Lysine L-phenyllactylated modified hapten, artificial antigen and preparation method and application of lysine L-phenyllactylated modified hapten and artificial antigen

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a lysine L-phenyllactylated modified hapten, an artificial antigen and a preparation method and application of the lysine L-phenyllactylated modified hapten and the artificial antigen. Researches show that L-phenyllactylated modification of lysine is increased in phenylketonuria, and based on this, the invention provides the L-phenyllactylated hapten of lysine. The lysine L-phenyllactic acid modified hapten is used for further preparing a lysine L-phenyllactic acid modified polyclonal antibody, the lysine L-phenyllactic acid modified polyclonal antibody has specific recognition and binding capacity on lysine L-phenyllactic acid modified in phenylketonuria patients, and the lysine L-phenyllactic acid modified hapten also has high titer and specificity.

Description

Technical Field

[0001] The present application belongs to the field of biomedicine, and specifically relates to a lysine L-phenyllactate-modified hapten, an artificial antigen, and a preparation method and application thereof. Background Art

[0002] Modification of the ε-amino group of lysine (i.e., post-translational modification of lysine) plays an important role in transcriptional regulation, signal transduction, protein degradation, and cell metabolism. Post-translational modification of lysine occurs widely in histones and non-histones, expanding the biological functions of proteins. Post-translational modification of lysine is mainly regulated by acylases, deacylases, and readers. Acylases mediate the addition of modification groups to the ε-amino group of lysine in proteins, while deacylases remove modification groups from the ε-amino group of lysine in proteins; readers recognize modification groups on the ε-amino group of histone lysine and then regulate the expression of downstream genes. With the development of mass spectrometry technology, new acylation modifications of lysine are constantly being discovered.

[0003] At present, about 30 lysine acylation modifications have been discovered, including lactylation, benzoylation, isonicotinoylation, acetylation, and crotonylation. Lysine post-translational modification of proteins is abnormal in tumors and metabolic diseases. Therefore, targeting lysine post-translational modification regulatory elements of proteins can treat diseases.

[0004] Phenylketonuria is a metabolic disease caused by an inborn error in phenylalanine metabolism, which leads to the accumulation of phenylacetic acid, L-phenyllactic acid and 2-hydroxyphenylacetic acid in urine. Its main clinical features are mental retardation, neuropsychiatric symptoms, eczema, skin scratching, pigment loss and mouse odor. The incidence of phenylketonuria is about 1 / 16,500. The disease is mainly caused by mutations in phenylalanine hydroxylase (PAH), which leads to low or missing enzyme activity.

[0005] At present, the diagnosis of phenylketonuria is mainly to detect the phenylalanine content and the ratio of phenylalanine to tryptophan in the blood. Therefore, it is necessary to provide a new small molecule hapten for the preparation of products related to the diagnosis, treatment or prognosis of phenylketonuria. Summary of the invention

[0006] Based on this, an embodiment of the present application provides a lysine L-phenyllactate-modified hapten, an artificial antigen, and a preparation method and application thereof.

[0007] On the one hand, the present application provides a lysine L-phenyllactate modified hapten, the structure of the lysine L-phenyllactate modified hapten is as follows: AA1-AA2-AA3-lysine L-phenyllactate modified-AA4-AA5-AA6-Cys.

[0008] Wherein, the lysine L-phenyllactate modification is as follows:

[0009]

[0010] The AA1, AA2 and AA3 and the AA4, AA5 and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg and His.

[0011] On the other hand, the present application provides a method for preparing a lysine L-phenyllactate-modified hapten, which comprises synthesizing the lysine L-phenyllactate-modified hapten using a solid phase synthesis method.

[0012] On the other hand, the present application provides an artificial antigen, which includes a carrier protein and the lysine L-phenyllactate modified hapten coupled to the carrier protein.

[0013] In one embodiment, the carrier protein includes one or more of hemocyanin KLH, bovine serum albumin BSA and chicken ovalbumin OVA.

[0014] In one embodiment, the carrier protein and the lysine L-phenyllactylation-modified polypeptide are covalently linked via MBS.

[0015] On the other hand, the present application provides a method for preparing an artificial antigen, characterized in that the preparation method comprises: mixing the carrier protein and the lysine L-phenyllactate-modified hapten for a coupling reaction to prepare the artificial antigen.

[0016] On the other hand, the present application provides a method for preparing a lysine L-phenyllactate-modified polyclonal antibody, which comprises the steps of immunizing a mammal with an immunogen and isolating the lysine L-phenyllactate-modified polyclonal antibody from the serum of the immunized mammal.

[0017] Wherein, the immunogen is the artificial antigen.

[0018] In one embodiment, the mammal comprises a lagomorph.

[0019] In one embodiment, immunizing a mammal with an immunogen includes: a primary immunization and a booster immunization.

[0020] In one embodiment, the amount of the immune antigen for the initial immunization is 1.4 mg to 1.8 mg.

[0021] In one embodiment, the amount of the immune antigen for the booster immunization is 0.6 mg to 1.0 mg.

[0022] In one embodiment, the number of booster immunizations is 6 to 8 times.

[0023] On the other hand, the present application provides a lysine L-phenyllactate-modified polyclonal antibody, and the lysine L-phenyllactate-modified polyclonal antibody is prepared by the preparation method.

[0024] On the other hand, the present application provides the use of the polyclonal antibody in the preparation of products for the detection, treatment and prognosis of phenylketonuria.

[0025] In one embodiment, the product includes a reagent, a test paper, a test kit or a chip.

[0026] On the other hand, the present application provides a detection product, which includes the polyclonal antibody.

[0027] The present application also provides a method for detecting lysine L-phenyllactate modification, which comprises the step of using the lysine L-phenyllactate modification polyclonal antibody to detect lysine L-phenyllactate modification in a sample to be tested.

[0028] The details of one or more embodiments of the present application are set forth in the description which follows, and other features, objects, and advantages of the present application will be apparent from the description and its claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0030] Figure 1 This is a titer test diagram of the rabbit polyclonal antibody modified by lysine L-phenyllactate;

[0031] Figure 2 The rabbit polyclonal antibody modified by lysine L-phenyllactation does not bind to lysine peptides;

[0032] Figure 3 The rabbit polyclonal antibody against lysine L-phenyllactate modification does not bind to lysine 2-hydroxy-phenylpropionate modification peptides, lysine 4-hydroxy-phenylpropionate modification peptides, and lysine β-hydroxy-phenylpropionate modification peptides;

[0033] Figure 4The rabbit polyclonal antibody against lysine L-phenyllactate does not bind to lysine lactate-modified peptides and lysine benzoyl-modified peptides.

[0034] Figure 5 Lysine L-phenyllactylation is elevated in phenylketonuria. DETAILED DESCRIPTION

[0035] Below in conjunction with embodiment and example, the application is further described in detail.It should be understood that these embodiments and examples are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiments and examples is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms, is not limited to the embodiment and example described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the application, and it should be understood that the application can be implemented without one or more of these details.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0037] the term

[0038] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0039] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0040] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0041] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0042] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0043] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0044] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0045] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0046] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0047] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0048] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0049] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0050] The term "antibody" means an immunoglobulin molecule that recognizes and specifically binds to a target (such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid or a combination thereof) through at least one antigen recognition site located within the variable region of the immunoglobulin molecule.

[0051] The term "polyclonal antibody" refers to a mixture of antibodies against different epitopes of the same antigen produced by different B cell clones after the body is stimulated by multiple antigenic determinants. They can recognize and bind to different antigenic epitopes on a single antigen.

[0052] The term "treatment" generally refers to an operation to obtain a desired pharmacological and / or physiological effect. The effect may be preventive, in terms of completely or partially preventing a disease or its symptoms; and / or therapeutic, in terms of partially or completely stabilizing or curing a disease and / or side effects produced by the disease. As used herein, "treatment" encompasses any treatment of a patient's disease, including but not limited to preventing the occurrence or recurrence of a disease, alleviating symptoms of a disease, reducing any direct or indirect pathological consequences of a disease, preventing the metastasis of a disease, slowing the progression of a disease, improving or alleviating the state of a disease, extending the frequency and duration of symptom-free periods, and resolving or improving the prognosis of a disease.

[0053] The term "therapeutically effective amount" or "therapeutically effective dose" refers to any amount of a drug that protects a patient from the onset of disease or promotes disease regression, as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or the prevention of impairment or disability resulting from disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to skilled practitioners, such as in human patients during clinical trials, in animal model systems predictive of efficacy in humans, or by measuring the activity of the agent in in vitro assays.

[0054] The terms "administering" or "administering" refer to the physical introduction of a therapeutic agent into a subject using any of a variety of methods and delivery systems known to those skilled in the art.

[0055] The terms "subject" or "patient" are used interchangeably. "Subject" or "patient" includes any human or non-human animal. The term "non-human animal" includes, but is not limited to, vertebrates such as non-human primates, sheep, dogs, and rodents (e.g., mice, rats, and guinea pigs). In some embodiments, the subject or patient is a mammal. In some embodiments, the subject or patient is a mouse. In some embodiments, the subject or patient is a human.

[0056] The term "lysine L-phenyllactylation" is a protein post-translational modification (PTM) in which an L-phenyllactyl group is added to the lysine residues of the protein. This modification can change the function, stability and interaction of the protein, thereby playing a role in a variety of biological processes. The characteristics of L-phenyllactylation modification include: this modification can occur on both histone lysine residues and non-histone lysine residues, especially specific lysine residues of core histones, such as K14, K18, K23, K27, K36, K37, K56 and K122 of histone H3 and K8, K12, K20, K31 and K91 of histone H4.

[0057] The present application has found through research that organic acids can form a complex with coenzyme A under the action of related enzymes, and then serve as a donor for the post-translational modification of lysine. However, previous studies have ignored the role of phenylacetic acid, L-phenyllactic acid and 2-hydroxyphenylacetic acid in phenylketonuria. Therefore, it is necessary to explore the mechanism of action of phenylacetic acid, L-phenyllactic acid and 2-hydroxyphenylacetic acid in phenylketonuria from the perspective of post-translational modification of lysine, and explore new targets that can be applied to the treatment of phenylketonuria.

[0058] On the one hand, the present application provides a lysine L-phenyllactate modified hapten, the structure of the lysine L-phenyllactate modified hapten is as follows: AA1-AA2-AA3-lysine L-phenyllactate modified-AA4-AA5-AA6-Cys.

[0059] Among them, the lysine L-phenyllactate modification is as follows:

[0060]

[0061] AA1, AA2, AA3 and AA4, AA5, and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg, and His.

[0062] For example, AA1 is selected from Ala, AA4 is selected from Val, and other optional combinations are also possible.

[0063] The present invention combines specific selected amino acids with lysine L-phenyllactate modification to form a hapten, and the hapten is used to further prepare artificial antigens and polyclonal antibodies with high titer and specificity.

[0064] On the other hand, the present application provides a method for preparing a lysine L-phenyllactate modified hapten, which comprises the step of adding an L-phenyllactate group to a lysine residue to prepare a lysine L-phenyllactate modified hapten.

[0065] On the other hand, the present application provides an artificial antigen, which includes a carrier protein and the lysine L-phenyllactate modified hapten coupled to the carrier protein.

[0066] Optionally, the carrier protein includes one or more of hemocyanin KLH, bovine serum albumin BSA and chicken ovalbumin OVA.

[0067] On the other hand, the present application provides a method for preparing an artificial antigen, the preparation method comprising: mixing the carrier protein and the lysine L-phenyllactate-modified hapten to perform a coupling reaction to prepare the artificial antigen.

[0068] On the other hand, the present application provides a method for preparing a lysine L-phenyllactate-modified polyclonal antibody, which comprises the steps of immunizing a mammal with an immunogen and isolating the lysine L-phenyllactate-modified polyclonal antibody from the serum of the immunized mammal.

[0069] Wherein, the immunogen is the artificial antigen.

[0070] Optionally, the mammal comprises a lagomorph, such as a New Zealand White rabbit.

[0071] In a specific animal, the immune response includes: primary immunization and booster immunization.

[0072] Optionally, the amount of the immunizing antigen for the first immunization is 1.4 mg to 1.8 mg. For example, the amount of the immunizing antigen for the first immunization is 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg or 1.8 mg.

[0073] Optionally, the amount of the immunizing antigen for booster immunization is 0.6 mg to 1.0 mg. For example, the amount of the immunizing antigen for booster immunization is 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg or 1.0 mg.

[0074] Optionally, the number of booster immunizations is 6 to 8 times, for example 6, 7 or 8 times.

[0075] Among them, the recombinant antigen also includes mixing with complete Freund's adjuvant, among which complete Freund's adjuvant is a commonly used immune adjuvant, mainly used to enhance immune response in animal experiments. Its mechanism of action is: the adjuvant activity of complete Freund's adjuvant comes from the continuous release of immunogens in oil droplets and stimulates local immune response. This continuous release can enhance the antibody response to the antigen. Incomplete Freund's adjuvant is a commonly used immune adjuvant, mainly used to enhance the immune response to antigens in animal immunization.

[0076] On the first day, complete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 1.4mg~1.8mg. For example, the volume ratio was: 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg.

[0077] On the 26th to 30th day, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immune antigen was 0.6mg~1.0mg. For example, the volume ratio is: 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immune antigen is 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0078] On days 38 to 42, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was: 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0079] On days 45 to 49, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0080] On days 52 to 56, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was: 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0081] On days 62 to 66, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0082] On days 72 to 76, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0083] On days 82 to 86, incomplete Freund's adjuvant and recombinant antigen were mixed in a volume ratio of 1:(0.8-1.2) and injected subcutaneously at multiple points. The amount of immunizing antigen was 0.6mg~1.0mg. For example, the volume ratio was: 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2. The amount of immunizing antigen was 0.6mg, 0.7 mg, 0.8 mg, 0.9 mg, 1.0 mg.

[0084] On the 92nd to 96th day, animal serum was collected, separated and purified.

[0085] On the other hand, the present application provides a polyclonal antibody prepared by the polyclonal antibody preparation method.

[0086] The present application also provides the use of the polyclonal antibody in the preparation of products for the treatment and prognosis of phenylketonuria.

[0087] Optionally, the product includes but is not limited to reagents, test strips, test kits or chips, and drugs.

[0088] On the other hand, the present application provides a method for detecting lysine L-phenyllactate modification, which comprises the step of using the lysine L-phenyllactate modification polyclonal antibody to detect lysine L-phenyllactate modification in a sample to be tested.

[0089] The present application shows through research that lysine L-phenyllactic acid modification increases in phenylketonuria. Based on this, the present application provides a lysine L-phenyllactic acid modified hapten. The lysine L-phenyllactic acid modified hapten of the present application is further used to prepare a lysine L-phenyllactic acid modified polyclonal antibody, which has specific recognition and binding ability to lysine L-phenyllactic acid modification in phenylketonuria patients, and also has high titer and specificity.

[0090] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0091] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0092] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0093] Example 1

[0094] This embodiment provides a method for preparing a hapten

[0095] 1. Preparation of lysine L-phenyllactate modified antigen

[0096] 1. Use solid phase synthesis to synthesize AA1-AA2-AA3-lysine L-phenyllactic acid modified-AA4-AA5-AA6-Cys peptide (lysine L-phenyllactic acid modified polypeptide) and AA1-AA2-AA3-lysine-AA4-AA5-AA6-Cys peptide (lysine polypeptide).

[0097] Among them, AA1, AA2 and AA3 and AA4, AA5 and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg and His.

[0098] Example 2

[0099] This embodiment provides a method for preparing an artificial antigen

[0100] 1. Preparation of lysine L-phenyllactate modified antigen

[0101] 1. Use solid phase synthesis to synthesize AA1-AA2-AA3-lysine L-phenyllactic acid modified-AA4-AA5-AA6-Cys peptide (lysine L-phenyllactic acid modified polypeptide) and AA1-AA2-AA3-lysine-AA4-AA5-AA6-Cys peptide (lysine polypeptide).

[0102] Among them, AA1, AA2 and AA3 and AA4, AA5 and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg and His.

[0103] 2. MBS (m-Maleimidobenzoyl-N-hydroxysuccinimide ester) activates 10 mg of carrier protein KLH (Keyhole limpet hemocyanin) to form an MBS / KLH conjugate.

[0104] 3. MBS / KLH is cross-linked with lysine L-phenyllactate-modified polypeptide containing Cys residues at pH=7.0 to form a polypeptide-KLH covalent complex antigen.

[0105] The L-phenyllactylation modification of lysine is as follows:

[0106]

[0107] Example 3

[0108] This example provides a method for preparing a lysine L-phenyllactate-modified polyclonal antibody

[0109] 1. Preparation of lysine L-phenyllactate modified antigen

[0110] 1. Use solid phase synthesis to synthesize AA1-AA2-AA3-lysine L-phenyllactic acid modified-AA4-AA5-AA6-Cys peptide (lysine L-phenyllactic acid modified polypeptide) and AA1-AA2-AA3-lysine-AA4-AA5-AA6-Cys peptide (lysine polypeptide).

[0111] Among them, AA1, AA2 and AA3 and AA4, AA5 and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg and His.

[0112] 2. MBS (m-Maleimidobenzoyl-N-hydroxysuccinimide ester) activates 10 mg of carrier protein KLH (Keyhole limpet hemocyanin) to form an MBS / KLH conjugate.

[0113] 3. MBS / KLH is cross-linked with lysine L-phenyllactate-modified polypeptide containing Cys residues at pH=7.0 to form a polypeptide-KLH covalent complex antigen.

[0114] The L-phenyllactylation modification of lysine is as follows:

[0115]

[0116] 2. Animal Immunization

[0117] Primary immunization: Mix the volume of Freund's complete adjuvant with the antigen and inject subcutaneously at multiple points on the back of 2-month-old New Zealand white rabbits for the main injection (1.6 mg antigen / rabbit, day 0).

[0118] Booster immunization: An equal volume of Freund's incomplete adjuvant was mixed with the antigen and seven booster injections (0.8 mg sensitive antigen / rabbit, on days 28, 42, 47, 54, 64, 74, and 84) were given subcutaneously at multiple points on the back of New Zealand white rabbits.

[0119] 3. Purification of rabbit polyclonal antibody modified by lysine L-phenyllactation

[0120] On the 94th day of immunization, blood was collected from the carotid artery and the New Zealand white rabbits were killed. The rabbit blood was placed at 4°C overnight, centrifuged at 4°C (10,000 rpm) for 30 minutes, and the supernatant was collected. Using a Sepharose 4B column activated with hydrogen bromide, 2 mg of lysine L-phenyllactate-modified peptide was covalently linked to the Sepharose 4B column by conventional methods to prepare a lysine L-phenyllactate-modified peptide affinity purification column; 2 mg of lysine peptide was covalently linked to the Sepharose 4B column by the same method to prepare a lysine peptide affinity adsorption column. 10 mL of antiserum was incubated with the lysine L-phenyllactate-modified peptide affinity purification column overnight, and washed with HCl buffer at pH 5.0 to remove impurities. The pH was 2.5, 0.15 M glycine buffer was used for elution, and 10× PBS buffer was quickly neutralized to prepare affinity purification antibodies. The affinity-purified antibody is passed through a lysine polypeptide affinity adsorption column, the flow-through liquid is collected, and the antibody against the lysine polypeptide is removed to obtain a lysine L-phenyllactate-modified specific antibody.

[0121] Take 5 μL of protein standards of different concentrations and add them to the protein standard wells of a 96-well plate. Take 5 μL of lysine L-phenyllactate-modified rabbit polyclonal antibody and add them to the sample wells of a 96-well plate. Add 250 μL of G250 staining solution to each well. Measure the absorbance at 595 nm using an ELISA reader. Based on the standard curve and the sample volume used, the concentration of the purified lysine L-phenyllactate-modified rabbit polyclonal antibody was calculated to be 0.82 mg / mL.

[0122] Verification results:

[0123] 1. Lysine L-phenyllactate modified rabbit polyclonal antibody titer detection

[0124] Dilute the antigen with coating solution, add 100 ng / well of antigen to a polystyrene 96-well plate, and coat overnight at 4°C. The next day, discard the coating solution in the wells and wash three times with washing solution.

[0125] The antigens are: lysine L-phenyllactate modified polypeptide and lysine polypeptide.

[0126] Blocking: Add 200μL / well blocking solution and place at room temperature for 1h. Washing: Wash 3 times with washing solution. Add lysine L-phenyllactate-modified rabbit polyclonal antibody according to the corresponding dilution ratio, 100μL per well, incubate at room temperature for 1h. Wash 5 times with washing solution. Add goat anti-rabbit-HRP (dilution ratio 1:5000) labeled IgG secondary antibody, 100 μL / well, incubate at 37℃ for 40min. Wash 5 times with washing solution; add 100 μL / well of freshly prepared substrate solution and place in the dark at room temperature for 15min. Add 50μL / well stop solution. The color turns yellow; use an enzyme reader to measure the absorbance of each well at 450nm. The titer of lysine L-phenyllactate-modified antibody is 1:1000, and the test results are as follows Figure 1 shown.

[0127] II. Specificity detection of rabbit polyclonal antibody modified by lysine L-phenyllactate

[0128] Cut the nitrocellulose (NC) membrane and press it against the well plate in the clean pipette tip box. Use the pipette tip sideways against the plate well to spot 2µL of antigen onto the NC membrane.

[0129] The antigens are lysine L-phenyllactate modified polypeptide and lysine polypeptide.

[0130] After the NC membrane was dried naturally, it was blocked in an incubation box at room temperature for 1 hour using a TBST solution containing 5% skim milk powder. The NC membrane was washed 3 times with TBST, and the NC membrane was incubated in a lysine L-phenyllactate-modified rabbit polyclonal antibody (dilution ratio 1:1000) diluted with the primary antibody diluent, and incubated at room temperature for 2 hours. It was washed three times with TBST, 5 minutes each time; it was combined with a goat anti-rabbit-HRP antibody (dilution ratio 1:5000) and incubated for 1 hour at room temperature. It was washed three times with TBST, 5 minutes each time, and the reaction was performed using an enhanced luminescent solution, and the iBright1500 imaging system instrument was used for detection.

[0131] The results showed that the lysine L-phenyllactate modified rabbit polyclonal antibody specifically bound to the lysine L-phenyllactate modified peptide, but not to the lysine peptide. Figure 2 shown.

[0132] 3. Lysine L-phenyllactate modified rabbit polyclonal antibody does not cross-react with isomeric modifications

[0133] Cut the nitrocellulose (NC) membrane, press the NC membrane with the well plate in the clean pipette tip box, use the pipette tip sideways against the plate well, and spot 2µL of antigen onto the NC membrane.

[0134] Among them, the antigens are lysine L-phenyllactate modified polypeptide, lysine 2-hydroxy-phenylpropionyl modified polypeptide, lysine 4-hydroxy-phenylpropionyl modified polypeptide lysine and lysine β-hydroxy-phenylpropionyl modified polypeptide.

[0135] After the NC membrane was dried naturally, it was blocked in an incubation box at room temperature for 1 hour using a TBST solution containing 5% skim milk powder. The NC membrane was washed 3 times with TBST, and the NC membrane was incubated in a lysine L-phenyllactate-modified rabbit polyclonal antibody (dilution ratio 1:1000) diluted with the primary antibody diluent, and incubated at room temperature for 2 hours. It was washed three times with TBST, 5 minutes each time; it was combined with a goat anti-rabbit-HRP antibody (dilution ratio 1:5000) and incubated for 1 hour at room temperature. It was washed three times with TBST, 5 minutes each time, and the reaction was performed using an enhanced luminescent solution, and the iBright1500 imaging system instrument was used for detection.

[0136] The results showed that the lysine L-phenyllactate modified rabbit polyclonal antibody specifically binds to the lysine L-phenyllactate modified peptide, but does not cross-react with the lysine L-phenyllactate modified peptide isomers (lysine 2-hydroxy-phenylpropionyl modified peptide, lysine 4-hydroxy-phenylpropionyl modified peptide lysine and β-hydroxy-phenylpropionyl modified peptide). Figure 3 shown.

[0137] 4. Lysine L-phenyllactate modified rabbit polyclonal antibody does not cross-react with existing modifications

[0138] Cut the nitrocellulose (NC) membrane, press the NC membrane with the well plate in the clean pipette tip box, use the pipette tip sideways against the plate well, and spot 2µL of antigen onto the NC membrane.

[0139] The antigens are: lysine L-phenyllactate modified peptide, lysine lactate modified peptide, lysine benzoyl modified peptide.

[0140] After the NC membrane was dried naturally, it was blocked in an incubation box at room temperature for 1 hour using a TBST solution containing 5% skim milk powder. The NC membrane was washed 3 times with TBST, and the NC membrane was incubated in a lysine L-phenyllactate-modified rabbit polyclonal antibody (dilution ratio 1:1000) diluted with the primary antibody diluent, and incubated at room temperature for 2 hours. It was washed three times with TBST, 5 minutes each time; it was combined with a goat anti-rabbit-HRP antibody (dilution ratio 1:5000) and incubated for 1 hour at room temperature. It was washed three times with TBST, 5 minutes each time, and the reaction was performed using an enhanced luminescent solution, and the iBright1500 imaging system instrument was used for detection.

[0141] The results showed that the lysine L-phenyllactate modified rabbit polyclonal antibody specifically bound to the lysine L-phenyllactate modified peptide, but did not cross-react with the existing modified peptides (lysine benzoyl modified peptide and lysine lactate modified peptide). Figure 4 shown.

[0142] 5. Lysine L-phenyllactylation is increased in phenylketonuria models

[0143] PLC / PRF / 5 cells were plated in 10 cm culture dishes, and the next day, PAH shRNA lentivirus and scrambled control virus were used to transfect the cells (MOI = 10). The sequence of PAH shRNA lentivirus was: GATCGGGAAGCAGTTTGCTGACATTGCTCGAGCAATGTCAGCAAACTGCTTCCTTTTTT (SEQ ID NO. 1).

[0144] 12 hours after transfection, fresh culture medium was replaced and culture was continued for 72 hours. The cell culture medium was discarded, the cells were washed twice with cold PBS, 200 μL RIPA protein lysis buffer (containing protease inhibitors, deacylase inhibitor 3 μM Trichostatin A and 50 mM Nicotinamide) was added, lysed on ice for 10 minutes, cells were collected using a cell scraper, and centrifuged at 12000 rpm for 10 minutes. The supernatant was discarded, protein quantification was performed by BCA method, the protein concentration was adjusted to the same concentration, 5× loading buffer was added, and boiled for 5 minutes. The protein was added to SDS-PAGE gel for electrophoresis, and then transferred to PDVF membrane. 5% skim milk powder was blocked at room temperature for 1 hour, and TBST was washed 3 times, 5 minutes each time. Lysine L-phenyllactate modified rabbit polyclonal antibody (dilution ratio 1:1000) was incubated overnight at 4°C, and TBST was washed 3 times, 5 minutes each time. The samples were incubated with goat anti-rabbit-HRP antibody (dilution ratio 1:5000) at room temperature for 1 hour, washed 3 times with TBST, 5 minutes each time, reacted with enhanced luminescence solution, and detected with iBright1500 imaging system instrument.

[0145] The results showed that lysine L-phenyllactylation was increased in the PAH knockdown phenylketonuria model. Figure 5 shown.

[0146] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description can be used to interpret the content of the claims.

Claims

1. A lysine L-phenyllactate modified hapten, characterized in that: The structure of the lysine L-phenyllactate modified hapten is as follows: AA1-AA2-AA3-lysine L-phenyllactate modified-AA4-AA5-AA6-Cys; Wherein, the lysine L-phenyllactate modification is as follows: The AA1, AA2 and AA3 and the AA4, AA5 and AA6 are each independently selected from at least one of Ala, Val, Leu, Ile, Pro, Met, Trp, Phe, Gln, Ser, Thr, Asn, Tyr, Gly, Asp, Glu, Lys, Arg and His.

2. The method for preparing the lysine L-phenyllactate modified hapten according to claim 1, characterized in that: The preparation method comprises synthesizing the lysine L-phenyllactate modified hapten by using a solid phase synthesis method.

3. An artificial antigen, characterized in that: The artificial antigen comprises a carrier protein and the lysine L-phenyllactate modified hapten according to claim 1 coupled to the carrier protein; Optionally, the carrier protein includes one or more of hemocyanin KLH, bovine serum albumin BSA and chicken ovalbumin OVA; Optionally, the carrier protein and the lysine L-phenyllactylation-modified polypeptide are covalently linked via MBS.

4. The method for preparing an artificial antigen according to claim 3, characterized in that: The preparation method comprises: mixing the carrier protein and the lysine L-phenyllactate modified hapten to carry out coupling reaction to prepare the artificial antigen.

5. A method for preparing a lysine L-phenyllactate-modified polyclonal antibody, characterized in that: The preparation method comprises the steps of immunizing a mammal with an immunogen and isolating a lysine L-phenyllactate-modified polyclonal antibody from the serum of the immunized mammal; Wherein, the immunogen is the artificial antigen according to claim 3; Optionally, the mammal comprises a lagomorph.

6. The method for preparing a lysine L-phenyllactate-modified polyclonal antibody according to claim 5, characterized in that: Immunizing a mammal with an immunogen includes: primary and booster immunizations; Optionally, the amount of the immune antigen for the initial immunization is 1.4 mg to 1.8 mg; Optionally, the amount of the immune antigen for booster immunization is 0.6 mg to 1.0 mg; Optionally, the number of booster immunizations is 6 to 8 times.

7. A lysine L-phenyllactate-modified polyclonal antibody, characterized in that: The lysine L-phenyllactate-modified polyclonal antibody is prepared by the preparation method according to any one of claims 5 to 6.

8. Use of the polyclonal antibody according to claim 7 in the preparation of products for the detection, treatment and prognosis of phenylketonuria; Optionally, the product includes a reagent, a test paper, a test kit or a chip.

9. A detection product, characterized in that: The detection product comprises the polyclonal antibody according to claim 7.

10. A method for detecting the L-phenyllactate modification of lysine, characterized in that: The detection method comprises the step of using the lysine L-phenyllactate-modified polyclonal antibody according to claim 7 to detect the lysine L-phenyllactate-modified in the sample to be tested.

Images