Application of ampelopsis vaughaniana vaWRKY72 gene in plant cold resistance

Abstract

The application belongs to the field of molecular biology and genetic engineering technology, and particularly relates to application of Vitis amurensis VaWRKY72 gene in improving plant cold resistance. The application first finds that overexpression of the Vitis amurensis VaWRKY72 gene can regulate cold resistance of Arabidopsis and grape. Through overexpression of the Vitis amurensis VaWRKY72 gene in Arabidopsis and grape, it is found that the Vitis amurensis VaWRKY72 gene can reduce malondialdehyde content, reduce electrolyte permeability, increase proline content and activities of peroxidase, catalase and superoxide dismutase, remove excess ROS, and promote expression of cold stress related genes, thereby improving the tolerance of plants to low temperature stress.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic engineering technology, specifically relating to the application of the VaWRKY72 gene of wild grape in plant cold resistance. Background Technology

[0002] Wild grape (Vitis amurensis Rupr.) is considered the most cold-resistant germplasm resource among grape species, capable of withstanding extreme temperatures of -40℃ to -50℃. It is widely used as a parent in hybridization breeding, but traditional hybridization breeding processes are cumbersome and time-consuming. Currently, although cold-resistant grape varieties have been cultivated in China, neither their yield nor quality can meet the needs of the country's grape and wine industry. With the development of molecular biology, genetic engineering breeding has emerged as a new approach. Therefore, identifying cold-resistance-related genes in wild grape and exploring their functions and mechanisms of action has significant theoretical and practical value for improving the cold resistance of grape varieties.

[0003] Further research into grape cold tolerance revealed that the VaERF080 and VaERF087 genes enhance the cold tolerance of transgenic Arabidopsis thaliana by increasing antioxidant enzyme activity and regulating the expression of cold-induced genes. The VaERF092 gene, by binding to the GCC-box on the promoter of the VaWRKY33 gene, strengthens the plant's tolerance to cold stress. Therefore, further research is needed to discover new grape genes for improving plant cold tolerance. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention aims to clarify the application of the VaWRKY72 gene in promoting plant cold resistance, provide new applications for the VaWRKY72 gene, and offer a new way to improve the cold resistance of plants.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] The first aspect of this invention provides the application of the *VaWRKY72* gene from *Vitis vinifera* in plant cold resistance, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The plants mentioned include Arabidopsis thaliana and grapes.

[0008] The inventors cloned the VaWRKY72 gene from the wild grape variety 'Shuangyou' and analyzed its subcellular localization and transcriptional autoactivation activity, such as... Figure 2As shown, its cold-resistant effect in Arabidopsis was demonstrated through heterologous overexpression. Simultaneously, a transient transformation experiment was used to transfer it into 'Chardonnay' grapes to verify its cold-resistant function and whether it regulates the expression of grape-related genes, elucidating the mechanism of action of the *VaWRKY72* gene in grape low-temperature stress.

[0009] The full-length open reading frame sequence of the *VaWRKY72* gene from *Vitis thunbergii* is 1782 bp, encoding 593 amino acids.

[0010] A second aspect of the present invention provides a recombinant expression vector comprising the aforementioned *VaWRKY72* gene from *Vitis vinifera*.

[0011] In another preferred embodiment, the recombinant expression vector is obtained by inserting the VaWRKY72 gene between the Kpn I and BamHI sites of the pCAMBIA2300-GFP overexpression vector plasmid.

[0012] A third aspect of the present invention provides recombinant engineered bacteria comprising the recombinant expression vector.

[0013] In another preferred embodiment, the recombinant engineered bacteria is obtained by transforming the recombinant expression vector into Agrobacterium competent cells GV3101 (pSoup).

[0014] Engineered bacteria can be understood as those used by those skilled in the art in the process of transgenic research, such as Agrobacterium competent cells GV3101 (pSoup). However, with the development of technology, the selection of engineered bacteria may change, or the use of vectors and engineered bacteria may also be involved in non-transgenic application fields. But any application containing the gene or vector described in this invention is within the scope of protection of this invention.

[0015] The fourth aspect of this invention provides the application of the recombinant expression vector in the cultivation of cold-resistant transgenic plants, which have improved cold resistance compared to wild-type plants.

[0016] In another preferred embodiment, the plants include Arabidopsis thaliana and grapes.

[0017] The fifth aspect of this invention provides the application of the recombinant engineered bacteria in the cultivation of cold-resistant transgenic plants, which have improved cold resistance compared to wild-type plants.

[0018] In another preferred embodiment, the plants include Arabidopsis thaliana and grapes.

[0019] The fifth aspect of the present invention provides a method for improving the cold resistance of plants, comprising the step of overexpressing the VaWRKY72 gene of the wild grape in the plant;

[0020] The plants mentioned include Arabidopsis thaliana and grapes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This invention is the first to discover the role of overexpression of the *VaWRKY72* gene from *Vitis thaliana* in regulating cold tolerance in *Arabidopsis thaliana* and grape. Through overexpression of the *VaWRKY72* gene in *Arabidopsis thaliana* and grape, it was found that the *VaWRKY72* gene enhances the plant's tolerance to low-temperature stress by reducing malondialdehyde (MDA) content, decreasing electrolyte osmotic pressure, increasing proline content and the activities of peroxidase, catalase, and superoxide dismutase, scavenging excess ROS, and promoting the expression of cold stress-related genes. Attached Figure Description

[0023] Figure 1 The expression pattern and basic characteristics of the VaWRKY72 gene from *Vitis vinifera* are analyzed. a) Expression pattern of the VaWRKY72 gene in the stems, stalks, leaves, and inflorescences of *Vitis vinifera*; b) Expression analysis of the VaWRKY72 gene in response to low-temperature stress; c) Chromosomal location of the VaWRKY72 gene, with black lines representing introns, gray squares representing exons, and blue boxes indicating conserved WRKY domains; d) Phylogenetic analysis of VaWRKY72 and its homologs; e) Comparison of conserved domains of the VaWRKY72 gene and its homologs. One-way ANOVA was used (P < 0.05).

[0024] Figure 2 Subcellular localization and transcriptional autoactivation activity analysis of the VaWRKY72 gene from wild grape; a) Subcellular localization of the VaWRKY72 gene, scale bar = 10 μm; b) Transcriptional autoactivation activity analysis of the VaWRKY72 gene in yeast, pGBKT7-53+pGADT7-T is the positive control, pGBKT7-Lam+pGADT7-T is the negative control, and pGBKT7 DNA-BD is the empty pGBKT7 vector.

[0025] Figure 3 This study analyzed the low-temperature stress of Arabidopsis seedlings overexpressing the VaWRKY72 gene from *Vitis thaliana*. a–b represent root length analyses of wild-type (WT) and VaWRKY72 transgenic lines (OE#2, OE#3, and OE#5), respectively; c–d represent frost-resistant mortality analyses of wild-type (WT) and VaWRKY72 transgenic lines (OE#2, OE#3, and OE#5), respectively. One-way ANOVA was used (P<0.05), scale bar = 1 cm.

[0026] Figure 4The following graphs are used to evaluate the cold tolerance of Arabidopsis thaliana overexpressing the VaWRKY72 gene from *Vitis thaliana*: a) morphological changes in wild-type (WT) and transgenic Arabidopsis thaliana lines (OE#2, OE#3, and OE#5) before and 4 hours after treatment with -6℃ low-temperature stress; b) DAB staining; c) H2O2 content; d) electrolyte osmotic pressure; e) proline content; f) malondialdehyde (MDA) content; g) superoxide dismutase (SOD) activity; h) peroxidase (POD) activity; i) catalase (CAT) activity. One-way ANOVA was used (P < 0.05), scale bar = 1 cm.

[0027] Figure 5 The relative expression levels of cold stress-related genes in wild-type (WT) and transgenic Arabidopsis thaliana (OE#2, OE#3, and OE#5) under low-temperature stress are shown in the figure. a represents AtCBF1; b represents AtCBF2; c represents AtCBF3; d represents AtKIN1; e represents AtCOR47; and f represents AtRD29A. Arabidopsis thaliana AtActin2 (AT3G18780.1) was used as an internal reference gene. One-way ANOVA was used for analysis of variance (P<0.05).

[0028] Figure 6 Phenotypic observation and physiological and biochemical index analysis of 'Chardonnay' grapes transiently transformed with the VaWRKY72 gene after low-temperature stress treatment. a: Phenotypic observation of wild-type (WT) and transgenic lines (OE#2 and OE#3) before and after low-temperature stress; b: DAB staining diagram; c: H2O2 content diagram; d: Electrolyte osmotic rate diagram; e: Proline content diagram; f: Malondialdehyde (MDA) content diagram; g: Superoxide dismutase (SOD) activity diagram; h: Peroxidase (POD) activity diagram; i: Catalase (CAT) activity diagram. One-way ANOVA was used (P<0.05), scale bar = 1 cm.

[0029] Figure 7 The relative expression levels of cold stress-related genes in wild-type (WT) and transiently transformed 'Chardonnay' grapes (OE#2 and OE#3) under low-temperature stress are shown in the figure. a represents VvCBF1; b represents VvCBF2; c represents VvCBF3; d represents VvCBF4; e represents VvKIN2; and f represents VvCOR15. The grape VvActin1 (Vitvi04g01613.t01) was used as an internal reference gene, and one-way ANOVA was performed (P<0.05).

[0030] Figure 8 A diagram illustrating the mechanism by which the VaWRKY72 gene in *Vitis thaliana* enhances the cold resistance of *Arabidopsis thaliana* and *Chardonnay* grapes. Detailed Implementation

[0031] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0032] The inventors previously conducted comparative transcriptome analysis on cold-resistant wild grape variety 'Shuangyou' and the non-cold-resistant European grape variety 'Red Globe' at different stages after low-temperature treatment, obtaining the differentially expressed gene VaWRKY72 from wild grape. To further investigate the response of the VaWRKY72 gene to low temperature, the inventors analyzed the low-temperature response of the VaWRKY72 gene and its expression patterns in different tissues of wild grape using RT-qPCR. Figure 1 As shown, the results indicate that the VaWRKY72 gene of wild grapes significantly responds to low-temperature induction, reaching a peak expression level at 6 h, and exhibiting the highest expression level in the leaves of wild grapes.

[0033] This invention provides a new use for the VaWRKY72 gene of wild grape, hereinafter referred to as the 'Double Excellent' VaWRKY72 gene of wild grape, and the coding region sequence of the VaWRKY72 gene is shown in SEQ ID NO.1:

[0034]

[0035] The amino acid sequence encoded by this gene is shown in SEQ ID NO.2:

[0036] *

[0037] Example 1: Cloning of the VaWRKY72 gene of wild grape 'Shuangyou'.

[0038] This invention uses the 'Shuangyou' variety of wild grape as the experimental material, which was provided by the Grape Germplasm Resource Nursery of Northwest A&F University.

[0039] 1. Primer design

[0040] The designed primers and their nucleotide sequences are shown below:

[0041] GC-VaWRKY72-Kpn IF: GGTACC ATGGAGGCTGCTGCTTTGGAGATAC, as shown in SEQ ID NO.3;

[0042] GC-VaWRKY72-BamH IR: GGATCC TCACTGGATATTATCTTTGTGATC A, as shown in SEQ ID NO.4.

[0043] 2. RNA extraction

[0044] Using Omega Bio-Tek / The FFPE RNA Kit was used to extract total RNA from the experimental material. cDNA was then obtained by reverse transcription using the Evo M-MLV Reverse Transcription Premixed Kit (containing gDNA removal reagent for qPCR) Ver.2.

[0045] 3. Gene cloning

[0046] Using the obtained cDNA as a template, and employing primers GC-VaWRKY72-Kpn IF and GC-VaWRKY72-BamHI-R, the following was performed: PCR amplification using Max DNAPolymerase high-fidelity enzyme yielded the VaWRKY72 open reading frame sequence, which is 1782 bp in length and encodes 593 amino acids.

[0047] 4. Gel recovery and sequencing

[0048] Sequence analysis of VaWRKY72 was performed, such as... Figure 1 As shown, it was found to be located on chromosome 1 of the grape reference genome, with 5 exons, and its amino acid sequence showed 98.32% similarity to the grape reference genome. Furthermore, sequencing results showed that VaWRKY72 possesses a highly conserved WRKYGQK domain, containing a C2HC zinc finger structure belonging to the IIb subfamily. Phylogenetic analysis indicated that VaWRKY72 is most closely related to the Brazilian rubber tree.

[0049] The PCR amplification products were recovered from the gel and sequenced. The sequencing sequence is shown in SEQ ID NO.1.

[0050] The coding region sequence of the VaWRKY72 gene was found to be identical, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0051] Example 2: Construction of recombinant plant overexpression vector

[0052] according to Following the instructions of the IIOne Step Cloning Kit, a one-step cloning method was used to construct vectors, obtaining the recombinant vectors pCAMBIA2300-VaWRKY72-GFP and pGBKT7-VaWRKY72.

[0053] Example 3: Subcellular localization and transcriptional autoactivation activity analysis

[0054] Subcellular localization was performed using the PEG-mediated Arabidopsis protoplast transformation method. Fluorescence was observed using a laser scanning confocal microscope. The excitation wavelength for GFP was 488 nm, and for mCherry, it was 552 nm. Transcriptional autoactivation activity assays were performed according to Clontech's protocol. Follow the instructions in the Gold Yeast Two-Hybrid System User Manual (PT4084-1). Also follow the instructions in the Clontech Yeastmaker manual. TM The Yeast Transformation System 2 User Manual (PT1172-1) instructs you to transform the successfully constructed vector into Y2HGold yeast strain, plate it on SD / -Trp medium, and incubate it upside down at 30°C for 3–5 days. Pick a single colony and dilute it in 50 μL of ddH2O. Take 5 μL of the bacterial suspension and drop it onto SD / -Trp medium. SD / -Trp / X-α-Gal (40 μg / mL) -1 ) and SD / -Trp / X-α-Gal / AbA (200 ng / mL) -1 On culture medium. Incubate upside down at 30℃ for 3-5 days and observe growth. pGBKT7-53 and pGADT7-T were co-transformed as positive controls, and pGBKT7-Lam and pGADT7-T were co-transformed as negative controls.

[0055] like Figure 2 As shown in Figure a, after co-transforming Arabidopsis protoplasts with VaWRKY72-GFP and AtHY5-mCherry, green fluorescence was detected in the cell nucleus, overlapping with the red fluorescence of AtHY5, indicating that VaWRKY72 is localized in the cell nucleus. A full-length pGBKT7-VaWRKY72 bait vector was constructed and transformed into Y2HGold yeast strain. Compared with transformation with the empty pGBKT7 vector, the positive control, and the negative control, [the results were as follows]. Figure 2 As shown in b, the transformants of pGBKT7-VaWRKY72 were found to grow normally and show blue color on SD / -Trp / X-α-Gal medium, and also grew normally and showed blue color on SD / -Trp / X-α-Gal / AbA medium, with no significant difference in plaque size. This indicates that the full-length VaWRKY72 has transcriptional autoactivation activity in yeast.

[0056] Example 4: Obtaining the VaWRKY72 transgenic Arabidopsis thaliana line

[0057] The pCAMBIA2300-VaWRKY72-GFP overexpression vector was transformed into Arabidopsis thaliana using Agrobacterium-mediated inflorescence infection. Three transgenic lines (OE#2, OE#3, and OE#5) were obtained by resistance screening of T3 generation plants and identification by PCR, Western blot, and RT-qPCR for subsequent experimental analysis.

[0058] Example 5: Obtaining the VaWRKY72 transgenic grape line

[0059] Agrobacterium-mediated transient transformation of whole grape plants was used to transiently transfer 'Chardonnay' grapes. The specific procedure was as follows: Healthy 6-week-old 'Chardonnay' tissue culture seedlings were selected. A 5mL syringe was used to create an incision at the petiole of the seedling, and the pre-treated bacterial solution was slowly injected. The seedlings were sonicated for 2 minutes; a vacuum was applied at 0.8 MPa, with a 5-minute recovery period after each 20-minute treatment. The treated seedlings were then cultured in the dark in a culture room. After 12 hours, they were placed under light (growth temperature 23–24℃, relative humidity 55–65%, 16 hours light / 8 hours dark). Finally, two transgenic grape lines (OE#2 and OE#3) were screened using PCR and RT-qPCR analysis for further experimental analysis.

[0060] Example 6: Overexpression of VaWRKY72 improved the resistance of Arabidopsis thaliana to low temperature.

[0061] Through testing, wild-type (WT) and three transgenic lines with high transcriptional levels (OE#2, OE#3, and OE#5) were selected for low-temperature (4℃) and freezing tolerance (-20℃) tests. It was found that at 25℃, there was no significant difference in root length between wild-type and transgenic Arabidopsis lines. Figure 3 As shown in a and b in the figure. However, at 4°C, the roots of transgenic Arabidopsis seedlings were longer than those of the wild type.

[0062] In addition, such as Figure 3 In cases c and d, after wild-type and transgenic Arabidopsis were treated at -20℃ for 1 hour and recovered for 3 days, the lethality of the wild-type was 32.33%, while the lethality of the three transgenic lines was 9.66%, 5.61%, and 11.3%, respectively. Furthermore, 4-week-old wild-type and three overexpression lines were cold-acclimatized at 4℃ for 3 days, followed by cold treatment at -6℃. Before cold treatment, there was almost no phenotypic difference between the wild-type and transgenic lines. However, after cold treatment, the leaves of the wild-type showed low-temperature damage, while the leaves of the transgenic lines only showed slight wilting. After a 7-day recovery period at room temperature, almost all wild-type plants were observed to have died, while the transgenic Arabidopsis recovered their green color. Figure 4 As shown in 'a'.

[0063] To further investigate the cold-resistance effect of VaWRKY72 in transgenic Arabidopsis thaliana, DAB histochemical staining, physiological index content, and related enzyme activities were measured. Under suitable growth conditions, wild-type and transgenic Arabidopsis thaliana showed the same phenotype in DAB staining. However, after cold treatment, the wild-type showed deeper DAB staining and lower H2O2 content than the transgenic type. Figure 4 As shown in b and c. Before low-temperature stress treatment, the electrolyte osmotic rate, MDA and proline content, and the activities of SOD, POD and CAT enzymes were almost the same in all plants. However, after low-temperature stress treatment, the transgenic plants had lower electrolyte osmotic rate and MDA content than the wild type. Furthermore, the transgenic plants had significantly higher proline content and activities of SOD, POD and CAT than the wild type, as shown in b and c. Figure 4 As shown in d~i. In summary, overexpression of VaWRKY72 enhances the cold resistance of transgenic Arabidopsis thaliana.

[0064] Example 7: Overexpression of VaWRKY72 gene upregulates the expression of cold stress-related genes in Arabidopsis thaliana.

[0065] To further investigate the mechanism by which overexpression of the VaWRKY72 gene enhances the cold resistance of transgenic lines, the transcriptional levels of AtCBF1, AtCBF2, AtCBF3, and AtCOR47 in the CBF-dependent pathway, and AtRD29A and AtKIN1 in the ABA signaling pathway were analyzed under low-temperature stress. Results are as follows: Figure 5 As shown, the expression levels of the aforementioned cold stress-related genes in transgenic Arabidopsis thaliana were significantly higher than those in the wild type. AtCBF1, AtCBF2, and AtCBF3 showed a faster response to low-temperature stress, while AtKIN1, AtCOR47, and AtRD29A showed a relatively slower response. This indicates that the VaWRKY72 gene enhances the cold resistance of transgenic Arabidopsis thaliana by increasing the transcriptional levels of cold stress-related genes.

[0066] Example 8: Transient overexpression of the VaWRKY72 gene enhances the cold resistance of 'Chardonnay' grapes

[0067] Transgenic grape plants were screened using PCR and RT-qPCR. Wild-type plants with consistent growth and 'Chardonnay' grape plants (OE#2 and OE#3) overexpressing the VaWRKY72 gene were selected and acclimatized at 10℃ for 1 day, followed by cold treatment at -2℃ for 36 hours. Figure 6As shown in Figure a, before treatment, the wild-type and transgenic grape phenotypes were identical. After low-temperature stress treatment, both wild-type and transgenic grape plants showed some degree of wilting, but the leaves of grapes overexpressing the VaWRKY72 gene only showed mild wilting compared to the wild-type. Seven days after recovery, some leaves of both wild-type and transgenic grapes turned yellow and withered, but the damage was greater in the wild-type than in the transgenic grape plants.

[0068] like Figure 6 As shown in b and c, before low-temperature stress treatment, the DAB staining of wild-type and transgenic grapes was relatively consistent, and the H2O2 content showed no significant difference. After low-temperature stress treatment, the H2O2 content of both transgenic and wild-type grape lines increased, but the H2O2 content of transgenic Chardonnay was higher than that of the wild type. Electrolytic osmotic rate, proline, MDA, SOD, POD, and CAT activities were measured in grape leaves. Before low-temperature stress treatment, the electrolyte osmotic rate, MDA and proline content, and SOD, POD, and CAT enzyme activities were almost identical in all plants. After low-temperature stress treatment, compared with wild-type grape plants, grape plants overexpressing the VaWRKY72 gene had lower MDA content and electrolytic osmotic rate, but higher proline content and SOD, POD, and CAT activities. Figure 6 As shown in d~i, the above results indicate that transient overexpression of the VaWRKY72 gene can improve the cold resistance of Chardonnay grapes.

[0069] Example 9: Overexpression of the VaWRKY72 gene upregulates the expression of cold stress-related genes in 'Chardonnay' grapes

[0070] To further investigate the mechanism of action of the VaWRKY72 gene in grapes, the expression levels of cold stress-related genes (VvCBF1, VvCBF2, VvCBF3, VvCBF4, VvKIN2, and VvCOR15) were analyzed. The results are as follows: Figure 7 As shown, VvCBF1, VvCBF2, VvCBF3, and VvCBF4 play important roles in the early response of plants to low-temperature stress, while VvKIN2 and VvCOR15 are late-response genes. Therefore, the mechanism by which VaWRKY72 enhances the cold tolerance of Arabidopsis and 'Chardonnay' grapes is as follows: Figure 8 As shown.

[0071] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Clearly, those skilled in the art can make various alterations and variations to the invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of equivalents of the invention, the invention is also intended to include these modifications and variations.

Claims

1. Mountain grape VaWRKY72 The application of genes in plant cold resistance is characterized by, The wild grape VaWRKY72 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. By overexpressing the wild grape in the plant VaWRKY72 Genes were used to increase the transcriptional level of genes related to cold stress, thereby improving the cold resistance of transgenic plants; the plants were Arabidopsis thaliana and grape. The genes in Arabidopsis thaliana associated with cold stress are: AtCBF1 Gene, AtCBF2 Gene, AtCBF3 Gene, AtKIN1 Gene, AtCOR47 Genes and AtRD29A Gene; The genes in the grapes that are related to cold stress are: VvCBF1 Gene, VvCBF2 Gene, VvCBF3 Gene, VvCBF4 Gene, VvKIN2 Genes and VvCOR15 Gene.

2. The wild grape as described in claim 1 VaWRKY72 The application of genes in the breeding of cold-resistant transgenic plants is characterized by, Compared to the wild type, the transgenic plants showed improved cold resistance; the plants in question are Arabidopsis thaliana and grape.

3. A method for improving the cold resistance of plants, characterized in that, Includes overexpression of the wild grape described in claim 1 in plants VaWRKY72 Genetic steps; the plants mentioned are Arabidopsis thaliana and grape.

Images