Gene for increasing gaba content in apple and snp molecular marker and application thereof

Abstract

This invention belongs to the field of apple molecular genetics and breeding technology, and specifically relates to a gene that increases GABA content in apples, its SNP molecular marker, and its application. This invention, for the first time, utilizes GWAS analysis to identify the GABA-related regulatory gene MdHVA22g in apple fruit. The gDNA sequence of this gene is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2. A corresponding SNP molecular marker was developed by associating the SNP with position 678 of the gene's gDNA, with polymorphisms of A or C. Apples with a homozygous AA genotype at this site have higher GABA content than apples with homozygous CC and heterozygous AC genotypes. Furthermore, this invention utilizes this SNP to design dCAPS primers, which can effectively and rapidly distinguish the GABA content of apples from different germplasms, facilitating the breeding of high-GABA apple varieties.

Description

Technical Field

[0001] This invention belongs to the field of apple molecular genetics breeding technology, and in particular relates to a gene that increases the GABA content of apples, its SNP molecular markers, and their applications. Background Technology

[0002] Apples are a globally popular fruit favored by consumers. In recent years, with rapid economic development, consumers have shifted their focus from merely on the appearance of apples to paying more attention to their nutritional value. As a beloved "health fruit," apples are rich in various nutrients. The proverb "An apple a day keeps the doctor away" highlights the important role of apple nutrients in human health. The abundant soluble sugars, organic acids, vitamins, amino acids, and minerals in apples all contribute to their nutritional quality. Free amino acids not only participate in the synthesis of proteins and volatile flavor compounds but also play a crucial role in plant growth and development.

[0003] Gamma-aminobutyric acid (GABA) is a four-carbon non-protein amino acid widely found in living organisms and an important nutrient with pharmacological properties. Clinical studies have shown that GABA has effects such as lowering blood pressure, sedation, diuresis, anti-cancer properties, and lowering blood sugar; adding GABA to food is beneficial to human health. Currently, CRISPR / Cas9 gene-edited tomatoes, marketed by Sanatech Seed, have a GABA content 4-5 times higher than ordinary tomatoes and have been proven to have therapeutic effects in lowering blood pressure and promoting relaxation. Apples have abundant germplasm resources, and the GABA content varies considerably among different apple varieties. However, research on the GABA content in apples is limited. Furthermore, previous studies have found that tomatoes contain abundant GABA, accounting for 50% of the total free amino acid content during the green ripening stage. Compared to tomatoes, apples have a relatively low GABA content, which cannot meet the human body's daily GABA requirement. Therefore, creating new apple varieties with high GABA content can fill the market gap caused by the low GABA content in currently cultivated apples. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a gene that increases the GABA content in apples, its SNP molecular marker, and its application.

[0005] In a first aspect, the present invention provides the application of the MdHVA22g gene in increasing the GABA content of apples, wherein the gDNA sequence of the MdHVA22g gene is shown in SEQ ID NO.1 and the CDS sequence is shown in SEQ ID NO.2.

[0006] This invention utilizes transgenic methods to overexpress MdHVA22g in apple callus tissue to verify its function. The results show that the GABA content of transgenic callus tissue is significantly increased compared to wild-type callus tissue. The GABA content of two transgenic apple callus lines, MdHVA22g OE#1 and MdHVA22g OE#2, is increased by 2.1 times and 2 times, respectively, compared to wild-type callus tissue. These results lay the foundation for creating new apple varieties with high GABA content.

[0007] Secondly, the present invention provides an SNP molecular marker for detecting GABA content in apple fruit. The SNP molecular marker is located at positions 487 to 704 of the gDNA of the MdHVA22g gene, and the SNP site is located at position 678 of the gDNA of the MdHVA22g gene. The base mutation at the SNP site is: base A is mutated to base C.

[0008] Apples are perennial woody plants characterized by long juvenile periods, self-incompatibility, and complex genetic backgrounds. Traditional hybridization breeding methods severely restrict apple genetic breeding and the selection of new varieties. Molecular marker-assisted selection (MMR) involves analyzing the genotypes of molecular markers closely linked to target genes, and then selecting for the target trait genotype using these markers. MMR-assisted breeding shortens the breeding cycle, accelerates the breeding process, improves breeding efficiency, and overcomes many difficulties encountered in conventional breeding methods. Therefore, identifying molecular markers related to GABA content in apple fruits can quickly identify germplasm resources with high GABA content, providing a reference for selecting apple varieties with high GABA content.

[0009] The SNP molecular markers provided by this invention can effectively identify the GABA content in apple fruits, which is of great significance for shortening the breeding cycle of apple varieties with high GABA content.

[0010] Thirdly, the present invention provides the application of the SNP molecular marker in identifying the GABA content trait of apple fruit, wherein apples with homozygous AA genotype at the SNP site have higher GABA content than apples with homozygous CC and heterozygous AC genotypes at the SNP site.

[0011] Fourthly, the present invention provides a dCAPS primer for detecting the SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.11-12.

[0012] Fifthly, the present invention provides applications of the dCAPS primers, wherein the dCAPS primers are used to identify apple genotypes and / or apple fruit GABA content traits.

[0013] Furthermore, the specific application is as follows: using the genomic DNA of the apple to be identified as a template, amplification is performed using the dCAPS primers. The amplified products are digested with ScrFI. If the amplified product of apple A cannot be digested by the enzyme, the genotype at position 678 of the MdHVA22g gene gDNA is homozygous AA, and the apple fruit has a high GABA content. If some of the amplified products of apple B can be digested by the enzyme, the genotype at position 678 of the MdHVA22g gene gDNA is heterozygous AC, and the apple fruit has a lower GABA content than apple A. If all the amplified products of apple C can be digested by the enzyme, the genotype at position 678 of the MdHVA22g gene gDNA is homozygous CC, and the apple fruit has a lower GABA content than apple B.

[0014] Furthermore, each 25 μL enzyme digestion reaction system consists of: 1 μg amplification product, 0.5 mL ScrFI, 5 μL CutSmart buffer, and the remainder is H2O.

[0015] Furthermore, the enzyme digestion reaction procedure is as follows: 37°C, 12h.

[0016] Sixthly, the present invention provides the application of the MdHVA22g gene, the SNP molecular marker, or the dCAPS primer in the breeding of apples with high GABA content.

[0017] The present invention has the following beneficial effects:

[0018] This invention identified a significantly associated SNP located in the MdHVA22g promoter region by performing GWAS analysis on the GABA content of 149 apple germplasm fruits. Subsequently, overexpressing apple callus material was obtained through transgenic methods, confirming that MdHVA22g participates in regulating fruit GABA content. Furthermore, this invention utilizes this SNP to design corresponding dCAPS primers, which can effectively and rapidly distinguish the GABA content of apple fruits from different germplasm sources, facilitating the breeding of high-GABA apple varieties. Attached Figure Description

[0019] Figure 1 The identification of the gene MdHVA22g related to GABA content in apple fruit, including:

[0020] a: The genomes of 149 apple germplasm resources were resequencing using the Illumina HiSeq 4000 sequencing platform, and the GABA content of the fruits of these 149 apple germplasm resources was measured. Combined with the genome-wide association analysis of apple fruit GABA content, a gene MdHVA22g that is significantly associated with apple fruit GABA content was found.

[0021] b: Schematic diagram of the quantile-quantile relationship of GABA content GWAS in apple fruit.

[0022] Figure 2 This is a schematic diagram of the quantile-quantile relationship of GABA content GWAS in apple fruit.

[0023] Figure 3 MdHVA22g positively regulates the GABA content in apple callus, of which:

[0024] a: Identification of MdHVA22g transgenic callus DNA levels.

[0025] b: Identification of MdHVA22g transgenic callus RNA levels.

[0026] c: Determination of GABA content in apple callus tissue.

[0027] Figure 4 Application of dCAPS primers for GABA content in apple fruit.

[0028] a: Verification of molecular markers for GABA content in different apple germplasms. Lane M is the marker band, and lanes 1 to 30 correspond to apple germplasms numbered 1 to 30 in Table 6.

[0029] b: GABA content in apple germplasm of different genotypes. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0031] The primer sequence information involved in the following embodiments is shown in Table 1:

[0032] Table 1 Primer sequence information

[0033]

[0034] Example 1: Genome-wide association analysis identifies candidate genes related to GABA content in apple fruit.

[0035] This invention performed whole-genome sequencing on 149 apple germplasm resources and collected mature fruits from the corresponding apple germplasms. Free amino acids were extracted, and GABA content was determined using high-performance liquid chromatography-tandem mass spectrometry (LC-MS). The results showed significant differences in GABA content among different apple germplasms, with the highest GABA content at 2427.45 μg / g and the lowest at 31.7 μg / g. The GABA content of apple fruits from different germplasms followed a normal distribution. Based on resequencing data, genome-wide association analysis (GWAS) was performed on GABA content. Preliminary screening revealed that candidate genes significantly associated with GABA content were mainly concentrated on chromosome 14. The key gene MdHVA22g, associated with fruit GABA content, was linked and cloned. The gDNA sequence of MdHVA22g is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2.

[0036] Figure 1 In our study, GWAS association analysis identified the candidate gene MdHVA22g on chromosome 14. We found a significantly associated SNP near the promoter of the MdHVA22g gene, located at position 678 of the MdHVA22g gene gDNA. The base mutation at this SNP site was a change from base A to base C. Haplotype analysis of this SNP site showed that apple germplasm with the A / A genotype had the highest GABA content, apple germplasm with the A / C genotype had a moderate GABA content, and apple germplasm with the C / C genotype had the lowest GABA content. Figure 2 ).

[0037] SEQ ID NO.1: GTTAACCAATCTAGAAAAAATGATATGTTTTATACAAAT GAAATGGTGGGGCTATAAAGATAATATAACCAGTATATTAAAACGTCCGATCAGTTTGACAATCAAATTTAATGTAGGATCTCTATTGTCAAAAGAAAAGATAGACCCCAGATATATGTAAGTTATCTTCCTCTCGTTAGTGTGGGATCATTGACCCAAGGCTTGGAGTGGGGGAGCATTTTGCTGTAAACTTGTGATGCGGCGTGGATGTGACTAGTTCAAAGATAGTATTAGTTTGTAGTCACGTTTTCAGTTTAGTCTTATAGTGTTTCACGTTTAAAAAGATAGGTCAACCAAATGTTAAATGTCAAATACACCC TTGTTCCATCTGATTTTTTAAAGTCATTTGTCTGTCAGCTTCACTTTTGTTGTTTTGTTTTTTATCTTGTCTCTCGCTATTTTGTTTATTTGCAGTATTTAGTTCTTTAATATTTTTTTTTTAAAAAAGAACGAGTTGTGTCTCAACCTCCTTAGTCAATCATCGTGTAATTCAACAACGTTATAAATTAAATTTAAACAGTATCATATAAAAATCTCTACATTTTTTTTCTTAACTTTTTATCACAATGTATATATCTGTGTCAATAACCACTATATGAAGATGCATTTTTTTATGATTAAAACTGTTATGTTTATAAATA M

[0038] SEQ ID NO.2: ATGTTGGGAAGCTTGCTAACCAGAATTCTTATATTGTTTCTTGGGTATGCATACCCAGCATTTGAGTGCTACAAAACAGTGGAGAAGAACAGAGTTGAGATTGAAGAACTCCGGTTTTGGTGTCAATACTGGATAATTGTGGCAATGCTCACAGTTCTTGAGAGGGCTGGAGATGTATTCATCTCATGGTTGCCCATGTATGGTGAAGGGAAGGTGGCCCTTTTTATATACCTATGGTGTCCAAAGACCAAGGGAACTTTCTTTGTGTACAAGACCTTCCTGAGGCCATATGTAGCAAAGCATGAGACAGACATAGACAGGAAGTTGCTGGAGATGAGAGCAAGAGCCTGGGATTTGACGGTACTCTACTGGCAGAACTTCGCCCAATATGGCCACGCTGCTTTCCTCCAAGCCCTTCGGTACATGGCTGCTAACTCCGCAAAGTTCGCCACCAAACCCACCACCGAGTCGCAGACAGTCGATGATGATCAGCAGGACACAGCAGCGCCGCTACGTAAACCGAGCGGGAAGAACAAGTGGCAGCCAGGATCCCCACCAGCAACACCAAATGGCAGAGCCACCACAGTCAACCGCGCCATGTCTGAGACTCCGAGGTCCCCCAAGGTGGTTCATCCCCGACATCAAACGGATGGTGGGCAGGTTGACGAGTTGACTGAGAAGCTCCGGCTCAGGCGTTCTAAGCCAATCCAGTGA。

[0039] Example 2: Verification of the gene function of MdHVA22g in apple callus

[0040] 1. Experimental method

[0041] 1.1 Gene cloning and construction of overexpression vector

[0042] Primers (SEQ ID NO. 3-4) for cloning the MdHVA22g gene were designed based on gene sequences from the National Center for Biotechnology Information (NCBI) database. The CDS sequence of the target gene was cloned by polymerase chain reaction (PCR) using *Crown Crown* cDNA as a template. The amplification system is shown in Table 2.

[0043] Table 2 PCR amplification system

[0044] reagents Usage PrimeSTAR Max Premix (2X) 25μL Forward Primer (10μM) 2μL Reverse Primer (10μM) 2μL cDNA 2μL <![CDATA[H2O]]> 19μL Total volume 50μL

[0045] Vector construction was completed using the Gateway vector construction system. First, the MdHVA22g gene fragment obtained by gene cloning was ligated into the intermediate vector pDONR222 via BP reaction (Table 3), and then introduced into the expression vector via LR reaction (Table 4).

[0046] Table 3 BP Reaction System

[0047]

[0048] Table 4 LR Reaction System

[0049]

[0050]

[0051] 1.2 Escherichia coli transformation

[0052] First, pre-chill the electroporation cuvette on ice. Dissolve *E. coli* bacteria stored at -80℃ on ice. Pipette 2 μL of the Gateway reaction product and mix it with the competent cells. Incubate on ice for 2 minutes. Wipe the electroporation cuvette clean with absorbent paper and perform electroporation at 1600V. Add 400 μL of LLB solution and incubate at 37℃ for 30 minutes. Spread 100 μL of the solution onto antibiotic-containing agar plates and incubate overnight at 37℃. Finally, select single clones for PCR positive screening.

[0053] 1.3 Agrobacterium-mediated transformation

[0054] First, pre-cool the electroporation cuvette on ice. Dissolve the Agrobacterium bacteria stored at -80℃ on ice. Pipette 2 μL of plasmid and mix it with the competent cells, then incubate on ice for 2 minutes. Wipe the electroporation cuvette clean with absorbent paper and perform transformation using an electroporation converter at 1600V. Add 400 μL of LB broth and incubate at 28℃ for 2 hours. Spread 100 μL of the solution onto antibiotic-containing agar plates and incubate at 28℃ for 2 days. Finally, pick single clones for PCR screening. The primer sequences used are shown in SEQ ID NO. 5–6.

[0055] 1.4 Genetic transformation of apple callus

[0056] Prepare apple callus tissue that has been stored for approximately 3 weeks. Resuspend Agrobacterium and adjust the OD value to 0.6-0.8. Add an appropriate amount of callus tissue to the resuspended Agrobacterium and shake on a shaker at room temperature for 30 minutes. Filter the solution with sterile gauze and blot dry with sterile absorbent paper. Place the callus tissue on a regular subculture medium and co-culture for 1-2 days. Afterward, transfer the culture to a callus medium containing antibiotics for selection.

[0057] 1.5 DNA Extraction

[0058] (1) Grind the frozen sample (transgenic callus material) thoroughly in liquid nitrogen. Transfer 0.1g of the material to a 2ml centrifuge tube, add 700μL CTAB buffer and 40μL β-mercaptoethanol, mix thoroughly, and incubate in a 65℃ water bath for 30min. (2) Remove the sample, cool to room temperature, and add an equal volume of DNA extraction buffer (phenol:chloroform:isoamyl alcohol = 24:1:1), mix thoroughly. Transfer to a 4℃ centrifuge and centrifuge at 12000rpm for 15min. (3) Take an appropriate amount of supernatant and place it in a 1.5ml centrifuge tube, add 2 volumes of anhydrous ethanol and 1 / 10 volume of 3M NaAC, mix well, and place at -20℃ overnight for sedimentation. (4) Transfer to a 4℃ centrifuge and centrifuge at 12000rpm for 15min. (5) Discard the supernatant, wash the precipitate once with 75% ethanol and once with 100% anhydrous ethanol, and place on the workbench until the anhydrous ethanol evaporates completely. (6) After the precipitate has dried, add 50 μL of ddH2O to dissolve it.

[0059] 1.6 RNA Extraction and cDNA Synthesis

[0060] (1) Grind the frozen sample thoroughly in liquid nitrogen. Transfer 0.1g of the material to a 2ml centrifuge tube, add 700μL of LTAB buffer and 40μL of β-mercaptoethanol, mix thoroughly, and incubate in a 65℃ water bath for 30min. (2) Remove the sample, cool to room temperature, and add an equal volume of RNA extraction buffer (phenol:chloroform:isoamyl alcohol = 24:1:1), mix thoroughly. Transfer to a 4℃ centrifuge and centrifuge at 12000rpm for 15min. (3) Take an appropriate amount of supernatant (about 600μL) and place it in a 1.5ml centrifuge tube, add an equal volume of RNA extraction buffer, and mix thoroughly. Transfer to a 4℃ centrifuge and centrifuge at 12000rpm for 15min. (4) Take an appropriate amount of supernatant (about 500μL) and place it in a 1.5ml centrifuge tube, add 2 volumes of anhydrous ethanol and 1 / 10 volume of 3M NaAC, mix well, and incubate at -20℃ overnight for sedimentation. (5) Transfer to a 4℃ centrifuge and centrifuge at 12000 rpm for 15 min. Discard the supernatant, add 300 μL of RNase-free water and mix well. At the same time, add 35 μL of DNase buffer and 12 μL of DNase I, and incubate at 37℃ for 30 min to completely remove genomic DNA. (6) Add 150 μL of RNase-free water and 500 μL of RNA extraction solution, mix well, and transfer to a 4℃ centrifuge and centrifuge at 12000 rpm for 15 min. (7) Take an appropriate amount of supernatant and place it in a 1.5 ml centrifuge tube. Add 2 volumes of anhydrous ethanol and 1 / 10 volume of 3M NaAC, mix well, and place at -20℃ overnight to settle. (8) Transfer to a 4℃ centrifuge and centrifuge at 12000 rpm for 15 min. Discard the supernatant, wash the precipitate once with 75% ethanol, and then wash once with 100% anhydrous ethanol. Place on the workbench until the anhydrous ethanol evaporates completely. (9) Dissolve in 30 μL of RNase-free water.

[0061] cDNA synthesis: cDNA synthesis was performed using the Thermo Fisher RevertAid reverse transcription kit. TM FirstStrandcDNASynthesis Kit.

[0062] 1.7 Determination of MdHVA22g gene expression

[0063] The expression level of MdHVA22g gene in callus tissue was determined by real-time PCR as shown in SEQ ID NO.7-8, with MdMDH gene as an internal reference. The primers are shown in SEQ ID NO.9-10.

[0064] 1.8 Determination of GABA content

[0065] Take 0.1g of fresh and lyophilized sample into a 2ml centrifuge tube, add 1mL of 50% ethanol aqueous solution (containing 0.1mol / L HCl), extract by sonication for 20min, centrifuge at 12000rpm / min for 15min at 4℃, take the supernatant and filter it through a 0.22μm organic filter, and finally dilute it 20 times with acetonitrile and place it in a chromatographic bottle.

[0066] 2 Experimental Results

[0067] This experiment used 'Wanglin' ​​fruit callus (WL) as background material. Through transgenic technology, we obtained two transgenic apple callus lines, MdHVA22g OE#1 and MdHVA22g OE#2, that overexpress MdHVA22g (OE). Transgenic identification was then performed at both the DNA and RNA levels. Figure 3 ab). The GABA content of calluses from WL, MdHVA22g OE#1, and MdHVA22g OE#2 cells grown for 20 days was determined by LC-MS. The results showed that the GABA content of the MdHVA22g OE#1 and MdHVA22g OE#2 transgenic calluses was 2.1 times and 2 times higher than that of the WL callus, respectively. Figure 3 c).

[0068] Example 3: Development and validation of dCAPS sub-markers for GABA content in apple fruit

[0069] dCAPS is a marker technique that uses primers to introduce mismatched bases to construct or remove restriction endonuclease recognition sites. Based on the SNPs associated with the promoter region of the MdHVA22g gene, this study designed corresponding dCAPS primers to distinguish apple germplasm of different genotypes. The nucleotide sequence of the dCAPS forward primer is shown in SEQ ID NO.11; the nucleotide sequence of the dCAPS reverse primer is shown in SEQ ID NO.12. Using the genomic DNA of the apple to be identified as a template, amplification was performed using the dCAPS forward and reverse primers. The amplification products were digested with ScrFI. The dCAPS restriction endonuclease reaction system is shown in Table 5, and the reaction program was 37℃ for 12 h.

[0070] Table 5. dCAPS restriction endonuclease reaction system

[0071] reagents Usage Amplification products 1μg ScrFI 0.5mL CutSmart buffer 5μL <![CDATA[H2O]]> to 25μL Total volume 25μL

[0072] In different apple germplasms, when the genotype is homozygous AA, the restriction endonuclease ScrFI cannot cleave the amplified fragment. Thirty apple germplasms were selected using molecular markers developed in this study for verification, and the results are as follows: Figure 4As shown in Table 6, bands 2, 5, and 26 are relatively high. When the genotype is heterozygous AC, the restriction endonuclease ScrFI can partially cleave the amplified fragment, resulting in two nucleic acid bands, such as 8, 15, and 18. When the genotype is homozygous CC, the restriction endonuclease ScrFI can completely cleave the amplified fragment, resulting in a relatively low nucleic acid band, such as 1, 3, and 4.

[0073] Thirty apple germplasms were selected for validation using the molecular markers developed in this study. Three germplasms were found to have the homozygous AA genotype, four to have the heterozygous AC genotype, and 23 to have the homozygous CC genotype. Validation of GABA content in the fruits of these 30 apple germplasms revealed that the homozygous AA genotype had the highest GABA content, followed by the heterozygous AC genotype, while the CC genotype had the lowest GABA content. Figure 4 b). Based on the above results, the SNPs in the MdHVA22g promoter region discovered in this study can effectively distinguish the GABA content of apple fruits from different germplasms. The dCAPS primers designed in this study can be used to achieve rapid identification of GABA content in apple fruits.

[0074] Table 6. Genotypes of 30 apple varieties and GABA content in fruit.

[0075]

[0076]

[0077] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0078] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. MdHVA22g The application of genes in increasing the GABA content of apples, characterized in that, The MdHVA22g The gDNA sequence of the gene is shown as SEQ ID NO. 1, and the CDS sequence is shown as SEQ ID NO.

2. By increasing the expression of the gene in apples, the GABA content of apples is increased. MdHVA22g The gDNA sequence of the gene is shown as SEQ ID NO. 1, and the CDS sequence is shown as SEQ ID NO.

2. By increasing the expression of the gene in apples, the GABA content of apples is increased.

2. Use of a SNP molecular marker in identifying the GABA content trait of apple fruit, characterized in that, The SNP molecular marker is as described in claim 1 MdHVA22g The SNP site is at position 487-704 of gDNA of the gene MdHVA22g The SNP site is at position 678 of gDNA of the gene, and the base mutation of the SNP site is that base A is mutated into base C; the apple with homozygous AA genotype of the SNP site has higher fruit GABA content than the apple with homozygous CC and heterozygous AC genotype of the SNP site.

3. Use of a dCAPS primer in identifying GABA content traits in apple fruit, characterized in that, The nucleotide sequences of the primers are shown as SEQ ID NO. 11~12, the primers are the primers for detecting the SNP molecular marker in claim 2, and the application comprises: Using the identified apple genomic DNA as a template, the dCAPS primer is used for amplification, and the amplified product is subjected to enzyme cutting with ScrFI. If the amplified product of apple A cannot be cut, then MdHVA22g the genotype of the gene gDNA at the 678th position is homozygous AA, and the GABA content of the apple fruit is high; if the part of the amplified product of apple B can be cut, then MdHVA22g the genotype of the gene gDNA at the 678th position is heterozygous AC, and the GABA content of the apple fruit is lower than that of apple A; if the whole amplified product of apple C can be cut, then MdHVA22g the genotype of the gene gDNA at the 678th position is homozygous CC, and the GABA content of the apple fruit is lower than that of apple B.

4. Use according to claim 3, characterized in that, The enzyme digestion reaction system is 1 μg of amplification product, 0.5 mL of ScrFI, 5 μL of CutSmart buffer, and the rest is H2O per 25 μL.

5. Use according to claim 4, characterized in that, The reaction procedure of the enzyme digestion is 37℃, 12h.

Images