Fermented lactobacillus mucilaginosus, probiotic preparation for promoting peristalsis and preparation method of probiotic preparation

Abstract

The invention provides a lactobacillus fermentum IG50, and the preservation number of the lactobacillus fermentum IG50 is CGMCC (China General Microbiological Culture Collection Center) NO.32111. The lactobacillus fermentum IG50 has the advantages that the lactobacillus fermentum IG50 can be used for preparing the lactobacillus fermentum IG50; the fermented lactobacillus mucus provided by the invention can be used for fermenting mangnolia officinalis, and a motilin receptor agonist is obtained. The invention also provides a probiotic preparation which is helpful for improving intestinal tract movement. The invention also provides a preparation method of the probiotic preparation. The preparation method of the probiotic preparation is simple and can be used for large-scale production.

Description

Technical Field

[0001] The invention belongs to the field of probiotic fermentation, and in particular relates to a fermented Lactobacillus mucosa and a fermentation product thereof, including a probiotic preparation for promoting intestinal peristalsis of the fermented Lactobacillus mucosa and a preparation method thereof. Background Art

[0002] Probiotics include bacteria and fungi, but the most commonly used probiotics belong to the group Lactobacillus and Bifidobacterium. In addition, other bacterial genera, such as Streptococcus, Enterococcus and Bacillus, and members of the genus Saccharomyces can have probiotic properties. The most common probiotics include: Lactobacillus acidophilus, Lactobacillus johnsonii, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus rhamnosus, Lactobacillus plantarum, Bifidobacterium longum, Bifidobacterium breve, Bifidobacterium bifidum and Bifidobacterium longum subsp. infantis. Some bacteria that are not often found in the gastrointestinal tract, such as Lactobacillus bulgaricus, Streptococcus thermophilus and Lactococcus, are also probiotics.

[0003] Among the above-mentioned probiotics, intestinal probiotics can colonize in the intestines, fight harmful bacteria, maintain the balance of intestinal flora, and regulate the body's immune function by enhancing the intestinal mucosal barrier function, inhibiting the growth and adhesion of pathogenic bacteria, regulating the activity of immune cells, and promoting the production of immune factors. In addition, intestinal probiotics also have the function of promoting intestinal peristalsis.

[0004] Poor intestinal motility is a condition in which the motility, or the speed at which food and waste are pushed through the intestines, slows. Common symptoms include:

[0005] 1. Constipation: Slow intestinal motility can cause food to stay in the intestines for too long, making it difficult to defecate.

[0006] 2. Abdominal distension and pain: It will cause the digestion time of food to be prolonged, and produce too much gas and fluid in the intestines, leading to abdominal distension and abdominal pain. The bloating feeling usually worsens after meals, and the abdominal pain may be paroxysmal or continuous.

[0007] 3. Indigestion: Because food stays in the intestines for too long, the absorption of nutrients by the intestines may be affected, leading to indigestion. Indigestion can manifest as stomach discomfort, hiccups, belching and nausea.

[0008] 4. Nausea and vomiting: It may cause slower gastric emptying, which can lead to nausea and vomiting. Nausea and vomiting usually occur after eating, and food staying in the stomach for too long may cause nausea.

[0009] 5. Loss of appetite and weight loss: Slow intestinal motility causes food to stay in the intestine for a long time after eating, which may reduce appetite and lead to weight loss.

[0010] Slow intestinal motility may also cause other symptoms, such as fatigue, anxiety, depression, heartburn, chest tightness, acid reflux, etc.

[0011] All of these will lead to a decline in the patient's quality of life.

[0012] On the other hand, common Chinese herbal medicines, such as Magnolia officinalis, are believed to have the function of promoting intestinal peristalsis. Therefore, screening out substances that can ferment Magnolia officinalis and obtain the function of promoting intestinal peristalsis has become a direction to solve the problem.

[0013] Most of the probiotics on the market are obtained by screening from food, and probiotics obtained from human feces (human probiotics) account for a relatively small proportion. After being screened and domesticated in the human gastrointestinal environment, human probiotics are more likely to colonize in the human intestine and thus exert greater probiotic effects; in particular, human probiotics have a high survival rate and are safer. The fermentation of traditional Chinese medicine by screened human probiotics is closer to that of probiotics in the human body, which is also safer.

[0014] The fermented mucus Lactobacillus disclosed in the Chinese invention application with publication number CN116751716A is a natural strain with high food safety. It has significant inhibitory activity on both α-amylase and α-glucosidase, is resistant to saliva, gastric acid, and bile salts, and has good intestinal colonization ability. It also has good cholesterol degradation ability and has important application value in the fields of food, health products, etc.

[0015] The Chinese invention application with publication number CN117099962A discloses the use of fermented mucus lactobacillus in the preparation of food to improve zinc deficiency damage. It is found that fermented mucus lactobacillus LFPerfectus001 has the effect of inhibiting the decrease of blood zinc content caused by zinc deficiency, increasing hair zinc content and immunoglobulin G (IgG) content, and can effectively improve the anorexia symptoms, weight loss and liver tissue damage caused by zinc deficiency, providing a new use for fermented mucus lactobacillus LFPerfectus001. Combined with the test results of drug sensitivity test, hemolytic test, mouse pathogenicity test phenotype test, and virulence gene and drug resistance gene analysis, it is proved from multiple dimensions that fermented mucus lactobacillus LFPerfectus001 is a safe strain.

[0016] However, none of the above prior arts involve the problem of accelerating intestinal peristalsis. Summary of the invention

[0017] The first object of the present invention is to provide a fermented mucus lactobacillus which can ferment Magnolia officinalis and promote intestinal peristalsis.

[0018] The second object of the present invention is to provide a fermentation product obtained by fermenting Magnolia officinalis with fermented Lactobacillus mucilaginosus.

[0019] The third object of the present invention is to provide a probiotic preparation comprising fermented Lactobacillus mucilaginosus.

[0020] The fourth object of the present invention is to provide a method for preparing a probiotic preparation.

[0021] The present invention is achieved through the following technical solutions.

[0022] A fermentative mucus lactobacillus IG50, whose Latin name is Limosilactobacillus fermentum. The preservation number of the strain is CGMCC NO.32111. The strain has been deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on September 29, 2024, the preservation unit code is CGMCC, the preservation unit address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, and the preservation number is CGMCC32111. The bacteria are alive when preserved.

[0023] A fermentation product obtained by fermenting Magnolia officinalis extract by fermenting Lactobacillus mucilaginosus IG50, wherein the fermentation product comprises a motilin receptor agonist;

[0024] The structure of the motilin receptor agonist is as follows:

[0025]

[0026] A probiotic preparation comprises fermented Lactobacillus mucilaginosus IG50 and a fermentation product obtained by fermenting magnolia bark extract with fermented Lactobacillus mucilaginosus IG50.

[0027] The probiotic preparation also includes a freeze-drying protective agent.

[0028] The freeze-drying protective agent comprises 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% oligofructose, 2-3% trehalose, 0.6-2.5% calcium alginate and the balance is water.

[0029] The preparation method of the probiotic preparation comprises the steps of fermenting and culturing the probiotics to obtain bacterial mud, mixing the bacterial mud with a freeze-drying protective agent, and then freeze-drying.

[0030] The culture medium used in the fermentation culture includes the following components in percentage by weight:

[0031] Yeast extract powder 0.3-0.8%, beef extract powder 0.4-0.8%, peptone 0.7-0.9%, diammonium hydrogen citrate 0.1-0.2%, dipotassium hydrogen phosphate 0.1-0.3%, anhydrous magnesium sulfate 0.01-0.03%, Tween 80 0.05-0.15%, glucose 0.5-2.5%, maltodextrin 1.0-1.5%, oligogalactose 0.5-0.8%, magnolia bark extract 0.3-0.5%, water balance. The preparation method of the magnolia bark extract is as follows:

[0032] The Magnolia officinalis is extracted and crushed to obtain a powder, and the powder is subjected to supercritical CO2 extraction.

[0033] The entrainer used in the supercritical CO2 extraction includes acetone;

[0034] The liquid-to-solid ratio of the entrainer to the powder is 1:0.08 g / mL.

[0035] The supercritical CO2 extraction uses a CO2 flow rate of 18-30 L / h;

[0036] The supercritical CO2 extraction adopts an extraction pressure of 2-4MPa;

[0037] The extraction temperature used in the supercritical CO2 extraction is 40-50°C;

[0038] The extraction time of the supercritical CO2 extraction is 3-5h.

[0039] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0040] The fermented mucus lactobacillus provided by the invention can ferment magnolia bark and obtain a motilin receptor agonist.

[0041] The probiotic preparation provided by the invention is helpful to improve intestinal motility.

[0042] The preparation method of the probiotic preparation provided by the invention is simple and can be produced on a large scale. DETAILED DESCRIPTION

[0043] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. If specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0044] Since Magnolia officinalis is mainly absorbed by the human body after fermentation by intestinal probiotics when used as Chinese medicine, the present invention is expected to screen out probiotics that can ferment Magnolia officinalis from the human intestinal tract, and separate beneficial compounds from the fermentation product. The intestinal flora of newborn babies is relatively simple, and probiotic flora accounts for the vast majority, and antibiotics have not been used, and the activity of probiotics is very high. Therefore, the success rate of screening and isolating bacteria with target functions from the feces of newborn babies is relatively high.

[0045] The specific extraction process of Magnolia officinalis extract is as follows: the bark of Magnolia officinalis is crushed into 10-55 mesh powder, and then the powder is placed in a supercritical CO2 extraction kettle. Acetone is used as an entrainer. Acetone is added according to the acetone to Magnolia officinalis solid-liquid ratio of 1:0.08 g / mL. Magnolia officinalis is subjected to supercritical CO2 extraction. The CO2 flow rate is controlled to be 18-30 L / h, the extraction pressure is 2-4 MPa, the extraction temperature is 40-50°C, the extraction is performed for 3-5 hours, and the extract is collected for later use.

[0046] Bacterial screening process

[0047] 1. Take 2 g of fresh feces from a healthy baby within 7 days after birth, filter it with sterile saline, spread it on a plate with MSR culture medium after gradient dilution, place it in an anaerobic incubator, and culture it in a constant temperature incubator at 37°C for 48 hours.

[0048] 2. After the colonies grow on the plate, use an inoculation loop to pick the colonies and purify them by streaking according to their color, size, transparency, edge shape, etc. Perform purification three times until the color, size, transparency, and edge shape of the colonies on the same plate are uniform.

[0049] 3. The purified colonies were subjected to Gram staining and catalase analysis, and Gram-positive bacteria and catalase-negative bacteria were retained.

[0050] 4. Spread the remaining bacteria on an MRS plate containing 0.8% calcium carbonate, and pick out the slightly larger bacteria with a transparent calcium-dissolving circle.

[0051] 5. The selected bacteria will be subjected to the next step of gastric acid and bile salt tolerance test.

[0052] Artificial gastric juice tolerance test: The treated bacterial liquid was inoculated into artificial gastric juice with pH 3.0, and cultured in a 37°C water bath for 3 hours. The number of live bacteria was determined and the survival rate was calculated.

[0053] Artificial intestinal fluid tolerance test: After the bacteria with high survival rate were treated in artificial gastric fluid for 3 hours, they were inoculated into artificial intestinal fluid (containing 0.3% bile salt) and cultured in a 37°C water bath for 6 hours. After that, the number of live bacteria was determined and the survival rate was calculated.

[0054] 6. Perform fermentation test on bacteria with high survival rate. Specifically, add 0.5wt% Magnolia officinalis extract to MRS medium, the bacterial inoculation amount is 2%, and the temperature is 37°C. After testing the fermentation product using human motilin (MTL) ELISA Kit, it is found that the fermentation product of strain IG50 has an agonist effect on motilin receptor.

[0055] IG50 was sequenced, and after comparison of the sequencing results, it was identified as belonging to Lactobacillus mucosa fermentans.

[0056] The 16s rDNA sequencing results of the bacteria are as follows:

[0057] CTAGCTAGCAGTACAGAGAGTTTGTGGCACGCGTTTGCCCAATTAGGTTGGTGGTGCT

[0058] TGCACCTGATTGATTTTGGTCGCCAACGAGGTGGCGGACGGGTGAGTAACACGTAGGT

[0059] AACCTGCCCAGAAGCGGGGGACAACATTTGGAAACAGATGCTAATACCGCATAACAAC

[0060] GTTGTTCGCATGAACAACGCTTAAAAGATGGCTTCTCGCTATCACTTCTGGATGGACCT

[0061] GCGGTGCATTAGCTTGTTGGTGGGGTAACGGCCTACCAAGGCGATGATGCATAGCCG

[0062] AGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTACGGGA

[0063] GGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCTGATGGAGCAACACCGCGT

[0064] GAGTGAAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTAAAGAAGAACACGTATGAGA

[0065] GTAACTGTTCATACGTTGACGGTATTTAACCAGAAAGTCACGGCTAACTACGTGCCAG

[0066] CAGCCGCGGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGA

[0067] GTGCAGGCGGTTTTCTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAAGTGCAT

[0068] CGGAAACTGGATAACTTGAGTGCAGAAGAGGGTAGTGGAACTCCATGTGTAGCGGTG

[0069] GAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTACCTGGTCTGCAAC

[0070] TGACGCTGAGACTCGAAAGCATGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCAT

[0071] GCCGTAAACGATGAGTGCTAGGTGTTGGAGGGTTTCCGCCCTTCAGTGCCGGAGCTA

[0072] ACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATT

[0073] GACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAA

[0074] CCTTACCAGGTCTTGACATCTTGCGCCAACCCTAGAGATAGGGCGTTTCCTTCGGGAA

[0075] CGCAATGACAGGTGGTGCATGGTCGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTAA

[0076] GTCCCGCAACGAGCGCAACCCTTGTTACTAGTTGCCAGCATTAAGTTGGGCACTCTAG

[0077] TGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGACGACGTCAGATCATCATGCC

[0078] CCTTATGACCTGGGCTACACACGTGCTACAATGGACGGTACAACGAGTCGCGAACTC

[0079] GCGAGGGCAAGCAAATCTCTTAAAACCGTTCTCAGTTCGGACTGCAGGCTGCAACTCG

[0080] CCTGCACGAAGTCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGT

[0081] TCCCGGGCCTTGTACACACCGCCCGTCACACCCTAACAAACCAAACATAGAGTCGAG

[0082] CCTGGGTCAGTAAGTACAAGGAAGGCACCATAGAGTAACCAC

[0083] See SEQ ID NO.1 for details.

[0084] In order to extract, separate and identify substances that can act on motilin receptors from the fermentation broth, the present invention purifies the fermentation broth. The specific steps are as follows:

[0085] (1) After the fermentation is completed, the fermentation liquid is soaked in 95% ethanol, centrifuged and the bacterial residue is discarded, the ethanol soaking clear liquid is collected and loaded onto an HP20 macroporous adsorption resin column at a rate of 0.5 BV / h for adsorption, and then eluted with 6 column volumes of water and 50% ethanol-water solution, respectively, at an elution flow rate of 1.5 BV / h, to remove some impurity pigments; then eluted with 4 column volumes of 95% ethanol, the eluate is collected, and concentrated to obtain a paste-like crude extract;

[0086] (2) Take the paste crude extract, add a small amount of methanol to dissolve it by ultrasonic, then stir and mix it with G200-300 mesh silica gel, and vacuum dry to remove the solvent; and fill the silica gel with the crude product into the upper layer of G200-300 mesh silica gel column, and then use petroleum ether: ethyl acetate = 7:1, petroleum ether: ethyl acetate = 4:1.5, and petroleum ether: ethyl acetate = 3:1 as the mobile phase for gradient elution.

[0087] Elution, collecting the eluate in sections;

[0088] (3) The collected eluate is detected for effective components by HPLC, the same components are combined and concentrated under vacuum, the concentrated solution is collected and dissolved in DMSO and then loaded on a DAC dynamic axial compression system, the target product is combined after HPLC detection, and vacuum dried to obtain a pure compound. HPLC analysis conditions: mobile phase: chromatographic grade acetonitrile (phase A), pure water containing 0.5% (v:v) formic acid (phase B); chromatographic column: ZORBAX SB-C18 (250×4.6 mm, 5 μm); flow rate: 1 mL / min; maximum pressure limit: 400 bar; detector: VWD; column temperature: 25°C; wavelength: 255 nm, 305 nm; injection volume: 20 μL; retention time: 25 min; gradient elution conditions: starting at A15% B 85%, reaching A 70% B30% at 18 min, reaching A 90% B10% at 20 min, A reaching 95% B10% at 21 min, A reaching 100% at 22 min, A reaching 20% ​​B 80% at 24 min, and maintaining A20% B 80% at 25 min.

[0089] The DAC dynamic axial compression system has C18 filler, 85% acetonitrile-water solution as mobile phase, controlled flow rate of 10 ml / min, and detection wavelength of 247 nm.

[0090] Among the substances extracted by the above method, the following compounds showed motilin receptor agonist effects.

[0091]

[0092] The spectral data of the compound are as follows:

[0093] 1H NMR (300MHz, CD3CN, δ, ppm)

[0094] 8.01(s,1H),7.86(s,1H),6.95(s,1H),6.67,(s,1H),6.08(s,1H),5.35(s,1H),4.49(s,1H),

[0095] 3.65,(d,2H),3.46(d,2H),3.33(d,2H),,3.01(s,1H),2.88(s,1H),2.85(d,2H),1.80(m,3H),1.63(m,3H),1.24(m,3H).

[0096] 13C NMR (300MHz, CD3CN, δ, ppm)

[0097] 175.4, 170.7, 147.7, 139.2, 138.8, 124.5, 123.7, 119.6, 111.0, 109.1, 68.4

[0098] 59.9, 42.6, 40.0, 33.6, 32.3, 23.3, 17.6, 14.0.

[0099] Furthermore, the agonist activity of the above compounds on motilin receptors was tested as follows:

[0100] The 96-well black-walled transparent cell culture plate was coated with the matrix BD Matrigel and incubated at 37°C for 1 hour. The supernatant was aspirated and the CHO-K1 cells corresponding to the human motilin receptor gene were inoculated in the 96-well black-walled transparent cell culture plate at a density of 4×10 wells. The cells were cultured in a 37°C constant temperature incubator with a CO2 concentration of 5% for 16 to 24 hours; then the cells were collected with 0.05% trypsin EDTA and centrifuged. The original culture medium was discarded. The cell pellet was resuspended in the culture medium, and 100 μL / well of the freshly prepared dye solution was added, and incubated at 37°C in the dark with 5% CO2 for 60 minutes. The compound was prepared in 100% DMSO, diluted to 5× the final concentration with the test buffer (Hanks balanced salt solution, 20mM HEPES and 0.1% BSA), and then distributed to the 384-well plate (5 μL / well). Preparation of the test sample: Prepare the test sample at different concentrations. A specific volume of the sample to be tested was added to the cells, the sample volume was 50 μL / well, and after culturing for 4.5 hours at 37°C and 5% CO2, CCF4-AM loading solution (Invitrogen Corp.) was added to each well. After culturing for 2 hours at room temperature, the fluorescence intensity was measured by using a plate reader FDSS (Hamamatsu Photonics KK) with an excitation wavelength of 400nm and an emission wavelength of 465nm / 540nm. The agonist effect of the sample on the motilin receptor was measured using a Flexstation3 multifunctional microplate reader. The experimental results were analyzed using Graphpadprism5 software.

[0101] result

[0102] When the test concentration is 0.85 mM, the compound has a strong stimulating effect on the motilin receptor, and the stimulating rate is 95.6%. Therefore, it can be seen that the compound has a stimulating effect on the motilin receptor and can be used as a new type of motilin agonist to improve gastrointestinal motility.

[0103] Preparation of probiotic preparations

[0104] Probiotic fermentation culture: The activated bacteria were inoculated into the spore-forming medium at an inoculum size of 2 mL / 100 mL. The culture was shaken at 37°C and 200 r / min for 48 h. The culture was heated in a water bath at 75°C for 15 min. The precipitate was centrifuged at 6000 g for 10 min, and the sludge was collected after washing three times with sterile saline.

[0105] The culture medium comprises the following components in percentage by weight: 0.3-0.8% yeast extract, 0.4-0.8% beef extract, 0.7-0.9% peptone, 0.1-0.2% diammonium hydrogen citrate, 0.1-0.3% dipotassium hydrogen phosphate, 0.01-0.03% anhydrous magnesium sulfate, 0.05-0.15% Tween 80, 0.5-2.5% glucose, 1.0-1.5% maltodextrin, 0.5-0.8% galacto-oligosaccharide, 0.3-0.5% magnolia bark extract, and the balance distilled water;

[0106] Preparation of probiotic freeze-dried powder: the probiotic mud and the freeze-dried protective agent are mixed evenly, pre-frozen at -80°C for 3h, freeze-dried to -60°C, and vacuum-freeze-dried to obtain the probiotic freeze-dried powder; the freeze-dried protective agent comprises the following components in weight percentage: 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% oligofructose, 2-3% trehalose, 0.6-2.5% calcium alginate, and the balance sterile water;

[0107] Animal Experimental Design Thirty-six 7-week-old male SPF BALB / c mice were randomly divided into a blank group, a modeling group, and a fermented Lactobacillus mucosa IG50 treatment group, with 12 mice in each group. After 7 days of adaptation, the blank group was gavaged with sterile saline every day, and the mice in the other groups were gavaged with loperamide hydrochloride (10 mg / kg bw) to create a mouse gastrointestinal motility inhibition model. One hour later, the blank group and the modeling group were gavaged with sterile saline, and the treatment group was gavaged with a probiotic preparation (5×10 8 cfu / mL), and the gavage volume was 0.2 mL for 14 consecutive days.

[0108] Detection indicators and methods

[0109] Determination of gastrointestinal motility in mice

[0110] On the 13th day, the mice were fasted overnight. The mice in the blank group were gavaged with sterile saline, and the mice in the other groups were gavaged with loperamide hydrochloride (10 mg / kg bw). One hour later, all mice were gavaged with ink containing the corresponding test preparation, and the gavage volume was 0.2 mL. The animals were then immediately transferred to a clean, empty cage and given food and water ad libitum. The time from gavage with ink to the discharge of the first black feces was recorded.

[0111] On the 14th day, the mice were fasted overnight and gavaged in the same way as on the 13th day. 30 minutes later, the mice were anesthetized by intraperitoneal injection of ketamine (100 mg / kg b.w). After blood was collected, the mice were killed by cervical dislocation. The abdomen was opened and the entire small intestine from the pylorus to the cecum was carefully removed. The distance traveled by the ink and the total length of the small intestine were measured. Small intestinal propulsion rate (%) = ink travel distance / total length of the small intestine × 100%.

[0112] Group Small intestinal propulsion rate (%) Blank Group 65.2 Modeling Group 38.1 Treatment Group 75.6

[0113] Determination of serum motilin level in mice

[0114] The collected mouse blood was allowed to stand for 2 hours, and then centrifuged at 3000×g for 15 minutes to obtain serum. The experiment was performed according to the instructions of the corresponding mouse motilin (MTL) ELISA kit, and the concentration of motilin in mouse serum was calculated according to the standard curve.

[0115] Group Motilin level (ng / L) Blank Group 134.8 Modeling Group 100.5 Treatment Group 175.4

[0116] The above experimental results show that probiotic preparations can significantly regulate the content of animal motilin and improve the gastrointestinal motility of animals.

Claims

1. A fermented mucus lactobacillus (Limosilactobacillus fermentum) IG50, characterized in that: Its accession number is CGMCC NO.32111.

2. A fermentation product obtained by fermenting Magnolia officinalis extract with fermented Lactobacillus mucilaginosus IG50 according to claim 1, characterized in that: The fermentation product includes a motilin receptor agonist; The structure of the motilin receptor agonist is as follows:

3. A probiotic preparation, characterized in that: The invention comprises the fermented Lactobacillus mucilaginosus IG50 as claimed in claim 1 and the fermentation product as claimed in claim 2.

4. The probiotic preparation according to claim 3, characterized in that: Lyoprotectants are also included.

5. The probiotic preparation according to claim 4, characterized in that: The freeze-drying protective agent comprises 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% oligofructose, 2-3% trehalose, 0.6-2.5% calcium alginate and the balance is water.

6. The method for preparing the probiotic preparation according to claim 3, characterized in that: The method comprises the steps of fermenting and culturing probiotics to obtain bacterial mud, mixing the bacterial mud with a freeze-drying protective agent, and then freeze-drying the mixture.

7. The method for preparing the probiotic preparation according to claim 6, characterized in that: The culture medium used in the fermentation culture includes the following components in percentage by weight: Yeast extract powder 0.3-0.8%, beef extract powder 0.4-0.8%, peptone 0.7-0.9%, diammonium hydrogen citrate 0.1-0.2%, dipotassium hydrogen phosphate 0.1-0.3%, anhydrous magnesium sulfate 0.01-0.03%, Tween 80 0.05-0.15%, glucose 0.5-2.5%, maltodextrin 1.0-1.5%, galacto-oligosaccharide 0.5-0.8%, magnolia bark extract 0.3-0.5%, and the balance is water.

8. The method for preparing the probiotic preparation according to claim 7, characterized in that: The preparation method of the Magnolia officinalis extract is as follows: The Magnolia officinalis is extracted and crushed to obtain a powder, and the powder is subjected to supercritical CO2 extraction.

9. The method for preparing the probiotic preparation according to claim 8, characterized in that: The entrainer used in the supercritical CO2 extraction includes acetone; The liquid-to-solid ratio of the entrainer to the powder is 1:0.08 g / mL.

10. The method for preparing the probiotic preparation according to claim 8, characterized in that: The supercritical CO2 extraction uses a CO2 flow rate of 18-30 L / h; The supercritical CO2 extraction adopts an extraction pressure of 2-4MPa; The extraction temperature used in the supercritical CO2 extraction is 40-50°C; The extraction time of the supercritical CO2 extraction is 3-5h.

Images