAATAATACATACTAATTTTTATTAAATAGAAAAAGATTCTTGGTATGTTCAATCCT
[0020] CGCAAATTGATATAATATTGTAATATATTTGACATAATCTTTTATTTATGTCCAAAACG
[0021] TAACGAAAATATTTAATTTGGGGGGAGGTTTTTGATTTATTCTTAAGATTCTGAATTT
[0022] ACAGTTACTACCCCTCAAGGGCAGCACCACGTCACCAATTGCTTAAGCTGATCCTT
[0023] GGTACTCCAACGCCCAACCTAGGGACGGGAACGAGTCACCCAATTGCTAGGCCGC
[0024] AACGGCACTCGACCCCACATCCAACGTCTGCGCCGAGGCTAGGGCTTAACGACAC
[0025] CGAGACCGCATCCGGCCACCGATGTCGAGGCTAATCTGGGGATCGGACCCTTGGA
[0026] GGTATACGACGCCCTCGCCGGGTTCTTTATCGTTTTTTTTTTTTTTTTTTTTTCTGATT
[0027] TATTTATTAATTTATTTTCAAAGTAAATTTTTTTTAAAAAAAAAGTTACTACATAAAG
[0028] GATTTTCCTTACGAAAGAGAACTTTGACTGGGATATTGAAATCCTTTTATTATGATG
[0029] TTATTATAAATATTGTTATGAAAACATATACAAGAAATAGTACGTATGTTGGATGAAA
[0030] GTGTATATAAAGTTTTCTCTCTATCGTTCAAATTAATGAAGTTCTATCCAAAATTTTT
[0031] TAGACTGAATAGGTTGAGATGATAGAACTATTAAGGTACCTTTCGACGTTCCGGATA
[0032] CTAAGGGATACGTAATATGGGATACTAAATAAAATTCTGTAACTGGTAGAAATCCGT
[0033] TTTAAAAACAGGACTTTGTTAGAACTTTAAATTATTTTAATTTATATACTCTTCTAAA
[0034] AAGGAGAGTTTTTAATAAGAAAGTCCTGTAAAATTTTTCAATGTTTAGTGATAGTTA
[0035] TGTAAATTTACAAATCCTTACTTTCATATAATGGATTTACTACACTGGAACTCTAAAG
[0036] GAATAAAATAGTCGGGTTTTCTTAATATGAATGATCATATTACTCATTGTACATGTATT
[0037] CTTTTAAATAGAAATACATATTATCAACAGGAGTTTAATTGAGTCTATTGGAAGTAA
[0038] AAGTGGTTTTTTTATATCGTATGAGAGTCATTAAGATGAAAATCCGTAATTAAGGTA
[0039] TCCTTACTAGTGTATTCACGTGTTTGTATAAAATATATATGTTTTCATAAGTAGAGTCA
[0040] TGATAAACATTACCACTTCTTAATATTAATTGAATGTACAAGTTATTCCTCATCCAAT
[0041] ATATTTAATGTCAGTTAGGTATGAGGGATTATGATACGTCAGTGATTTTTCTAAGTTT
[0042] TTTCCTAAGTAACTGTGTCTTTCTACAAGTATAACATACAAATTATTCTTTCGTATAA
[0043] ATCATGGTAAGGAAAATGCACCTTAACTTACATTCGTATTGACATTCAACCACAAA
[0044] CACGTTCTCTCTCCCCTGACTCTTCAACAAGTGGTTCTACAATTATCACACAATAAA
[0045] GACCTACTATGCTAAAAATGAAATAAAAATAGGAAAAGACATTATAAACCCAAAAA
[0046] AAAAATGTTACTGTTACACAGTGAAAAAAATATTAGGTTTTTATTTTCTGTAAAAGT
[0047] CAATATCAATAAAATTAAAAAAATTCGGTTGAGATTGCCTTTTTATTTTTAGTAAATT
[0048] TTTATATCTGACGTTACGTAAACACCCCATCTTAGTACTAAACTAAGGTTTATGGTG
[0049] TGAAACTCTACACCTCGATTTGATTAGTTCAGGTTCAAATGGTTCCTGACAGAGAA
[0050] AAAAGAAAAACTATGTAAAATGGGTTTACTCTCCCCAAATTTCTTATCTACTTCTTA
[0051] TCGTTTGTGTAAAGGAGAAGAGGTAGTTTAATCCTATACAGTATCTACCCTTGTCGG
[0052] TTCAGTCTTACTCACCAAAATGAGATACTCTATTAGAGATAGGTGACAGAGAGACC
[0053] CACAAAGAACTTCCCGTTCCTTTTGTTTTGAATTTCCGACGCTTAGTATAGCCTACC
[0054] TCAAATTCATTTCTTCAATCTATGTAGTTAACATAAATTTAGGTACTTAGGAATTATTA
[0055] TAAAAATTTTGTACAGCTAATATAAACATATACGATCCCTTGATAATCTTTTTATTATC
[0056] CCTTTCTCTTTCTTATTTCGTCAATGGTTTTTTTTTTTTTTTTTTCTTAGTAATCTTTTA
[0057] CGACTTAAAGTCATCTAAGTGACGTCATCTTAAAAGTCGTAGTTTTTTTCATTTTAG
[0058] ACCGTTTTAACTAGGGTAAAACTCTCAACAAAAAAAAATTGAGTAAAGAAAGAAA
[0059] TATTGTATATTTAGGTCGTTCACTAAACCTCTTTAATCTTATTTTCAAAGTATTTTTAC
[0060] GCCAGATTACTTAGCGGGAAAGGTCTTTTATGACGAAATAAAAAGGTTGAATTGTC
[0061] TCTTTTATGCTGGTAAGTACCCACAAAAGAAAGTAGATAGTAGAAGAACTAAATTG
[0062] TATCTGAGATCGATTTTCCTTTGAGTTTTAATACATAAGATTTAGAAAGGAAAATGT
[0063] TTATCTCTTTAACTCTCGGTCTATGAAAATTATTATATCAATTCCCGTGTCTCATTTTA
[0064] GTTCAATCTGGGTACGGATCTTAAATCCAGAGGATTAAGGGTCAAGTTAGTCACCG
[0065] GAAAAGCGACTTGAAGAACTTAACCGTAGACGAA
[0066] SEQ ID NO. 2:
[0067] TGTTAGTGTTTATGAAAAACAACTACGGATTTCCGACAAATTCTTACTTATGTGTCC
[0068] TCAATACGTGAACATAGAGTCGTTCCTCACTAAGGAGGACCCCGGTACACGGTCC
[0069] GGTCCGACGGCCCGGACGGATGTCCGGGGAGACGTAGTGACTCTTGACTTGTCAT
[0070] TTGGTCTCCACCGGTAAGAAGGTGTGAAGTATAATACATACATACTAGGGAAAATA
[0071] ATACATACTAATTTTTATTAAATAGAAAAAGATTCTTGGTATGTTCAATCCTCGCAAA
[0072] TTGATATAATATTGTAATATATTTGACATAATCTTTTATTTATGTCCAAAACGTAACGA
[0073] AAATATTTAATTTGGGGGGAGGTTTTTGATTTATTCTTAAGATTCTGAATTTACAGTT
[0074] ACTACCCCTCAAGGGCAGCACCACGTCACCAATTGCTTAAGCTGATCCTTGGTACTCCAACGCCCAACCTAGGGACGGGAACGAGTCACCCAATTGCTAGGCCGCAACGR(G / C)R(C / A)ACTCGACCCCACATCCAACGTCTGCGCCGAGR(C / G)CTAGGGCR(G / T)TAACGACACCGAGACCGCATCCGGCCACCGATGTCGAGGCTAAR(G / T)CTGGGGAT CGGACCCTTGGAGGTAR(C / T)ACR(G / A)ACGCCCTCGCCGGGTTCTTTATCGTTTTT TTTTTTTTTTTTTTTTCTGATTTATTTATTAATTTATTTTCAAAGTAAATTTTTTTTAAA AAAAAAGTTACTACATAAAGGATTTTCCTTACGAAAGAGAACTTTGACTGGGAT SEQ ID NO. 3:
[0075] GGATTTACTACACTGGAACTCTAAAGGAATAAAATAGTCGGGTTTTCTTAATATGAATGATCATATTACTCATTGTACATGTATTCTTTTAAATAGAAATAR(T / C)ATATTATCAAC AGGAGTTTAATTGAGTCTATTGGAAGTAAAAGTGGTTTTTTTATATCGTATGAGAGTCATTAAGATGAAAATCCGTAATTAAGGTATCCTTACTAGTGTATTCACGTGTTTGTATAAAATATATATGTTTTCATAAGTAGAGTCR(G / A)TGATAAACATTACCACR(C / T)TCTTAATATTAATTGAATGTACAAGTTATTCCTCATCCAATATATTTAATGTCAGTTAGGTATGAGGGATTATGATACGTCAGTGATTTTTCTAAGTTTTTTCCTAAGTAACTGTGTCTTTCTACAAGTATAACATACAAATTATTCTTTCGTATAAATCATGGTAAGGAAAATGCACCTTAACTTACATTCGTATTGACATTCAACCACAAACACGTTCTCTCTCCCCTGACTCTTCAACAAGTGGTTCTACAATTATCR(T / A)CACAATAAAGACCTACTATR(A / G)CTAAAATGAAATAAAAATAGGAAAAGACATTATAAACCCAAAAAAAAAATGTTACTGTTACACAGTGAAAAAAATATTAGGTTTTTATTTTCTGTAAAAGTCAATATCAATAAAATTAAAAAAATTCGGTTR(A / G)AGATTR(A / G)CCTTTTTATTTTTAGTAAATTTTTATATCTGACR(A / G)TTAR(T / C)GTAAACACCCCATCTTAGTACTAAACTAAGR(T / G)TTTATGGTGTGAAACTCTACACCTCGATTTGATTAGTTCAGGTTCAAATGGTTCCTGACAGAGAAAAAAGAAAAACTATGTAAAATGGGTTTACTCTCCCCAAATTTCTTATCTACTTCTTATCGTTTGTGTAAAGGAGAAGAGGTAGTTTAATCCTATACAGTATCTACCCTTGTCGGTTCAGTCTTACTCAC
[0076] SEQ ID NO. 4:
[0077] TTGTCGGTTCAGTCTTACTCACCAAAATGAGATACTCTATTAGAGATAGGTGACAG
[0078] AGAGACCCACAAAGAACTTCCCGTTCCTTTTGTTTTGAATTTCCGACGCTTAGTAT
[0079] AGCCTACCTCAAATTCATTTCTTCAATCTATGTAGTTAACATAAATTTAGGTACTTAGGAATTATTATAAR(C / A)AATTTTGTACAGCTAATATAAACATATACGATCCCTTGATAA TCTTTTTATTATCCCTTTCTCTTTCTTATTTCGTCAAR(C / T)GGTTTTTTTTTTTTTTTT TTCTTAGTAATCTTTTACGACTTAAAGTCATCTAAGTGACGTCATCTTAAAAGTCGTAGTTTTTTTCATTTTAGACCGTTTTAACTAGGGTAAAACTCTCAACAAAAAAAAATTGAGTAAAGAAAGAAATATTGTATATTTAGGTCGTTCACTAAACCTCTTTAATCTTATTTTCAAAGTATTTTTACGCCAGATTACTTAGCGGGAAAGGTCTTTTATGACGAAATA AAAAGGTTGAATTGTCTCTTTTATGCTGGTAAGTACCCACAAAAGAAAGTAGATAGTAGAAGAACTAAATTGTATCTGAGATCGATTTTCCTTTGAGTTTTAATACATAAGATTTAGAAAGGAAAATGTTTATCTCTTTAACTCTCGGTCTATGAAAATTATTATATCAATTCCCGTGTCTCATTTTAGTTCAATCTGGGTACGGATCTTAAATCCAGAGGATTAAGGGTCAAGTTAGTCACCGGAAAAGCGACTTGAAGAACTTAACCGTAGACGAA
[0080] The present application provides a method for screening genetic markers associated with feed utilization and meat production traits in pigs, the method comprising the steps of:
[0081] Genomic DNA was extracted from blood of Large White pigs. Primers were designed according to the genomic sequence from +95 to +2931 bp upstream of the transcription start site of SYISL. The genomic DNA of pigs was amplified by PCR using the primers, and the nucleotide sequence from +95 to +2931 bp upstream of the transcription start site of SYISL was obtained by direct sequencing (see SEQ ID NO. 1 for details), which contains 19 SNP sites. The haplotype composed of the 19 mutation sites can be used as a genetic marker for association analysis of feed utilization and meat production traits in pigs.
[0082] The application provides a genotyping method for detecting SNP sites in the above sequences.
[0083] The application provides application of haplotype analysis of genotyping individuals by identifying 19 SNP polymorphic sites
[0084] The application further provides application of correlation analysis between different genotypes of individuals and feed utilization and meat yield by using direct sequencing method.
[0085] The more detailed technical solutions are described in the "specific embodiments".
[0086] Compared with the prior art, the application has the beneficial effects that 19 SNPs sites located in the promoter region of the SYISL gene in the application. Through correlation analysis, the 19 SNPs sites are all significantly correlated with the feed utilization and meat yield of pigs. Further analysis shows that the 19 SNPs are all in a complete linkage disequilibrium state, and haplotype analysis shows that two haplotypes can be formed, and there are significant differences in traits such as feed intake, lean meat rate and feed utilization. The above haplotype can change the expression level of the SYISL gene, and then affect the growth and differentiation process of muscle cells.
[0087] In view of the important role of the haplotype composed of the 19 SNPs in the growth and meat yield traits of pigs, the haplotype can be used as an effective molecular marker and applied to genetic improvement of pigs. By using the haplotype for molecular marker assisted selection, the breeding efficiency can be significantly improved, and breeding pigs with excellent growth performance and meat quality can be selected, thereby providing an efficient and precise genetic improvement tool for pork production. This finding provides a new target for molecular breeding of pigs, has a wide application prospect and important economic value. The haplotype site composed of the 19 SNPs is incorporated into the breeding strategy, so that the genetic structure of pigs can be further optimized, and the competitiveness of the pork industry can be improved. BRIEF DESCRIPTION OF DRAWINGS
[0088] Figure 1 : Cloning detection results of the 104827658-104830494 segment of pig chromosome 8. The concentration of agarose gel is 1.5%. The marker explanation is as follows: lanes 1-2, 3-4, 5-6 are respectively three pairs of PCR amplification products, and lane M is DL2000 Maker.
[0089] Figure 2 : Nucleotide sequences of the 104827658-104830494 segment of pig chromosome 8, which are respectively nucleotide sequences of SEQ ID NO. 2-SEQ ID NO. 4. There are 19 mutation sites in the shown sequences, which are specific sites causing the polymorphism of the segment.
[0090] Figure 3 The sequencing result of the genetic marker sequence of the present application. There are 19 double-peak maps, respectively, base "G" mutated to "C", base "C" mutated to "A", base "C" mutated to "G", base "G" mutated to "T", base "G" mutated to "T", base "C" mutated to "T", base "G" mutated to "A", base "T" mutated to "C", base "G" mutated to "A", base "C" mutated to "T", base "T" mutated to "A", base "A" mutated to "G", base "A" mutated to "G", base "A" mutated to "G", base "A" mutated to "G", base "T" mutated to "C", base "T" mutated to "G", base "C" mutated to "A", and base "C" mutated to "T".
[0091] Figure 4 The linkage disequilibrium analysis diagram of 19 SNP polymorphic sites of the present application, the left diagram represents D' value, and the right diagram represents r 2 value. DETAILED DESCRIPTION
[0092] Example 1: Obtaining of the DNA fragment of the region of 104827658-104830494 of pig chromosome 8 and establishment of the SNP detection method
[0093] The experiment selects a large white pig, and three pairs of primers are designed according to the genomic sequence of the 104827658-104830494 segment of pig chromosome 8, and the specific sequences are as follows:
[0094] Forward primer 1 (SEQ ID NO. 5): 5'-TAGGGTCAGTTTCAAGAGAAAGCATTC-3',
[0095] Reverse primer 1 (SEQ ID NO. 6): 5'-ACACAGGAGTTATGCACTTGTATCTCA-3'.
[0096] Forward primer 2 (SEQ ID NO. 7): 5'-CACTCATTCTGACTTGGCTGTTCC-3',
[0097] Forward primer 2 (SEQ ID NO. 8): 5'-CCTAAATGATGTGACCTTGAGATTTCC-3'.
[0098] Forward primer 3 (SEQ ID NO. 9): 5'-AAGCAGATGCCAATTCAAGAAGTTCAG-3',
[0099] Reverse primer 3 (SEQ ID NO. 10): 5'- AACAGCCAAGTCAGAATGAGTGGTT-3'.
[0100] The genomic DNA of different test population pigs was subjected to PCR amplification using the above-mentioned primers.
[0101] The PCR reaction system is shown in Table 1.
[0102] Table 1 PCR reaction system
[0103]
[0104] The PCR reaction conditions are shown in Table 2.
[0105] Table 2 PCR reaction conditions
[0106]
[0107] After purification and cloning of the obtained PCR products, Wuhan Hechuan Gene Technology Co., Ltd. was commissioned to perform sequence determination. BLAST comparison analysis found that 19 base mutations existed in the three sequences.
[0108] Example 2: Analysis and application of genetic markers of the present application and haplotypes of Large White pigs
[0109] In order to determine the linkage disequilibrium relationship of the 19 SNPs in the region of 104827658-104830494 of pig chromosome 8, Large White pigs (1266) were selected as test materials in this embodiment. Polymorphism detection was performed by direct sequencing method, and the correlation of polymorphic sites and haplotypes was analyzed. Haploview 4.1 software was used for linkage disequilibrium analysis and haplotype analysis, in which the 19 polymorphic sites were all in complete linkage disequilibrium, generating two haplotypes, H1: GACGGCGTGCTAAAATTCC, H2: CCGTTTACATAGGGGCGAT, as shown in Table 3.
[0110] Table 3 Haplotype analysis of SYISL gene in Large White pigs
[0111]
[0112] Example 3: Association analysis and application of genetic markers of the present application and feed utilization and meat production traits of Large White pigs
[0113] In order to determine the correlation between the haplotype composed of 19 SNPs in the region of 104827658-104830494 of pig chromosome 8 and the differences in pig phenotypes, Large White pigs (1266) were selected as the test materials in this embodiment. Polymorphism was detected by direct sequencing method, and the correlation between the polymorphic sites and the meat production traits and feed utilization of pigs was analyzed. The association between genotypes and phenotypic values was analyzed by using the mixed linear model (Mixed) in the SAS 8.0 statistical software. The analysis model of Large White pigs is as follows: Y ijkl = u + G i + F j + S k + B l + ε ijklm , wherein Y ijkl is the trait observation value; u is the total average value of the trait; G i is the genotype effect; F j , S k , and B l are fixed effects, which are family, gender, and batch effects, respectively; ε ijklm is a random error, which is assumed to follow N(0, σ 2 ) distribution.
[0114] After polymorphism detection of the 19 sites in the region of 104827658-104830494 of pig chromosome 8, three genotypes were detected in the above Large White pig population. The genotype frequency and its distribution are shown in Table 4.
[0115] Table 4 Genotype frequency and allele frequency of polymorphic sites in the Large White pig population
[0116]
[0117] From Table 4, it can be seen that the H1-H1 allele frequency of the polymorphic site in the Large White pig population is higher than the H2-H2 allele frequency.
[0118] Table 5 Association analysis of polymorphic sites and feed utilization and meat production traits
[0119]
[0120] Note: The above values are least square means ± standard errors; in each pig breed, the same capital letter in the same column indicates extremely significant (P<0.01), the same small letter indicates significant (P<0.05), the same column contains the same letter, which indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no annotation indicates no significant difference (P>0.05).
[0121] Through the analysis of Table 5, it is found that the polymorphic sites have significant correlation with backfat thickness, eye muscle thickness, average feed intake (30-100kg) and average feed-meat ratio (30-100kg) in Large White pigs (P<0.05). Among them, the backfat thickness, average feed intake and average feed-meat ratio of the individual with combined haplotype H2-H2 are significantly lower than those of the individual with combined haplotype H1-H1 genotype (P<0.05); the eye muscle thickness of the individual with combined haplotype H2-H2 is significantly higher than that of the individual with combined haplotype H1-H1 genotype (P<0.05). From the aspects of genetic stability and genetic progress, the combined haplotype H2-H2 has obvious advantages in reducing the live backfat thickness, average feed intake (30-100kg) and average feed-meat ratio (30-100kg), and increasing the eye muscle thickness. In combination with the above results, the haplotype polymorphic site composed of the 19 SNPs can be used as a molecular breeding marker for increasing feed utilization and pork production traits.
[0122] It should be noted that the above embodiments are only used to explain the technical method of the present application, and the application range of the present application is not limited to the listed examples; through the explanation and description of the above embodiments, researchers in the field should understand that the researchers can modify the technical solutions described in the above embodiments, and replace some or all of the technical features of the embodiments; and the technical solutions generated by these modifications and replacements without departing from the essence of the technical solutions of the present application are also within the scope of the embodiments of the present application.
Claims
1. The use of a haplotype marker associated with pig feed utilization and meat production traits in Large White pig breeding, characterized in that, The marker consists of 19 SNP loci; the 19 SNP loci are named as rs698837059, rs702511014, rs711300964, rs707052512, rs696375896, rs708902283, rs691749030, rs343701254, rs320380315, rs326529139, rs340588370, rs322564742, rs342333906, rs324114921, rs334145347, rs341513531, rs328108976, rs326445452, rs346394676; the relationship between different genotypes of the 19 SNP loci and feed utilization and meat production traits of pigs: the 100kg backfat thickness, 30-100kg average feed intake, 30-100kg average feed conversion of individuals with combined haplotype H2-H2 are significantly lower than those of individuals with combined haplotype H1-H1 genotype; the 100kg eye muscle thickness of individuals with combined haplotype H2-H2 is significantly higher than that of individuals with combined haplotype H1-H1 genotype; the 19 SNP loci of H1 genotype are GACGGCGTGCTAAAATTCC in turn, and the 19 SNP loci of H2 genotype are CCGTTTACATAGGGGCGAT in turn.
Citation Information
Patent Citations
Genetic marker associated with growth and fattening traits of pigs and application
CN113088576A
Genetic marker associated with pig muscle fiber density and meat production character and application
CN116516014A