Nucleic acid molecule for changing corn plant height and application

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a nucleic acid molecule for changing corn plant height and application thereof. A series of nucleic acid molecules capable of changing the corn plant height are obtained by editing a corn ZmGA2ox2 gene promoter.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a nucleic acid molecule for changing corn plant height and an application thereof. Background Art

[0002] Dwarfing traits have brought about a breakthrough in crop yields, and methods to reduce crop plant height have great application potential. Among the main agronomic traits of corn, plant height and ear height affect corn lodging resistance, photosynthetic efficiency, and harvest index, and are closely related to corn yield. Therefore, plant height and ear height traits are of great value in corn breeding practice and germplasm resource improvement.

[0003] Promoter gene editing can change gene expression by changing promoter characteristics, thereby achieving the effect of trait improvement. For example, modifying the promoter of the rice OsSWEET gene can improve rice resistance to bacterial blight (Oliva, R., Ji, C., Atienza-Grande, G. et al. Broad-spectrum resistance to bacterial blight in rice using genome editing [J]. Nat Biotechnol., 2019, 37, 1344-1350); editing promoters such as SlCLV3 in tomatoes can obtain continuously changing phenotypes, thereby fine-tuning the phenotype (Rodríguez-Leal D, Lemmon ZH, Man J, et al. Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing [J]. Cell, 2017, 171: 470-480.e8.).

[0004] The present invention intends to achieve fine-tuning of corn plant height by editing the promoter of the corn gibberellin oxidase gene ZmGA2ox2. Summary of the invention

[0005] To solve the above problems, the present invention adopts the following technical solutions:

[0006] The present invention provides a nucleic acid molecule, characterized in that the nucleic acid molecule sequence is shown as SEQ ID NO.13 or any one of SEQ ID NO.16 to SEQ ID NO.23.

[0007] The present invention also provides an expression cassette, characterized in that: it is composed of the above-mentioned nucleic acid molecule, a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2, and a terminator of the sequence shown in SEQ ID NO.3 connected in sequence;

[0008] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4.

[0009] The present invention also provides a method for changing corn plant height and / or pollen shedding and silking interval, characterized in that it comprises any of the following:

[0010] (1) using genetic engineering means to modify the sequence of the maize genome region shown in SEQ ID NO.1 in a targeted manner, and selecting maize plants with altered plant height and / or pollen shedding and silking interval;

[0011] (2) Inserting the expression cassette containing the above gene into the maize genome, and selecting maize plants with altered plant height and / or pollen shedding and silking interval.

[0012] In some embodiments, the above-mentioned genetic engineering means adopts CRISPR / Cas9 gene editing method.

[0013] The present invention also provides a kit for changing the plant height and / or the interval between powder shedding and silking of corn, characterized in that it comprises any one of the following:

[0014] (1) RNA molecules capable of simultaneously recognizing target sequences shown in SEQ ID NO.5 to SEQ ID NO.8;

[0015] (2) a DNA molecule encoding the RNA described in (1);

[0016] (3) A vector for expressing the RNA described in (1).

[0017] In some embodiments, the above-mentioned kit further includes a Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.

[0018] In some embodiments, the above RNA molecule is a combination of sequences shown in SEQ ID NO.9 to SEQ ID NO.12.

[0019] The present invention also provides the use of the above expression box, method or kit in changing the plant height and / or the pollen shedding and silking interval of corn.

[0020] The present invention also provides the use of the nucleic acid molecule with the sequence shown in SEQ ID NO.13 or SEQ ID NO.18 or SEQ ID NO.23 in reducing the height of corn plants.

[0021] The present invention also provides the use of a nucleic acid molecule having a sequence shown in any one of SEQ ID NO.16 or SEQ ID NO.19 to SEQ ID NO.22 in increasing the height of corn plants.

[0022] The present invention also provides the use of the nucleic acid molecule with the sequence shown in SEQ ID NO.13 or SEQ ID NO.17 or SEQ ID NO.19 or SEQ ID NO.20 or SEQ ID NO.23 in increasing the interval between corn powder shedding and silking.

[0023] The present invention also provides the use of the nucleic acid molecule with the sequence shown in SEQ ID NO.16 or SEQ ID NO.22 in shortening the interval between corn powder shedding and silking.

[0024] The advantages and beneficial effects of the present invention are as follows: The present invention obtains corn materials with changed plant height and / or pollen shedding and silking interval by editing the promoter of the ZmGA2ox2 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Vector element information for overexpression and knockout of ZmGA2ox2 gene. A: Schematic diagram of T-DNA region elements of overexpression vector. B: Schematic diagram of T-DNA region elements of gene editing knockout vector. C: Target position and sequence of knockout vector. D: Mutation of gene after editing.

[0026] Figure 2 Plant height performance of maize with overexpression and knockout of ZmGA2ox2 gene in the field. WT: wild-type maize; KO: knockout maize; OE: overexpression maize.

[0027] Figure 3 Design and results of promoter editing. A: T-DNA region element structure of gene editing vector; B: promoter target site location and sequence (including PAM) of target gene; C: promoter mutation type.

[0028] Figure 4 Plant height and flowering status of promoter-edited materials. DETAILED DESCRIPTION

[0029] The following definitions and methods are provided to better define this application and guide those of ordinary skill in the art in the practice of this application. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the relevant field. All patent documents, academic papers, industry standards and other public publications cited herein are incorporated herein by reference in their entirety.

[0030] As used herein, "corn" is any corn plant and includes all plant varieties that can be bred with corn, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in an amino to carboxyl direction. Amino acids can be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that limit the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" is used in the context of a specific nucleic acid to refer to the nucleic acid containing the necessary information for directing the translation of the nucleotide sequence into a specific protein. Codons are used to represent information for encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence with a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may include known analogs of a natural amino acid that may function in a manner similar to that of a naturally occurring amino acid.

[0031] As used herein, the terms "isolated" and "purified" are used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free of components that normally accompany or react with the nucleic acid or polypeptide as found in the environment in which it naturally occurs. Thus, an isolated or purified nucleic acid or polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as protein-encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may contain less than about 0.5 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0032] In this application, the words "comprise", "comprising" or their variants are to be understood as including other elements, numbers or steps in addition to the described elements, numbers or steps. "Test plant" or "test plant cell" refers to a plant or plant cell in which a genetic modification has been effected, or a progeny cell of a plant or cell so modified, which progeny cell comprises the modification. "Control" or "control plant" or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells can include, for example: (a) wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically modified starting material that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an empty construct (i.e., a construct with no known effect on the trait of interest, such as a construct comprising a marker gene); (c) plants or plant cells that are non-transformed segregants of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but have not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the test plant or plant cell itself, which is under conditions where the gene of interest is not expressed.

[0033] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0034] In some embodiments, the nucleotide sequence of the present application can be changed to perform conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequence of the present application can be replaced without changing the amino acid sequence according to the disclosed monocot codon preference, for example, the codons encoding the same amino acid sequence can be replaced with codons preferred by monocot plants without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiment due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in the present application is replaced according to monocot plant preference codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituent. Exemplary amino acid substitution groups with various aforementioned properties considered are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, and the other corresponding nucleotide sequences are present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or a cDNA library) from a selected organism.

[0035] In some embodiments, a fragment of a nucleotide sequence and an amino acid sequence encoded therein is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of the polynucleotide of the embodiment or a portion of the amino acid sequence of the polypeptide. The fragment of the nucleotide sequence can encode a protein fragment, and the protein fragment retains the biological activity of the natural or corresponding full-length protein, and thus has protein activity. Mutant proteins include biologically active fragments of natural proteins, which contain continuous amino acid residues that retain the biological activity of natural proteins. Some embodiments also include transformed plant cells or transgenic plants, which include the nucleotide sequence of at least one embodiment. In some embodiments, an expression vector is used to transform a plant, and the expression vector includes the nucleotide sequence of at least one embodiment and a promoter that drives expression in a plant cell operably connected thereto. Transformed plant cells and transgenic plants represent plant cells or plants that contain heterologous polynucleotides in the genome. In general, the heterologous polynucleotides are stably integrated in the genome of the transformed plant cell or transgenic plant, so that the polynucleotides are passed to offspring. The heterologous polynucleotides can be integrated into the genome individually or as part of an expression vector. In some embodiments, the plants involved in the present application include plant cells, plant protoplasts, plant cell tissue cultures that can regenerate plants, plant calli, plant masses and plant cells, which are complete plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, spikes, cobs, shells, stalks, roots, root tips, anthers, etc. The present application also includes plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or their progeny, and thus at least partially comprising the nucleotide sequences of the present application.

[0036] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the inventive method, step or condition, all belong to the scope of the present application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions of the manufacturer's instructions. If not otherwise specified, the chemical reagents used in the embodiments are conventional commercial reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0037] Example

[0038] Example 1 Effects of overexpression and knockout of ZmGA2ox2 gene on maize phenotype

[0039] In order to clarify whether the ZmGA2ox2 gene (gene number Zm00001d002999) is related to the plant height trait of maize, the inventors first used conventional overexpression and gene editing knockout techniques to overexpress and knockout the ZmGA2ox2 gene in the maize inbred line KN5585. The overexpression used the ubi promoter to drive the gene CDS sequence. The gene knockout used three sgRNAs to knock out the gene simultaneously (see the schematic diagram of the vector T-DNA for overexpression and gene editing). Figure 1 ). After obtaining overexpression and edited corn materials, the plant height and ear height traits were investigated. The results showed that the overexpression corn materials were extremely dwarfed and did not produce fruit, with plant height reduced by 52.53% and ear height reduced by 57.43%. The plant height and ear height of gene-edited corn increased significantly, with plant height increased by 4.71% and ear height increased by 7.97% ( Figure 2 ).

[0040] The above results indicate that the ZmGA2ox2 gene has the function of regulating corn plant height, but direct overexpression and knockout cannot produce corn materials with industrial application value.

[0041] Example 2 Editing the ZmGA2ox2 promoter to fine-tune the plant height trait of maize

[0042] The ZmGA2ox2 gene is related to the plant height trait of corn. The inventor intends to edit the ZmGA2ox2 promoter to achieve the effect of fine-tuning the plant height of corn. The ZmGA2ox2 promoter sequence is shown in SEQ ID NO.1, the genomic sequence of the gene region is shown in SEQ ID NO.4, the encoded amino acid sequence is shown in SEQ ID NO.2, and the terminator sequence is shown in SEQ ID NO.3.

[0043] Four gene editing targets were designed for the promoter sequence: AGACAGTTATGCGCTTTGTG (SEQ ID NO.5), CCTATCGGCCTGACGCACAA (SEQ ID NO.6), CAGGGGTTCGTGCATAGGCG (SEQ ID NO.7) and TCCTACATAAAACTGTAGAA (SEQ ID NO.8). A gene editing vector was constructed and transformed into the maize inbred line KN5585 to obtain ZmGA2ox2 promoter-edited maize materials. A total of 11 promoter editing types were obtained by sequencing ( Figure 3 ). The edited promoters are shown in SEQ ID NO.13 to SEQ ID NO.23.

[0044] The results of the two-year field plant height survey showed that compared with the wild-type control, the plant heights of mutants 14#, 21#, and 50# were significantly reduced, the plant heights of mutants 19#, 24#, 27#, 38#, and 49# were significantly increased, and there was no significant difference in the plant heights of mutants 16#, 18#, and 20#. In addition, compared with the wild-type control, the pollen shedding and silking interval (ASI value) of mutants 14#, 20#, 24#, 27#, and 50# increased significantly, and the ASI values ​​of 19# and 49# were significantly shortened.

[0045] Table 1 Plant height data of mutant corn materials (unit: cm)

[0046]

[0047]

[0048] Table 2 ASI of mutant corn materials (unit: day)

[0049]

[0050] It can be seen that the promoter mutation of the GA2ox2 gene can regulate the plant height and the interval between pollen shedding and silking in corn.

[0051] By editing the gene promoter and obtaining mutants of different editing types, the height of corn plants can be regulated, with a range of -20% to 20%. In addition, mutations in the GA2ox2 gene promoter can regulate the interval between corn pollen shedding and silking.

[0052] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A nucleic acid molecule, characterized in that: The nucleic acid molecule sequence is shown in any one of SEQ ID NO.13 or SEQ ID NO.16 to SEQ ID NO.

23.

2. An expression cassette, characterized in that: It is formed by sequentially connecting the nucleic acid molecule according to claim 1, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2, and the terminator of the sequence shown in SEQ ID NO.3; Optionally, the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.

4.

3. A method for changing corn plant height and / or pollen shedding and silking interval, characterized in that: Includes any of the following: (1) using genetic engineering means to modify the sequence of the maize genome region shown in SEQ ID NO.1 in a targeted manner, and selecting maize plants with altered plant height and / or pollen shedding and silking interval; (2) Inserting the expression cassette of claim 2 into the corn genome, and selecting corn plants with altered plant height and / or pollen shedding and silking interval.

4. The method according to claim 3, characterized in that: The genetic engineering method adopts the CRISPR / Cas9 gene editing method.

5. A kit for changing corn plant height and / or pollen shedding and silking interval, characterized in that: Includes any of the following: (1) RNA molecules capable of simultaneously recognizing target sequences shown in SEQ ID NO.5 to SEQ ID NO.8; (2) a DNA molecule encoding the RNA described in (1); (3) a vector for expressing the RNA described in (1); Optionally, the kit further comprises a Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein. Optionally, the RNA molecule is a combination of sequences shown in SEQ ID NO.9 to SEQ ID NO.

12.

6. Use of the expression cassette of claim 2, or the method of any one of claims 3 to 4, or the kit of claim 5 in changing the plant height and / or the pollen shedding and silking interval of corn.

7. Application of nucleic acid molecules with sequences shown in SEQ ID NO.13, SEQ ID NO.18 or SEQ ID NO.23 in reducing the height of corn plants.

8. Use of a nucleic acid molecule having a sequence shown in SEQ ID NO.16 or any one of SEQ ID NO.19 to SEQ ID NO.22 in increasing the height of corn plants.

9. Use of the nucleic acid molecule of the sequence shown in SEQ ID NO.13 or SEQ ID NO.17 or SEQ ID NO.19 or SEQ ID NO.20 or SEQ ID NO.23 in increasing the interval between corn powder shedding and silking.

10. Use of the nucleic acid molecule with the sequence shown in SEQ ID NO.16 or SEQ ID NO.22 in shortening the interval between corn powder shedding and silking.

Images