Rice ACCase mutant protein and application method thereof

Abstract

The invention discloses a rice ACCase mutant protein and a preparation method thereof. The amino acid sequence of the ACCase mutant gene encoding protein has the following mutations: the 2052nd site corresponding to the amino acid sequence of wild rice ACCase is mutated, isoleucine (I) is changed into asparagine (N), or isoleucine (I) is changed into glutamine (Q), or isoleucine (I) is changed into cysteine (C), or isoleucine (I) is changed into cysteine (C), or isoleucine (I) is changed into cysteine (C), or isoleucine (I) is changed into cysteine (C), or isoleucine (I) is changed into cysteine (C). And the plant can have extremely strong resistance (tolerance) to acetyl-coenzyme A carboxylase inhibitor herbicides. After the rice containing the rice ACCase mutant protein disclosed by the invention is applied with an acetyl-coenzyme A carboxylase inhibitor herbicide with 8 times of recommended use concentration, plants still grow normally, and the tolerance of the herbicide is greatly enhanced, so that the rice ACCase mutant protein can be widely applied to breeding of herbicide-resistant plants.

Description

Technical Field

[0001] The invention relates to the field of plant protein and plant resistance to herbicides, and in particular to a rice ACCase mutant protein resistant to acetyl-CoA carboxylase inhibitor herbicides, wherein the protein can confer resistance to acetyl-CoA carboxylase inhibitor herbicides on plants, especially rice. Background Art

[0002] Increasing crop yields has become particularly important. Farmland weeds are an important factor affecting crop yield and quality. Weeds compete with crops for water, fertilizer, air, heat and space, resulting in more than 34% of global crop yield losses each year. In addition, weeds increase humidity by affecting the permeability of plant roots, thereby increasing the occurrence and spread of diseases. Manual weeding can effectively reduce the harm of weeds, but this method is time-consuming, labor-intensive, inefficient, and does not meet the needs of modern agricultural production. In the past few decades, chemical weeding has been widely used as the main means of preventing and controlling weed damage because it is simple, economical and effective.

[0003] Acetyl-CoA carboxylase (ACCase) is the rate-limiting enzyme in the de novo fatty acid synthesis pathway in plants. It participates in the process of generating malonyl-CoA from acetyl-CoA as a precursor in the plastid. ACCase consists of three parts, namely biotin carboxyl carrier protein (BCCP), biotin carboxylase (BC) and carboxyltransferase (CT). Since ACCase plays a key role in the normal growth and development of plants, pesticide companies have developed a series of herbicides targeting ACCase, which have been promoted in the market to date. ACCase inhibitors inhibit the synthesis of fatty acids by inhibiting the homologous ACCase in grass plants. They have the advantages of high efficiency, selectivity, low toxicity, long application period, and safety for subsequent crops. In addition, such inhibitors can be transmitted in the plant body and can control annual or perennial grass weeds after seedlings.

[0004] The development of plant herbicide varieties will be able to obtain higher returns if it is combined with crop varieties. In order to avoid herbicides from damaging the crops themselves, the creation of resistant plants, plant tissues, and plant seeds can be combined with herbicides to complement each other to increase crop yields. Herbicide-resistant germplasm was created along with the development of high-efficiency herbicides. The combination of specific resistant crop varieties and herbicides is an effective means of controlling weeds in modern agriculture. However, the traditional breeding method has a long cycle and a lack of available germplasm resources. In the production of crops, rice, as one of the five major food crops, urgently needs to cultivate herbicide-resistant rice to prevent and control weedy rice based on the current situation of weedy rice. Among them, target resistance research is simpler and will not excessively involve traditional genetic modification issues. If it is applied to production, it is easier to be accepted. Moreover, looking at the herbicide market, ACCase inhibitor herbicides occupy a large market share, with many types and good effects. It is most appropriate to use this as a target for herbicide resistance research. Therefore, it is necessary to discover new herbicide resistance gene loci, create resistant plant varieties, and cultivate more herbicide-resistant rice. Summary of the invention

[0005] Technical problem: The technical problem to be solved by the present invention is to provide a rice ACCase mutant protein. The protein can confer good herbicide resistance to rice. Further, the technical problem to be solved by the present invention is to provide a rice ACCase mutant protein that can confer resistance to (tolerance to) acetyl-CoA carboxylase herbicides in plants.

[0006] To this end, the present invention provides an amino acid sequence encoding a rice ACCase mutant protein.

[0007] In one embodiment, the present invention provides a rice ACCase mutant protein, wherein the amino acid sequence of the ACCase mutant protein is site-specifically replaced: the ACCase mutant protein is obtained by mutation at position 2052 of the amino acid sequence of rice ACCase.

[0008] Preferably, the amino acid sequence of the rice ACCase of the present invention is mutated from isoleucine to asparagine, or from isoleucine to glutamine, or from isoleucine to cysteine ​​at position 2052 relative to the amino acid sequence of the wild-type ACCase.

[0009] The present invention also provides a rice ACCase mutant protein, comprising: (a) an amino acid sequence of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, or (b) a derivative protein having acetyl-CoA carboxylase activity obtained by site-directed substitution (substitution and / or deletion and / or addition of one or more amino acids) of the amino acid sequence of the wild-type ACCase protein sequence SEQ ID NO:2.

[0010] The present invention also provides the application of the rice ACCase mutant protein in plant resistance to herbicides. The herbicides that the mutant protein of the present invention can tolerate include but are not limited to cypermethrin or quizalofop-p-ethyl. The herbicides that the mutant protein of the present invention can tolerate also include one or more of the herbicides of the acetyl-CoA carboxylase inhibitor class (clethodim, cyhalofop-butyl, diclofop-butyl, fluazifop-butyl, diclofop-butyl, sethoxydim, aryloxyphenyl cyclohexanedione, triketide cyclohexanedione, and naproxil).

[0011] The present invention also provides a method for obtaining a plant having herbicide resistance, comprising the following steps:

[0012] The plant is made to express the rice ACCase mutant protein.

[0013] Furthermore, the method for obtaining a plant with herbicide resistance includes making the target plant contain a mutant ACCase protein by means of transgenic, hybridization, or backcrossing.

[0014] The present invention also provides a method for controlling weeds and protecting plants from damage caused by herbicides, comprising: planting a rice variety containing the ACCase mutant protein according to any one of claims 1 to 3 or capable of expressing the ACCase mutant protein in a target plot, and applying an effective dose of a predetermined herbicide in the field during the fertilization season during the growth period of the rice.

[0015] The present invention also provides a method for obtaining a plant with herbicide resistance. Further, the present invention provides a method for enhancing the tolerance of plants, plant tissues, and plant cells to at least one herbicide, wherein the herbicide interferes with the activity of the ACCase enzyme, and the method comprises introducing an ACCase mutant protein or expressing an ACCase mutant protein in the target plant, plant tissue, or plant cell. Preferably, herbicide resistance in the present invention refers to resistance (tolerance) to acetyl-CoA carboxylase inhibitor herbicides.

[0016] The method for enhancing the resistance of plants, plant tissues or plant cells to herbicides of the present invention can be implemented by transformation or hybridization, selfing and asexual reproduction, or can be obtained by gene site-directed mutagenesis, so that the altered plant includes one of the nucleotide sequences of SEQ ID No: 3, SEQ ID No: 4 and SEQ ID No: 5 of the present invention.

[0017] The crops described in the present invention include but are not limited to rice, and may also include other crops.

[0018] The sequences are as follows:

[0019] SEQ ID NO:1

[0020]

[0021]

[0022]

[0023]

[0024] The amino acid sequence of SEQ ID NO.2 is as follows:

[0025]

[0026]

[0027] SEQ ID NO:3

[0028]

[0029]

[0030] SEQ ID NO:4

[0031]

[0032]

[0033] SEQ ID NO:5

[0034]

[0035]

[0036] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0037] The present invention has obtained through a large number of mutation experiments for the first time that the mutation at position 2052 of the amino acid sequence of wild-type rice ACCase can bring resistance to herbicides to plants, especially resistance to herbicides that interfere with the activity of ACCase enzymes. Therefore, the rice varieties cultivated using the protein of the present invention are preferably used in combination with acetyl-CoA carboxylase inhibitor herbicides. The experimental results of spraying the ACCase inhibitor herbicide Gaicaoneng in the field show that the rice containing the rice ACCase mutant protein of the present invention still grows and develops normally and bears fruit after applying 8 times the recommended concentration of acetyl-CoA carboxylase inhibitor herbicides, while the wild-type rice seedlings have died after applying 1 times the recommended concentration of acetyl-CoA carboxylase inhibitor herbicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is resistant callus grown on a selection medium containing herbicides;

[0039] Figure 2 This is the sequence map of the mutation site variation of the mutant rice plant;

[0040] Figure 3 This is a comparison of the effects of spraying 8 times the herbicide on the mutant I2052N / I2052Q / I2052C and the wild-type rice at the seedling stage. DETAILED DESCRIPTION

[0041] The present invention is described below with reference to the following examples. However, it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0042] The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

[0043] Example 1: CRISPR-mediated prime editing system

[0044] Taking rice as an example, the nucleotide sequence GGACAAAGAGATCTTTTTGA in the rice ACC gene SEQ ID NO:1 is selected. AGGThe sequence is the recognition site (the underlined part is the PAM sequence of the 5'NGG-3' structure). In order to achieve the mutation of the 2052nd amino acid from isoleucine (I) to asparagine (N), or from isoleucine to glutamine (Q), or from isoleucine to cysteine ​​(C), the nucleotide ATT (I) corresponding to the 2052nd amino acid is mutated to AAT (N), TGC (C), CAG (Q), respectively. According to these mutations, a suitable pegRNA sequence is designed, and its sequence is shown in Table 1. The pegRNA forward oligonucleotide chain and the reverse oligonucleotide chain complementary thereto are synthesized, annealed to form a double strand, and then connected to the guide editing tool pHUC411-PE2 vector pre-cut by BsaⅠ-HFv2 enzyme by GoldenGate cloning.

[0045] Table 1. pegRNA sequences for achieving amino acid mutations

[0046]

[0047]

[0048] Enzyme digestion system: pHUC411-PE2 vector 15μL, CutSmart 4μL, BsaⅠ-HFv2 2μL, ddH2O 19μL. The mixed enzyme digestion system was placed in a 37℃ oven for overnight digestion, and the digestion product was inactivated at 65℃ for 20min before use.

[0049] pegRNA annealing reaction system: FP (10μM) 10μL, RP (10μM) 10μL, T4DNA ligase buffer 5μL, T4 PNK 1μL, ddH2O 24μL. After the preparation, react at 37℃ for 1 hour, then add 2.5μL 1M NaCl, react at 95℃ for 5s, and then anneal naturally for 2-3 hours.

[0050] GoldenGate reaction system: pHUC411-PE2 (BsaⅠ-HFv2) 1μL, pegRNA 1μL, CutSmart 1μL, BsaⅠ-HFv2 1μL, T4 DNA Ligase buffer 1μL, T4DNA Ligase 1μL, ddH2O 4μL. After configuration, PCR reaction was performed. PCR program: 37℃5min, 25℃5min, 25-35 cycles, 80℃10min, 4℃ storage. The reaction product was transformed into E. coli.

[0051] Positive transformants were obtained by selecting plaques with kanamycin resistance and without spectinomycin resistance. After sequencing verification, positive plasmids were extracted to construct a guide editing vector for amino acid mutation at position 2125 of the plant ACC gene, named pHUC411-PE2-ACC pegRNA, and the plant expression vector was transferred into Agrobacterium tumefaciens EHA105 by freeze-thaw method. Positive clones were obtained by colony PCR screening, and Agrobacterium containing pHUC411-PE2-ACC pegRNA was obtained.

[0052] Example 2: Rice genetic transformation process

[0053] 1. Induction of rice callus: After the seeds are disinfected with alcohol for 5 minutes, they are soaked in sodium hypochlorite + Tween 20 for 40 minutes in a rotating manner. The disinfected seeds are cleaned with sterile water and soaked overnight at 30°C in the dark. The embryos of the treated seeds are cut out with a scalpel under sterile conditions and placed on the prepared induction medium and cultured in the dark at 30°C. The culture dish is a 100×25mm disposable plastic sterile culture dish. About 12-15 rice seed embryos are placed in each dish. Culture for 2-3 weeks until light yellow granular callus is induced (be careful to remove the contaminated seeds in time during this period).

[0054] 2. Pre-culture: transfer the induced callus tissue to a new induction medium in a sterile environment for pre-culture before infection. At the same time, activate the frozen target vector Agrobacterium twice for later use.

[0055] 3. Infection and co-cultivation: Mix the Agrobacterium bacterial solution and measure its OD600 = 0.1 for use. Select medium-sized secondary callus and transfer it to a 50mL sterile tube to the 15-20mL mark. Add the prepared Agrobacterium infection solution and fully suspend for 15 minutes. After the infection, use sterile filter paper to absorb the moisture of the callus to prevent contamination caused by residual Agrobacterium, and then transfer it to the pre-prepared co-culture medium and place it in a 23°C incubator in the dark for 2 days.

[0056] 4. Recovery culture: After the co-culture is completed, transfer the callus tissue to the recovery medium in the clean bench and culture it in the dark at 28℃ for 5 days. Pay attention to strict aseptic operation and place the callus evenly without overlapping or contamination.

[0057] 5. Screening: Select the golden yellow and dry callus after 3-5 days of recovery culture and place it on the screening medium containing 50 mg / L hygromycin for 7 days. Put about 30 callus on each plate of culture medium. In order to obtain rice callus containing herbicide resistance, it is then transferred to the medium containing hygromycin and 9 μmol of chlorpyrifos and cultured at 28°C for 3 weeks ( Figure 3 ).

[0058] 6. Differentiation culture: Select new induced particles grown after double resistance screening of hygromycin and 9 μmol of methicillin from the screening medium, and transfer them to the differentiation medium containing 25 mg / L hygromycin (about 300-350 regenerated calli for each carrier), where each dish of differentiation medium is divided into 5 places on average, and callus particles from the same screening place are placed in the same place of the differentiation medium, and a maximum of 4 callus particles are placed in each place. Culture at 28°C for 3 weeks.

[0059] 7. Rooting culture: For each vector, only one plant of the transformation event was selected for rooting. The seedlings after differentiation culture were transferred to rooting medium and cultured at 28°C for 2-3 weeks (16h light + 8h dark).

[0060] 8. Transplantation: Seedlings that test positive are transplanted into nutrient soil or the field to continue growing.

[0061] Example 3: Analysis of mutation sites of rice mutant 2052 resistant to acetyl-CoA carboxylase inhibitor herbicides

[0062] Forty-eight transgenic plants were obtained for each vector. To identify the base variation at the editing site, the genomic DNA of leaves selected from these herbicide-resistant rice mutant plants was extracted using the CTAB method, and primers were used to amplify the upstream and downstream sequences of the target sequence. A pair of primers was used to amplify the upstream and downstream sequences of the target sequence.

[0063] FP:CACCGTTGGACCCACCGGACAG

[0064] RP:GTCAAGCCGACTCATGCAAT

[0065] The amplified products were sent to Shanghai Bioengineering Company for genome sequencing. The sequencing results were compared with the wild-type Nipponbare ACCase gene, and homozygous mutant plants of these vectors were obtained. The sequencing results are shown in Figure 2 The amino acid sequence at position 2052 encoded by the corresponding ACCase gene changes. The amino acid sequences of the mutated ACCase proteins are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, and are named I2052N, I2052Q, and I2052C, respectively.

[0066] Example 4: Experiment on the resistance of rice mutants to acetyl-CoA carboxylase inhibitor herbicides

[0067] The homozygous rice material containing the mutant protein is transplanted into the field to harvest T1 generation seeds. After the plants mature, the seeds are mixed, dried, and stored in storage boxes.

[0068] Sowed in the field and planting pots in the middle season. When the rice I2052N, I2052Q, I2052C and wild-type rice seedlings grew to the 3-4 leaf stage, 12.96 g / mu of the herbicide Gai Cao Neng (8 times the recommended concentration) was sprayed with a quantitative pesticide spray tower. 15 days later, the rice I2052N, I2052Q and I2052C plants were all normal green plants, still growing normally, and the survival rate was above 95%, while the wild-type rice had all died, indicating that the mutant rice can resist 8 times the recommended concentration of the herbicide Gai Cao Neng.

[0069] When the rice seedlings I2052N, I2052Q, I2052C and wild-type rice grew to the 3-4 leaf stage, 38.4 g / mu of clethodim (8 times the recommended concentration) herbicide was sprayed using a quantitative pesticide spray tower. 15 days later, the rice plants I2052N, I2052Q and I2052C all appeared as normal green plants and still grew normally, with a survival rate of more than 95%, while the wild-type rice plants all died, indicating that the mutant rice can resist 8 times the recommended concentration of clethodim herbicide, and the mutant protein of the present invention can give rice high resistance to herbicides.

[0070] The above embodiments are only preferred examples for introducing the present invention. For those skilled in the art, any obvious changes and improvements made without departing from the spirit of the present invention should be regarded as part of the present invention.

Claims

1. A rice ACCase mutant protein, characterized in that: The amino acid sequence of the ACCase mutant protein is obtained by mutation at position 2052 of the wild-type rice ACCase amino acid sequence.

2. The ACCase mutant protein according to claim 1, characterized in that The 2052nd position of its amino acid sequence is changed from isoleucine to asparagine, or from isoleucine to glutamine, or from isoleucine to cysteine.

3. The ACCase mutant protein according to claim 2, characterized in that The amino acids thereof are mutated as shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing.

4. A method for preparing a herbicide-resistant plant, characterized in that: The plant is made to express the ACCase mutant protein according to claim 3, so that the plant has resistance to acetyl-CoA carboxylase inhibitors or improves the plant's resistance to acetyl-CoA carboxylase inhibitors.

5. The method according to claim 4, characterized in that The method comprises: making the plant contain the ACCase mutant protein according to claim 2 by gene editing, mutagenesis, hybridization, backcrossing, selfing or asexual reproduction.

6. A method for obtaining the ACCase mutant protein according to claim 5, characterized in that: The method comprises the steps of: 1) Construction of guide editing expression vector and expression cassette containing ACCase mutation target site; 2) introducing the above expression vector into rice cells by genetic transformation, adding herbicide screening during the genetic transformation process, and obtaining callus and seedlings containing the ACCase mutant protein according to claim 2; 3) causing a plant to express the rice ACCase mutant protein according to claim 2 or 3.

7. A method for effectively controlling weeds and protecting rice from damage by herbicides, characterized in that: The method comprises planting a rice variety containing the ACCase mutant protein according to any one of claims 1 to 3 or capable of expressing the ACCase mutant protein in a target plot, and applying an effective dose of a herbicide having the function of interfering with the activity of the ACCase enzyme in the field during the rice growth period and the fertilization season.

8. The method according to claim 7, characterized in that The herbicide is a commercially available acetyl-CoA carboxylase inhibitor herbicide.

9. The method according to claim 7, characterized in that The herbicide includes one or more of cyhalofop-butyl, fenoxaprop-butyl, fluazifop-butyl, sethoxydim, quizalofop-butyl, clethodim and the like.

Images