Application of Citrus CsGGP2 Gene in Improving Citrus Canker Resistance and Resistance Breeding in Citrus

Abstract

The present invention discloses the application of the citrus CsGGP2 gene in improving resistance to citrus canker and breeding for resistance in citrus, belonging to the field of molecular breeding technology. The present invention discloses for the first time that significantly reducing the expression level of the citrus CsGGP2 gene can significantly improve citrus resistance to canker, and that the greater the degree of reduction in CsGGP2 gene expression, the stronger the citrus canker resistance. When the expression level is reduced to 2% of that of wild-type citrus, the lesion area is reduced to 53% of that of the wild-type. The reduction in the transcription level of the citrus CsGGP2 gene does not significantly affect the phenotype and development of the plant. The provided citrus CsGGP2 gene can be used as a candidate gene for studying resistance to citrus canker and can be used independently in molecular breeding for resistance to citrus canker or in combination with other resistance or susceptibility genes for molecular breeding of citrus canker resistance, thus having important application value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to the application of a citrus CsGGP2 gene in improving resistance to citrus canker and in citrus resistance breeding. Background Art

[0002] In recent years, my country's citrus industry has developed rapidly and has gradually become the main economic pillar of the southern mountainous areas, playing an important role in rural revitalization and ecological protection. However, the development of the citrus industry has been constrained by diseases such as citrus canker. Citrus canker is a bacterial disease caused by Xanthomonas citri subsp. Citri (Xcc), which harms most of the currently cultivated citrus varieties. It occurs in major citrus producing areas in my country, and the affected area has a trend of continuous expansion. Therefore, strengthening the prevention and control of citrus canker is of great significance to the industrial development of citrus.

[0003] While governments, producers, and researchers in citrus-producing regions around the world prioritize research on the prevention and control of citrus canker, the disease remains uncured due to its wide range of transmission pathways, rapid spread, and significant difficulty in prevention and control. Traditional prevention and control methods (such as burning diseased trees and using pesticides) require significant manpower and material resources and pose significant environmental risks. Therefore, the prevention and control of citrus canker relies primarily on cultivating new, disease-resistant germplasm. Generations of citrus farmers have engaged in long-term cross-breeding for disease resistance, but the long cycle of cross-breeding results in very low breeding efficiency.

[0004] Molecular breeding, which allows for the targeted and efficient cultivation of new disease-resistant germplasm, has rapidly developed and been widely applied. In recent years, biotechnology has yielded several citrus resources resistant to citrus canker, including Jincheng, Xinhuicheng, and Navelcheng lines transgenic for the antheraea persica antimicrobial peptide D gene; Wanjincheng lines overexpressing CsBZIP40; and plants with enhanced resistance to citrus canker obtained by site-directed gene editing of the promoter of the citrus canker-susceptible gene CsLOB1. However, high-quality candidate genes remain scarce, and their functions and mechanisms of action are poorly understood. This has hindered the development of molecular breeding for citrus canker resistance. Therefore, it is urgent to identify more genes closely associated with citrus canker and to analyze their functions and mechanisms for use in molecular breeding for canker resistance.

[0005] Research has shown that GDP-L-galactose phosphorylase (GGP) participates in ascorbic acid (AsA) biosynthesis and is a key node in the L-galactose pathway, catalyzing the conversion of GDP-L-galactose to L-galactose-1-phosphate. StGGP in potato can enhance resistance to dark stress by positively regulating AsA content, while CaGGP in pepper has a positive regulatory effect on salt stress. The GGP gene family in citrus is involved in responses to light, AsA biosynthesis, and plant growth and development. Summary of the Invention

[0006] The purpose of the present invention is to provide the application of the citrus CsGGP2 gene in improving citrus canker resistance and citrus resistance breeding, so as to provide a gene closely related to citrus canker resistance, provide a new candidate gene for citrus canker resistance breeding, and contribute to obtaining highly resistant citrus canker varieties and reducing environmental pollution caused by traditional prevention and control methods such as pesticides and incineration.

[0007] To achieve the above objectives, the present invention provides the use of the citrus CsGGP2 gene in improving resistance to citrus canker, reducing the expression level of the CsGGP2 gene and enhancing resistance to citrus canker; the CDS sequence of the CsGGP2 gene is shown in SEQ ID NO.1.

[0008] Preferably, the greater the degree of reduction in the expression level of the CsGGP2 gene, the stronger the resistance to citrus canker.

[0009] Preferably, RNAi interference is used to reduce the expression level of the CsGGP2 gene.

[0010] Preferably, the primers for amplifying the citrus RNAi interference fragment are CsGGP2-RNAi-F and CsGGP2-RNAi-R, the sequence of CsGGP2-RNAi-F is shown in SEQ ID NO.3, and the sequence of CsGGP2-RNAi-R is shown in SEQ ID NO.4.

[0011] Preferably, the PCR amplification program for amplifying the citrus RNAi interference fragment is: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C extension for 10 min. The system is prepared using the instructions attached to the high-fidelity enzyme.

[0012] As described above, the RNAi vector of the citrus CsGGP2 gene and the engineered bacteria are used to improve the resistance to citrus canker. The engineered bacteria are strains containing the citrus CsGGP2 gene RNAi vector for propagation or infection.

[0013] As mentioned above, the application of citrus CsGGP2 gene in the breeding of citrus canker-resistant varieties.

[0014] As mentioned above, the RNAi vector and engineered bacteria of the citrus CsGGP2 gene are used in the breeding of citrus canker-resistant varieties.

[0015] Therefore, the application of the citrus CsGGP2 gene provided by the present invention in improving citrus canker resistance and citrus resistance breeding has the following specific technical effects:

[0016] (1) The present invention discloses for the first time that significantly reducing the expression level of the citrus CsGGP2 gene can significantly improve the resistance of citrus to canker disease. The greater the reduction in the expression level of the CsGGP2 gene, the stronger the resistance of citrus to canker disease. When the expression level is reduced to 2% of that of wild-type citrus, the area of ​​lesions is reduced to 53% of that of wild-type citrus.

[0017] (2) The reduction of citrus CsGGP2 gene transcription level will not have a significant effect on the phenotype and development of the plant;

[0018] (3) The citrus CsGGP2 gene provided by the present invention can be used as a candidate gene for studying resistance to citrus canker. It can be used independently in molecular breeding for resistance to citrus canker, or it can be used together with other disease-resistant or disease-susceptible genes for molecular breeding of citrus canker resistance, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0020] Figure 1 This is a structural diagram of the CsGGP2 gene in Example 1 of the present invention;

[0021] Figure 2 This is an electrophoresis gel image of the PCR amplification of the RNAi fragment of the CsGGP2 gene in Example 2 of the present invention; wherein RNAi represents the RNAi fragment of the CsGGP2 encoding gene; M represents a DNA molecular weight standard;

[0022] Figure 3 Schematic diagram of the structure of the CsGGP2 interference vector in Example 3 of the present invention; wherein GUS:NPTII represents the β-glucosidase gene, and NOS represents the opine synthase gene terminator;

[0023] Figure 4 This is a schematic diagram of the genetic transformation process of citrus in Example 4 of the present invention;

[0024] Figure 5 The following is a photograph of the GUS staining results of the transgenic plants in Example 5 of the present invention; WT represents the wild-type control, and R-GGP1 and R-GGP2 represent different strains of transgenic plants;

[0025] Figure 6 This is a PCR electrophoresis gel image of some transgenic plants in Example 5 of the present invention, wherein WT is the wild-type control; R-GGP1 and R-GGP2 represent different transgenic lines; M represents a DNA molecular weight standard;

[0026] Figure 7 The results of the analysis of CsGGP2 expression in the transgenic plants in Example 5 of the present invention are shown; WT represents the wild-type control, R-GGP1 and R-GGP2 represent different strains of transgenic plants, * indicates a significant difference compared with the wild type (P=0.05); ** indicates an extremely significant difference compared with the WT (P=0.01);

[0027] Figure 8 The phenotype photographs of transgenic plants in Example 5 of the present invention are shown; WT represents the wild-type control, and R-GGP1 and R-GGP2 represent different strains of transgenic plants;

[0028] Figure 9 This is a photograph of the leaves of the transgenic plants in Example 6 of the present invention 10 days after inoculation with canker bacteria; WT represents the wild-type control, and R1 and R2 represent different strains of transgenic plants;

[0029] Figure 10 This is a statistical chart of the lesion size on the leaves of the transgenic plants in Example 6 of the present invention 10 days after inoculation with the canker pathogen; wherein WT represents the wild-type control, and R1 and R2 represent different strains of transgenic plants;

[0030] Figure 11 This is a statistical graph of the disease index of the transgenic plant leaves in Example 6 of the present invention 10 days after inoculation with canker bacteria; WT represents the wild-type control, and R-GGP-1 and R-GGP-2 represent different strains of transgenic plants. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0032] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0033] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.

[0034] It should be noted that the embodiments of the present invention use Wanjin orange as the test object. In practical applications, this method can also be used to improve the resistance of other citrus varieties to canker disease.

[0035] Example 1

[0036] Informatics analysis of the citrus CsGGP2 gene was performed as follows:

[0037] The CDS sequence of the citrus CsGGP2 gene is shown in SEQ ID NO. 1. The structure of the CsGGP2 gene was analyzed using InterPro software. Figure 1 As shown, the CsGG P2 gene was found to encode 455 amino acids and contain a GDP-L-galactose / GDP-D-glucose phosphorylase protein domain consisting of 402 amino acid residues.

[0038] SEQ ID NO.1:

[0039] ATGATGTTGAGGATCAAGAGGGTGCCCGACGGTTGTTTCGAATTATCAGAAAGA

[0040] GGAGACGGAGGAGGCTGCTGCTGCTGCTCGTCGTGTAAGCGGGTGCGGGAGG

[0041] AATTGCTTGAACAAATGTTGCATTCAAGGTGCAAAGCTTCCTTTATATGCTTTC

[0042] AAGAGGGTGAACAAGTTTAAAACTGAAATGGGTGTGCATGGACACGAGGTTA

[0043] GAGAGCCCGAGCCTCCCGTTGCATTTCTGGACTCGCTCGTTCTTGGGGAGTGG

[0044] GAGGACCGCGTACAGAGAGGACTATTTCGCTATGATGTTACTGCCTGTGAAAC

[0045] CAGGGTCATTCCTGGTCAGTATGGTTTCATTGCTCAACTGAACGAGGGCCGCC

[0046] ACCTGAAGAAAAGGCCTACTGAGTTCCGTGTTGATAAGGTCCTCCAGCCTTTT

[0047] GATGGGAACAAGTTCAACTTTACCAAAGTGGGGCAAGAAGAGGTGCTCTTCC

[0048] AGTTTGAGGCAAGCGAAGATGGTGAAGTCCAGTTTCACCCAAGTGCCCCCAT

[0049] TGATGTTGAGAATTCTCCAAGTGTTGTTGCCATCAATGTGAGTCCTATTGAGTA

[0050] CGGGCATGTGCTGTTGATCCCACGAGTTCTTGAGTGCTTGCCACAGAGGATTG

[0051] ACCGTGATAGCTTCTTGCTCGCACTTTACATGGCTGCAGAAGCTGGGAATCCAT

[0052] ACTTCAGGTTGGGTTACAACAGCTTGGGTGCATTTGCTACCATCAACCACCTT

[0053] CACTTCCAGGCTTACTACATGGCCTTGCCTTTTCCAATTGAGAAGGCTCCTACC

[0054] AAGAAGATAATCTCTACTGGCAGTGGTGTGAAGATCTCTGAGCTTTTAAACTAT

[0055] CCAGTCAGAGGCCTCGTCTTTGAAGGTGGAAACTCTCTGGAAGACTTATCCAA

[0056] CACAGTCTCGGATGCGTGCATTTGCCTTCAAGAGAACAACATTCCTTACAATG

[0057] TTTCATTGCTGATTGTGGAAAGCGCATATTTCTCTTACCACAGTGCTATGCTG

[0058] AGAAACAAGCTCTTGGGGAAGTGAGTTCAGAGCTTCTGGACACCCAAGTGAA

[0059] CCCTGCTGTGTGGGAGATTAGTGGGCATATGGTGTTAAAGAGGAAAGAAGGACT

[0060] ATGAAGAGGCATCCGAGGAAAATGCTTGGAGGCTGCTTGCCGAAGTCTCTCTC

[0061] TCTGAGGAGAGGTACCAAGAAGTAAATGCTCTCATCTTTGAAGCCATTGCGCG

[0062] TGGTGATGATGCCAATGGAGGTGTTGCTGAGAGCGTAATTGGGGAGGCAGATG

[0063] CGAAACCAAAGTCTGGCGGTGAAGTGGATGCAATTAATAAAAACTCTTGCCCT

[0064] GCCATGGTGTCGGGGACTCCAGAATGCCTGGTTCTTCAGTAA

[0065] Example 2

[0066] To clone the RNAi fragment in the CsGGP2 encoding gene, the specific steps are as follows:

[0067] 1) RNA extraction and cDNA synthesis from citrus.

[0068] Total RNA was extracted from citrus (Wanjincheng) leaves using a Plant Total RNA Extraction Kit (Adlai, Cat: RN09). RNA quality was verified by agarose gel electrophoresis, and concentration was measured using a concentration meter. High-quality RNA was selected and used to synthesize cDNA using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, Cat: RR036A) according to the system and protocol specified in the accompanying instructions. The resulting cDNA was stored at -20°C until use.

[0069] 2) Cloning and recovery of RNAi fragments targeting the CsGGP2 gene coding sequence.

[0070] Using primers CsGGP2-RNAi-F (sequence shown in SEQ ID NO. 3) and CsGGP2-RNAi-R (sequence shown in SEQ ID NO. 4), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), the citrus cDNA obtained in step 1) was used as a template. Following the instructions provided with the high-fidelity enzyme PrimeSTAR Max DNA Polymerase, a 282-bp RNAi fragment encoding the CsGGP2 gene was cloned. The sequence is shown in SEQ ID NO. 2. The PCR amplification program was as follows: 98°C for 5 min; 98°C for 30 s, 56°C for 30 s, and 72°C for 1.5 min for 35 cycles; and extension at 72°C for 10 min. The electrophoresis results of the amplified product are shown in Figure 2. Figure 2 Under ultraviolet light, cut the agarose gel containing the target fragment with a clean blade, and use the kit (BioFlux, CAT: BSC02M1) to recover the target DNA fragment according to the steps in the attached instructions.

[0071] SEQ ID NO.2:

[0072] CGGTTGTTTCGAATTATCAGAAAGAGGAGACGGAGGAGGCTGCTGCTGCTGC

[0073] TCGTCGTGTAAGCGGGTGCGGGAGGAATTGCTTGAACAAATGTTGCATTCAAG

[0074] GTGCAAAGCTTCCTTTATATGCTTTCAAGAGGGTGAACAAGTTTAAAACTGAA

[0075] ATGGGTGTGCATGGACACGAGGTTAGAGAGCCCGAGCCTCCCGTTGCATTTCT

[0076] GGACTCGCTCGTTCTTGGGGAGTGGGAGGACCGCGTACAGAGAGGACTATTT

[0077] CGCTATGATGTTACTGCCT

[0078] SEQ ID NO.3:

[0079] TCTAGAGGCGCCACGGTTGTTTCGAATTATCAGAAAGAGG

[0080] SEQ ID NO.4:

[0081] GGATCCATTTAAATAGGCAGTAACATCATAGCGAAATAGTCC

[0082] Example 3

[0083] The specific steps for constructing the CsGGP2 gene interference vector are as follows:

[0084] The PCR-recovered products of the RNAi fragment of the CsGGP2 encoding gene obtained in Example 2 were divided into two groups: the first group was double-digested with SwaⅠ and AscⅠ, and the second group was double-digested with BamHI and SalⅠ. The two groups of fragments recovered by enzyme digestion were ligated to the pUC-RNAi vector using the T4 DNA Ligase kit (Promega, CAT: M1801), and the ligation products were transformed into Escherichia coli DH5α.

[0085] The plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the intermediate vector pUC-RNAi-CsGGP2 containing the CsGGP2 interference fragment. The intermediate vector pUC-RNAi-CsGGP2 and the pLGNe vector were double-digested with KpnⅠ and SalⅠ, respectively. The digested product containing the RNAi fragment was ligated to the pLGNe vector to construct the final interference vector pLGNe-CsGGP2-RNAi. The vector structure is shown in FIG. Figure 3 shown.

[0086] Example 4

[0087] The CsGGP2 interference vector pLGNe-CsGGP2-RNAi obtained in Example 3 was Figure 4 The process shown is for genetic transformation of citrus, and the specific steps are as follows:

[0088] 1) Transform Agrobacterium tumefaciens with sGGP2 interference vector.

[0089] The constructed CsGGP2 interference vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The specific steps are as follows: pre-thaw the frozen competent cells EHA105 (50 μL) of Agrobacterium tumefaciens on ice; add 2 μL of the constructed CsGGP2 interference vector plasmid to the competent cells, pipette to mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the previously dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL LB liquid culture medium was transferred to an electric shock cup, pipetted and mixed, and then transferred to a sterile centrifuge tube. The culture was shaken at 260 rpm and 28°C for 60 min. The bacterial liquid was centrifuged at 10,000 rpm for 1 min, and the supernatant was discarded (leaving about 100 μL of resuspended bacteria). After resuspension, the culture was spread and incubated in the dark at 28°C for 2 days. After plaques grew, single colonies were verified by PCR using primers CsGGP2-RNAi-F (sequence shown in SEQ ID NO. 3) and CsGGP2-RNAi-R (sequence shown in SEQ ID NO. 4).

[0090] The PCR reaction conditions were as follows: 94°C for 3 min; 30 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and 72°C for 10 min.

[0091] 2) Take the epicotyls of citrus seedlings as explants.

[0092] Fresh citrus (Wanjin Orange) fruits were washed and surface-disinfected with 70% alcohol. The seeds were removed on a clean bench, the seed coats removed, and the seeds germinated on a seed germination medium. After incubation at 28°C in the dark for two weeks, the seeds were incubated under 16-hour light / 8-hour dark conditions for one week. The epicotyls of the germinated seedlings were cut into 1 cm segments on a clean bench for Agrobacterium tumefaciens-mediated genetic transformation.

[0093] 3) Prepare Agrobacterium tumefaciens infection solution.

[0094] Before transfection, streak the Agrobacterium (containing the pLGNe-CsGGP2-RNAi vector) onto LB solid medium supplemented with 50 mg / L kanamycin. Pick a single colony and inoculate it into 25 mL of LB liquid medium supplemented with 50 mg / L kanamycin. Cultivate the culture overnight at 28°C with shaking. Dilute the culture to an OD value of 0.1 and continue culturing to an OD value of 0.5. Centrifuge at 5000 rpm for 10 minutes, discard the supernatant, and resuspend the culture in MS liquid medium (pH 5.4) for transfection.

[0095] 4) Transforming the epicotyls of the citrus seedlings obtained in step 2).

[0096] The citrus epicotyl stem segments obtained in step 2) were soaked in the Agrobacterium suspension resuspended in MS liquid medium at pH 5.4 in step 3) for 13 minutes. After soaking, the segments were dried with sterile filter paper and transferred to co-cultivation medium and incubated in the dark at 26°C for 2 days. After co-cultivation, the epicotyls were transferred to screening medium on a clean bench and incubated in the dark at 28°C for 7 days. The epicotyls were then incubated at 28°C with a 16-hour light / 8-hour dark cycle. The cells were subcultured every two weeks using screening medium and then identified by GUS staining.

[0097] 5) Plantlet culture of transformants.

[0098] When the seedlings grow to more than 1 cm, they are cut and grafted onto Wanjin orange seedlings in sterile test tubes and cultured in seedling culture medium; when the seedlings grow to about 5 cm, they are grafted onto Citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0099] The culture medium components used in this example are as follows:

[0100] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0101] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0102] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0103] Seedling medium: MS + 30g / L sucrose, pH 5.8.

[0104] Example 5

[0105] Verification of transgenic plants is as follows:

[0106] 1) Identification of transgenic plants by GUS staining.

[0107] The leaves of the regenerated plants obtained in Example 4 were cut into leaf discs with a diameter of 7 mm and subjected to GUS histochemical staining for 24 h. The results were as follows: Figure 5 As shown, the leaf discs of positive plants showed blue edges, while the leaf discs of WT plants did not show color.

[0108] 2) PCR identification of transgenic plants.

[0109] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15). PCR was then performed to detect the integration of the RNAi fragment described in Example 2 into the citrus genome. The detection primers were ID-CsGGP2-F (sequence shown in SEQ ID NO. 5) and ID-CsGGP2-R (sequence shown in SEQ ID NO. 6). The obtained genomic DNA was used as a template. The PCR system was prepared according to the instructions for the high-fidelity enzyme PrimeSTARMax DNA Polymerase. The PCR reaction conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and 72°C for 10 min.

[0110] SEQ ID NO.5:TCGTTGAAGATGCCTCTGCCGACAG

[0111] SEQ ID NO.6:CGGTTGTTTCGAATTATCAGAAAGAGGAG

[0112] Some electrophoresis results are as follows Figure 6 As shown, a 500 bp amplified fragment could be obtained from the positive plants, while no amplification was obtained from the WT plants.

[0113] 3) qRT-PCR analysis of transgenic plants.

[0114] Total RNA was extracted from the leaves of transgenic plants (Aidelai, CAT No: RN09), and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsGGP 2-F (sequence shown in SEQ ID NO.7) and RT-CsGGP2-R (sequence shown in SEQ ID NO.8). The qRT-PCR reaction conditions were: 95℃ for 3min, 94℃ for 10s; 56℃ for 10s, 72℃ for 10s, 40 cycles; 72℃ for 10min. -△△Ct The relative expression of CsGGP2 gene in transgenic plants was calculated by defining the water-treated sample as the reference factor, i.e. its CsGGP2 expression level was 1, and then the fold expression of the gene in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is its relative expression level.

[0115] SEQ ID NO.7:GCCTCGTCTTTGAAGGTGGA

[0116] SEQ ID NO.8:TCTTGAAGGCAAATGCACGC

[0117] The results are as follows Figure 7 As shown, the expression of CsGGP2 gene in transgenic plants was significantly inhibited compared with that in wild-type plants (the lowest was 2% of that in wild-type plants).

[0118] 4) Phenotypic observation of transgenic plants.

[0119] Phenotypic photos of transgenic plants and wild-type plants are shown in Figure 8 As shown in the results, it was observed that the transgenic plants were shorter than the wild-type plants, and had no obvious abnormalities in appearance (stems and leaves), indicating that CsGGP2 interference had no significant effect on the phenotype and development of the plants.

[0120] Example 6

[0121] The resistance of transgenic plants was evaluated as follows:

[0122] Mature leaves of transgenic plants were taken, washed with clean water, and then disinfected with 75% alcohol. After rinsing with sterile water in a clean bench, the surface moisture of the leaves was dried with sterile filter paper. After that, a sterile needle was used to prick the leaf veins as the center, and a canker bacterial solution (the canker bacterial solution frozen in the laboratory was activated to OD = 0.5, centrifuged, and 100 μL of the supernatant was retained for resuspension at a concentration of 1×10 5 CFU / mL), with 1 μL spotted per pinhole. Leaves inoculated with the canker pathogen were incubated at 28°C in a constant-temperature, light-controlled incubator (16 hours light / 8 hours dark, 60% humidity). Mature leaves of wild-type plants grafted at the same time and treated identically served as controls. Five replicates were set up for each treatment. Photos were taken on the 10th day after the leaves were spotted. Photos of some leaves are shown below. Figure 9 As shown in Figure 2, Image J V1.47 software was used to count the areas of the 740 selected lesions. The statistical results are shown in Figure 2. Figure 10 shown.

[0123] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the area of ​​the lesions, grade 0 (R≤0.25mm 2 ), Level 1 (0.25mm 2 <R≤0.5mm 2 ), Level 2 (0.5mm 2 <R≤0.75mm 2 ), Level 3 (0.75mm 2 <R≤1mm 2 ), Level 4 (1.0mm 2 <R≤1.25mm 2 ), 5 levels (1.25mm 2 <R≤1.5mm 2 ), 6 levels (1.5mm2 <R≤1.75mm 2 ), 7 levels (R>1.75mm 2 ).

[0124] The disease index DI was calculated according to the following formula: Figure 11 shown.

[0125] DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0126] Depend on Figure 9 It can be seen that 10 days after inoculation with the canker bacteria, the leaves of the transgenic plants and the WT plants grafted at the same time were all diseased to varying degrees, and there were significant differences in the size of the lesions. According to statistics, the area of ​​lesions on the leaves of the transgenic plants ( Figure 10 ) and disease index ( Figure 11 ) were significantly smaller than the wild-type control, with the lesions reduced to 53% of the wild-type citrus leaves at most and the disease index being 67% of the wild-type.

[0127] It can be seen that the interference of CsGGP2 can greatly reduce the lesion area of ​​ulcer disease, alleviate the severity of ulcer disease, and significantly improve the resistance of citrus to ulcer disease.

[0128] Therefore, the present invention discloses for the first time that significantly reducing the expression level of the citrus CsGGP2 gene can significantly improve the resistance of citrus to canker disease, and the greater the degree of reduction in the expression level of the CsGGP2 gene, the stronger the resistance of citrus to canker disease. When the expression level is reduced to 2% of that of wild-type citrus, the lesion area is reduced to 53% of that of the wild type; the reduction in the transcription level of the citrus CsGGP2 gene will not have a significant effect on the phenotype and development of the plant; the provided citrus CsGGP2 gene can be used as a candidate gene for studying resistance to citrus canker disease, can be used independently in molecular breeding for resistance to citrus canker disease, and can also be used together with other disease-resistant or disease-susceptible genes in molecular breeding for citrus resistance to canker disease, and has important application value.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Citrus CsGGP2 The application of the gene in improving resistance to citrus canker is characterized by: reduce CsGGP2 The expression level of the gene increases the resistance to citrus canker; CsGGP2 The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. The citrus according to claim 1 CsGGP2 The application of the gene in improving resistance to citrus canker is characterized by: CsGGP2 The greater the degree of reduction in gene expression, the stronger the resistance to citrus canker.

3. The citrus according to claim 1 CsGGP2 The application of the gene in improving resistance to citrus canker is characterized by: RNAi interference method is used to reduce CsGGP2 Gene expression level.

4. The citrus according to claim 3 CsGGP2 The application of the gene in improving resistance to citrus canker is characterized by: The primers for amplifying the citrus RNAi interference fragment are CsGGP2-RNAi-F and CsGGP2-RNAi-R. The nucleotide sequence of CsGGP2-RNAi-F is shown in SEQ ID NO.3, and the nucleotide sequence of CsGGP2-RNAi-R is shown in SEQ ID NO.

4.

5. The citrus according to claim 3 CsGGP2 The application of the gene in improving resistance to citrus canker is characterized in that: The PCR amplification program for amplifying the citrus RNAi interference fragment was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min. The system was prepared using the instructions provided with the high-fidelity enzyme.

6. The citrus fruit as claimed in claim 1 CsGGP2 Application of an RNAi vector containing a gene or an engineered bacterium containing the vector in improving resistance to citrus canker.

7. Reduce the citrus as claimed in claim 1 CsGGP2 Application of gene expression in breeding citrus canker-resistant varieties.

8. The citrus fruit as claimed in claim 6 CsGGP2 Application of an RNAi vector containing a gene or an engineered bacterium containing the vector in the breeding of varieties resistant to citrus canker.

Images