Quadruple fluorescent PCR primer probe combination, reaction system, method and application for identifying mycoplasma gallisepticum wild strain and vaccine strain

Abstract

The invention relates to the technical field of molecular biological detection, and particularly discloses a quadruple fluorescent PCR primer probe combination, a reaction system and a detection method for identifying a mycoplasma gallisepticum wild strain and a vaccine strain. The quadruple fluorescent PCR primer probe combination for identifying the mycoplasma gallisepticum wild strain and the vaccine strain comprises a universal primer probe group for detecting mycoplasma gallisepticum and a specific primer probe group specially aiming at three vaccine strains F-36, TS-11 and 6 / 85 respectively. According to the quadruple fluorescent PCR primer probe combination, the reaction system and the method for identifying the mycoplasma gallisepticum wild strain and the vaccine strain, the purpose of simultaneously detecting and distinguishing DNA of the mycoplasma gallisepticum wild strain and DNA of three different vaccine strains (F-36, TS-11 and 6 / 85) of the mycoplasma gallisepticum wild strain can be achieved, so that detection and differential diagnosis are more efficient, economical, simple and convenient; the kit has the advantages of high sensitivity, good specificity, rapidness, high flux, simplicity and convenience in operation and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological detection, and in particular to a quadruple fluorescent PCR primer-probe combination, reaction system, method and application for identifying wild strains and vaccine strains of Mycoplasma gallisepticum. Background Art

[0002] Mycoplasma gallisepticum (MG), also known as Mycoplasma gallisepticum, is a member of the genus Mycoplasma in the family Mycoplasmataceae of the order Mycoplasmae of the class Mollicutes. As early as the 1950s, scholars have proved that MG is associated with respiratory diseases in chickens, decreased egg production and economic damage caused by reduced hatching rates. MG is distributed all over the world, with a high infection rate and rapid spread, causing serious harm. MG is also widely prevalent in my country. There are MG-positive cases in Guangdong, Guangxi, Beijing, Shanghai, Qinghai, Sichuan, Inner Mongolia and other places, and the average infection rate in various places is 36.2% to 89.5%. MG infection can cause chronic respiratory diseases in chickens, manifested as chronic respiratory symptoms such as coughing and rales, affecting the carcass quality of broilers and the production performance of breeders, and increasing the mortality rate of chickens. After infection, chickens can be transmitted vertically and horizontally. The pathogen circulates throughout the flock, seriously reducing the resistance of the flock, and is prone to concurrent or secondary infection with other pathogens, aggravating symptoms and even outbreaks of other diseases, causing more serious losses. It is estimated that MG infection can reduce chicken productivity by 10% to 20%, increase embryonic mortality by 5% to 10%, and significantly increase the cost of disease prevention and control. At present, MG infection has become one of the most important diseases restricting the healthy development of my country's poultry industry. From 2023, it has been listed as one of the diseases to be purified in breeding farms.

[0003] The prevention and control of MG mainly relies on vaccination, drug treatment, isolation, elimination and purification of positive chickens, and vaccination is the most commonly used and effective method. The domestic and imported attenuated vaccine strains currently used in my country are mainly F-36, TS-11 and 6 / 85. Unlike the infection of MG wild strains, which can cause disease in chickens and cause epidemics, after vaccination with MG attenuated vaccine strains, the corresponding attenuated vaccine strains can colonize in chickens, showing the presence of bacteria without clinical symptoms, and have an immune protection effect on chickens. Traditional detection methods such as classic PCR recommended by the World Organization for Animal Health WOAH cannot distinguish between infected animals and immune animals. Moreover, investigations have found that some chicken farms in China currently have irregular vaccination and even abuse, resulting in the co-infection of wild strains and vaccine strains (even multiple vaccine strains) in chickens, which has caused great difficulties in the prevention and control and purification of the disease. Carrying out detection and differential diagnosis is the premise and basis for timely taking scientific prevention and control measures, effectively controlling the disease and reducing losses. Therefore, studying MG wild strains and vaccine strains, as well as the differential diagnosis methods of different vaccine strains, will provide necessary technical tools for the prevention and control and purification of MG.

[0004] At present, molecular biological diagnostic techniques including PCR, fluorescent PCR, LAMP, RAA-CRISPR and RAA have been widely used in MG detection and diagnosis because they are fast, accurate and more suitable for clinical use. Among them, although RAA and LAMP technologies have the advantages of faster and more sensitive detection, simpler equipment and more suitable for on-site detection, they also have defects such as immature technology and difficulty in multi-target detection. Therefore, compared with traditional fluorescent PCR detection methods, their clinical application and popularity are not high. At present, grassroots testing institutions are all equipped with fluorescent PCR instruments, while LAMP and RAA detection require the purchase of additional instruments. Fluorescent PCR detection methods, especially TaqMan real-time fluorescent PCR methods, have many advantages such as strong specificity, high sensitivity, good repeatability, high stability, easy multi-target detection and high penetration rate of instruments and equipment, and have become the preferred molecular biological diagnostic method. TaqMan real-time fluorescent PCR methods for MG have been established at home and abroad, but most of them can only detect one strain at a time, or use dual fluorescent quantitative PCR to detect two mycoplasmas at one time. The Chinese patent application with publication number CN 118813835A discloses a real-time fluorescence quantitative PCR kit for identifying wild strains of Mycoplasma gallisepticum from F strains, TS-11S strains, and 6 / 85 strains, which is used to identify MG isolates that have been isolated, cultured, and purified, and can also be used to evaluate the in vivo replication efficiency of attenuated live vaccines (F strains, TS-11 strains, and 6 / 85 strains) in immunized chickens and monitor wild virus infection. However, the patent application only applies the wild strain identification system and the three vaccine strain identification systems to form a dual fluorescence quantitative PCR system for mixed testing. A one-time test can only identify one wild strain and one vaccine strain, and there is no way to achieve the purpose of distinguishing wild strains from three vaccine strains in a one-time test in the same reaction tube. With the increasing harm of mycoplasma disease to my country's poultry industry in recent years, the country has put the control and purification of MG on the agenda. From 2023, the disease will be included in the purification diseases of the national animal disease purification farm. In view of the current widespread prevalence of MG in chickens in my country and the serious mixed infection caused by vaccine abuse, the existing detection methods can no longer meet the current and future technical needs of MG diagnosis and prevention and control. It is urgently needed to further develop a rapid identification detection method that can simultaneously detect and distinguish MG wild strains and the three existing vaccine strains. This is of great significance for chicken farmers to formulate and implement prevention and control strategies in a targeted manner. Summary of the invention

[0005] In view of the above shortcomings, the present invention provides a quadruple fluorescent PCR primer-probe combination and reaction system and method for identifying wild strains and vaccine strains of Mycoplasma gallisepticum (MG), which can simultaneously detect and distinguish the DNA of wild strains of MG and its three different vaccine strains (F-36, TS-11, 6 / 85). The specific technical scheme is as follows:

[0006] A quadruple fluorescent PCR primer-probe combination for identifying wild strains and vaccine strains of Mycoplasma gallisepticum (MG), the primer-probe combination comprising the following primer-probe sets:

[0007] A universal primer-probe set for detecting Mycoplasma gallisepticum (MG), comprising: a forward primer MG-U_F as shown in SEQ ID NO: 1, a reverse primer MG-U_R as shown in SEQ ID NO: 2, and a probe MG-U_P as shown in SEQ ID NO: 9;

[0008] A primer probe set for detecting MG vaccine strain F-36, comprising: a forward primer MGF-36_F as shown in SEQ ID NO:3, a reverse primer MG F-36_R as shown in SEQ ID NO:4, and a probe MG F-36_P as shown in SEQ ID NO:10;

[0009] A primer probe set for detecting MG vaccine strain TS-11, comprising: a forward primer MGTS-11_F as shown in SEQ ID NO:5, a reverse primer MG TS-11_R as shown in SEQ ID NO:6, and a probe MG TS-11_P as shown in SEQ ID NO:11;

[0010] The primer probe set for detecting MG vaccine strain 6 / 85 comprises: a forward primer MG6 / 85_F as shown in SEQ ID NO:7, a reverse primer MG 6 / 85_R as shown in SEQ ID NO:8 and a probe MG 6 / 85_P as shown in SEQ ID NO:12.

[0011] The universal primer probe group in the above quadruple fluorescent PCR primer probe combination can detect all currently known MG strains, including wild-type strains and vaccine strains.

[0012] Preferably, in the above-mentioned quadruple fluorescent PCR primer-probe combination, the probe MG-U_P, the probe MG F-36_P, the probe MG TS-11_P and the probe MG 6 / 85_P are respectively labeled with modification groups that exhibit different fluorescent colors.

[0013] On the other hand, the present invention also provides a quadruple fluorescent PCR reaction system for identifying MG wild strains and vaccine strains, wherein the reaction system comprises the above-mentioned primer-probe combination. Preferably, in the above-mentioned quadruple fluorescent PCR reaction system, the concentration of the forward primer MG-U_F and the reverse primer MG-U_R is 0.2-0.3 μmol / μL, and the concentration of the probe MG-U_P is 0.05-0.15 μmol / μL;

[0014] The concentration of the forward primer MG F-36_F and the reverse primer MG F-36_R is 0.1-0.2 μmol / μL, and the concentration of the probe MG F-36_P is 0.03-0.08 μmol / μL;

[0015] The concentration of the forward primer MG TS-11_F and the reverse primer MG TS-11_R is 0.1-0.2 μmol / μL, and the concentration of the probe MG TS-11_P is 0.03-0.08 μmol / μL;

[0016] The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R are 0.1-0.2 μmol / μL, and the concentration of the probe MG 6 / 85_P is 0.03-0.08 μmol / μL.

[0017] Preferably, in the above-mentioned quadruple fluorescent PCR reaction system, the concentrations of the forward primer MG-U_F and the reverse primer MG-U_R are 0.25 μmol / μL, and the concentration of the probe MG-U_P is 0.1 μmol / μL;

[0018] The concentration of the forward primer MG F-36_F and the reverse primer MG F-36_R was 0.15 μmol / μL, and the concentration of the probe MG F-36_P was 0.05 μmol / μL;

[0019] The concentration of the forward primer MG TS-11_F and the reverse primer MG TS-11_R is 0.15 μmol / μL, and the concentration of the probe MG TS-11_P is 0.05 μmol / μL;

[0020] The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R were 0.15 μmol / μL, and the concentration of the probe MG 6 / 85_P was 0.05 μmol / μL.

[0021] On the other hand, the present invention also provides the use of the above-mentioned quadruple fluorescent PCR primer-probe combination in the preparation of a product for simultaneously identifying MG wild-type strains and vaccine strains.

[0022] On the other hand, the present invention also provides the use of the above-mentioned quadruple fluorescent PCR primer-probe combination and fluorescent PCR reaction system in simultaneously detecting and identifying wild strains and vaccine strains of Mycoplasma gallisepticum for non-disease diagnosis or treatment purposes.

[0023] Preferably, in the above application, the vaccine strain is MG F-36, TS-11, or MG 6 / 85.

[0024] On the other hand, the present invention also provides a quadruple fluorescence PCR detection method for distinguishing MG wild-type strains and vaccine strains for non-disease diagnosis or treatment purposes, comprising the following steps:

[0025] (1) Preparation of fluorescent PCR reaction system: adding corresponding DNA template and the quadruple fluorescent PCR primer-probe combination according to any one of claims 1 to 2 to prepare a quadruple fluorescent PCR reaction system;

[0026] (2) Fluorescence PCR reaction system amplification;

[0027] (3) Result determination: The threshold setting principle is that the threshold line just exceeds the highest point of the amplification curve of the normal negative control; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged as MG negative; if the Ct value of the MG-U channel of the sample to be tested is ≤35, and a specific amplification curve appears, the result is judged as MG positive; at the same time, if the Ct value of any one or more channels of vaccine strains such as F-36, TS-11 or 6 / 85 is ≤35 and a specific amplification curve appears, the MG vaccine strain is judged to be positive, and a specific amplification curve appears in the corresponding channel, which is judged to be the presence of the corresponding vaccine strain; if the three vaccine strain channels have no Ct value or the Ct value is >35, and there is no specific amplification curve, the MG wild strain is judged to be positive.

[0028] Preferably, in the above detection method, in step (2), the detection reaction conditions are set as: pre-denaturation at 95°C for 30s; denaturation at 95°C for 15s, annealing at 48°C for 30s, for a total of 40 cycles; and collecting the fluorescence signal at the end of each cycle.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The present invention achieves the purpose of simultaneously detecting and distinguishing the DNA of wild-type MG and its three different MG vaccine strains (F-36, TS-11, and 6 / 85) in the same reaction tube through one reaction, making identification detection and diagnosis more efficient, economical, and convenient.

[0031] 2. High sensitivity: The quadruple fluorescence PCR detection method provided by the present invention has a minimum detection limit of 8.7344×10 1 copies / μL、9.0396×10 1 copies / μL、9.0144×10 1 copies / μL and 10.2380×10 1 copies / μL.

[0032] 3. Good specificity: The quadruple fluorescence PCR detection method provided by the present invention only generates corresponding fluorescence amplification signals for the genomes of MG and its vaccine strains F-36, TS-11, and 6 / 85, and has no cross-reaction to poultry pathogens such as Newcastle disease virus lasota strain, chicken synoviae Mycoplasma MS-H strain, Gallus typhi Salmonella ATCC54003 strain, avian Escherichia coli O78 type SH strain, H9 subtype avian influenza virus SS strain, chicken infectious bronchitis virus H120 strain, avian Pasteurella multocida inactivated vaccine (strain 1502), and blood, saliva, and skin samples from SPF chickens.

[0033] 4. Fast detection speed and high throughput: The quadruple fluorescence PCR detection method provided by the present invention can complete the entire amplification detection process within 1 hour after adding the sample, and according to the number of detection wells of the fluorescence quantitative PCR instrument, it can realize the simultaneous detection of 96 to 384 samples at one time.

[0034] 5. Easy operation: The quadruple fluorescence PCR detection method provided by the present invention only needs to place the configured reaction system in a fluorescence quantitative PCR instrument to complete the entire amplification and result determination process, without the need for identification by agarose gel electrophoresis; at the same time, the probe group used is optimized based on the difference in multiple SNP sites, with a low detection background value, making it easier to determine the results. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are some embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0036] Figure 1 Schematic diagram of the design region of the MG-U primer and probe in the present invention;

[0037] Figure 2 Schematic diagram of the design region of the MG F-36 primer and probe in the present invention;

[0038] Figure 3 Schematic diagram of the design region of the MG TS-11 primers and probes in the present invention;

[0039] Figure 4 Schematic diagram of the design region of the MG 6 / 85 primers and probes in the present invention;

[0040] Figure 5The electrophoresis result diagram for the positive plasmid preparation of the present invention, wherein lane 1: 2000bp Marker lane; 2: MG-U lane (175bp); 3: MG F-36 lane (99bp); 4: MG TS-11 lane (551bp); 5: MG 6 / 85 lane (83bp).

[0041] Figure 6 This is a quadruple Taqman fluorescence PCR sensitivity test result diagram (MG-U), where 1: working standard 1; 2: working standard 2; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8; 9: working standard 9; 10: negative control;

[0042] Figure 7 It is the result graph of the standard curve of quadruple Taqman fluorescence PCR (MG-U);

[0043] Figure 8 This is a quadruple Taqman fluorescence PCR sensitivity test result diagram (MG F-36), where 1: working standard 10; 2: working standard 11; 3: working standard 12; 4: working standard 13; 5: working standard 14; 6: working standard 15; 7: working standard 16; 8: working standard 17; 9: working standard 18; 10: negative control;

[0044] Fig. 9 It is the result graph of the standard curve of quadruple Taqman fluorescence PCR (MG F-36);

[0045] Fig.10 This is a quadruple Taqman fluorescence PCR sensitivity test result diagram (MG TS-11), where 1: working standard 19; 2: working standard 20; 3: working standard 21; 4: working standard 22; 5: working standard 23; 6: working standard 24; 7: working standard 25; 8: working standard 26; 9: working standard 27; 10: negative control;

[0046] Fig.11 The standard curve results of quadruple Taqman fluorescence PCR (MG TS-11) are shown;

[0047] Fig.12 The figure is the result of the quadruple Taqman fluorescence PCR sensitivity test (MG 6 / 85), wherein 1: working standard 28; 2: working standard 29; 3: working standard 30; 4: working standard 31; 5: working standard 32; 6: working standard 33; 7: working standard 34; 8: working standard 35; 9: working standard 36; 10: negative control;

[0048] Fig.13 The figure is the result of the standard curve of quadruple Taqman fluorescence PCR (MG 6 / 85);

[0049] Fig.14 It is a comparison chart of the results of quadruple Taqman fluorescence PCR sensitivity test (MG-U, MG F-36, MG TS-11, MG6 / 85);

[0050] Fig.15 Diagram showing the suitability of universal MG-U primer and probe combinations for wild-type and vaccine strain DNA templates;

[0051] Fig.16 The specificity diagram of this method is verified by wild strain DNA template;

[0052] Fig.17 It is a graph of the results of the quadruple Taqman fluorescent PCR specificity test, among which: 1: MG-U positive control; 2: MG F-36 positive control; 3: MG TS-11 positive control; 4: MG 6 / 85 positive control; 5: Newcastle disease virus lasota strain; 6: Mycoplasma synoviae MS-H strain; 7: Salmonella enterica serovar Typhimurium ATCC54003 strain; 8: Escherichia coli O78 type SH strain; 9: H9 subtype avian influenza virus SS strain; 10: Infectious bronchitis virus H120 strain; 11: Avian Pasteurella multocida inactivated vaccine (strain 1502); 12: Skin tissue from SPF chicken; 13: Blood from SPF chicken; 14: Saliva from SPF chicken; 15: Negative control. DETAILED DESCRIPTION

[0053] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Unless otherwise defined, all professional terms used hereinafter have the same meaning as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present invention, etc. can be purchased from the market or can be prepared by existing methods.

[0054] The invention is based on the fluorescent quantitative PCR technology of multiple Taqman-probes, and uses the conservative sites 218132-218306 of MG in the genome of TS-11 strain, the specific sites 598305-598403 of F-36 strain in the genome, the specific sites 879213-886977 of TS-11 strain in the genome, the specific sites 526057-526140 of 6 / 85 strain in the genome as molecular markers, designs primers and probes, establishes a detection method, and realizes the purpose of distinguishing and detecting MG F-36, MG TS-11, MG 6 / 85 vaccine strains and wild strains by real-time monitoring of the fluorescent signals of different markers.

[0055] Example 1 Construction of a quadruple fluorescent PCR primer-probe combination and reaction system and method for identifying wild strains and vaccine strains of Mycoplasma gallisepticum

[0056] 1.1 Screening and design of primers and probes

[0057] MG strains have high genomic homology. In order to effectively distinguish wild MG strains and vaccine strains, the whole genome sequences of MG epidemic strains and vaccine strains included in the GenBank database were downloaded, and sequence analysis and comparison were performed using MEGA 6 software. The conserved sites 218132-218306 of the MG TS-11 (GenBank accession number: CP044225.1) genome were screened, and the specific primer pair MG-U_F / MG-U_R and probe MG-U_P were designed using Primer Premier 5 software, which can detect the genomic nucleic acids of all known MG strains (including vaccine strains and wild strains). At the same time, Genious software was used to analyze and compare the whole genome sequence of MG F-36 (GenBank accession number CP001873.1), the whole genome sequence of MG TS-11 (GenBank accession number: CP044225.1), and the whole genome sequence of MG 6 / 85 strain (GenBank accession number: NZ_CP044224.1), and the specific sequences of the three vaccine strains were found at positions 598305-598403, 879213-886977, and 526057-526140 of their genomes, respectively.

[0058] Taking into account factors such as the conservation of vaccine strain-specific sequences, base composition, GC content, secondary structure formation, Tm value, etc., a quadruple Taqman fluorescent PCR primer-probe scheme for identifying and detecting MG F-36, TS-11, and 6 / 85 was designed using Primer Premier 5 software (Table 1).

[0059] Table 1 Design of primer pairs and probe sets for MG universal, F-36, TS-11, 6 / 85 identification

[0060]

[0061] Primer and probe design region MG-U see Figure 1 、MGF-36 Figure 2 MGTS-11 Figure 3 、MG6 / 85 Figure 4 , the specific sequence of design is as follows:

[0062] (1) Universal primer probe set for detecting MG wild strains and vaccine strains:

[0063] Forward primer MG-U_F: 5'-GAAGGTGAAACTAAYTCC-3' (SEQ ID NO: 1)

[0064] Reverse primer MG-U_R: 5'-CTTGGATCATCATTCTTTC-3' (SEQ ID NO: 2)

[0065] Probe MG-U_P: 5′-AATCCCAATCCCTAAACCCAAGAGT-3′ (SEQ ID NO: 9).

[0066] (2) Primer probe set for detecting MG vaccine strain F-36:

[0067] Forward primer MG F-36_F: 5'-GCTCCATCTAGTAGTTATCA-3' (SEQ ID NO: 3)

[0068] Reverse primer MG F-36_R: 5'-TGCACTTAAGAAATCTACAAA-3' (SEQ ID NO: 4)

[0069] Probe MG F-36_P: 5'-CATCCATTCCACCTAATTGACTAGCA-3' (SEQ ID NO: 10).

[0070] (3) Primer probe set for detecting MG vaccine strain TS-11:

[0071] Forward primer MG TS-11_F: 5'-AGCACTGTACAATACTTG-3' (SEQ ID NO: 5)

[0072] Reverse primer MG TS-11_R: 5'-CGACATCAATAGCTACAC-3' (SEQ ID NO: 6)

[0073] Probe MG TS-11_P: 5′-ACACACCCTAAATATCAAACTCGAACA-3′ (SEQ ID NO: 11).

[0074] (4) Primer probe set for detecting MG vaccine strain 6 / 85:

[0075] Forward primer MG 6 / 85_F: 5'-GCTGAGTGATTGTTTTAATC-3' (SEQ ID NO: 7)

[0076] Reverse primer MG 6 / 85_R: 5'-ACCTGATTATGTGAATCCTA-3' (SEQ ID NO: 8)

[0077] Probe MG 6 / 85_P: 5'-AAACACCCGCTCCATTGCTTT-3' (SEQ ID NO: 12).

[0078] Among them, the 5' end of the detection probe MG-U_P was labeled with hexachlorofluorescein group HEX, the 5' end of MG F-36_P was labeled with carboxyfluorescein FAM, the 5' end of MG TS-11_P was labeled with indole dicarbonyl cyanine CY5, the 5' end of MG 6 / 85_P was labeled with carboxyl-X-rhodamine group ROX, the 3' end of MG-U_P was labeled with quencher group BHQ1, the 3' end of MG F-36_P was labeled with quencher group BHQ1, the 3' end of MG TS-11_P was labeled with quencher group BHQ3, and the 3' end of MG 6 / 85_P was labeled with quencher group BHQ2. Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] 1.2 Primer and probe concentration optimization reaction procedure and reaction system determination

[0080] The upstream and downstream primers and probes of each MG were diluted to 10 μmol / μL using ddH2O, and the final concentration range of the primers in the reaction system was set to 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40 μmol / μL, and the final concentration range of the probes was set to 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35 μmol / μL, and a variety of combinations were obtained through permutation and combination. The primer and probe pairs of each combination were subjected to single-plex fluorescence PCR reaction, and the primer-probe combination with the minimum Ct value and the best amplification curve was screened out to determine the optimal primer and probe concentrations.

[0081] Reaction program determination: the annealing temperature was set to 40, 44, 48, 52, 56, and 60°C, and 6 test groups were set up. At the same time, the number of cycles was optimized when the annealing temperature was determined. The number of cycles was set to 30, 35, 40, and 45 to determine the best single-plex fluorescence PCR reaction program.

[0082] Optimization of reaction conditions: Establish and optimize the multiplex fluorescence PCR reaction system and procedure based on the optimal single fluorescence PCR reaction conditions. Mix the corresponding primers and probes of the optimized single fluorescence PCR system and add them to the same system to perform fluorescence PCR reaction. Adjust the ratio of primer pairs in the mixed primers and probe concentration according to the Ct value, fluorescence value and amplification curve of the quadruple fluorescence PCR amplification results, and use the optimized reaction system and procedure for multiplex fluorescence PCR amplification.

[0083] Optimization results: Multiplex fluorescence PCR reaction system: MG-U_F / R 0.5μL (0.25μmol / μL), MG-U_P 0.2μL (0.10μmol / μL); MG F-36_F / R 0.3μL (0.15μmol / μL), MG F-36_P 0.10μL (0.05μmol / μL); MGTS-11_F / R 0.3μL (0.15μmol / μL), MG TS-11_P 0.10μL (0.05μmol / μL); MG 6 / 85_F / R 0.3μL (0.15μmol / μL), MG 6 / 85_P 0.10μL (0.05μmol / μL); 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, DNA template 2.0 μL, and finally add ddH2O to make up to 20.0 μL.

[0084] Reaction program: 95°C for 30 s; 95°C for 15 s, 48°C for 30 s, for 40 cycles.

[0085] 1.3 Quadruple fluorescence PCR detection method for distinguishing wild-type and vaccine strains of Mycoplasma gallisepticum

[0086] The quadruple fluorescence PCR detection method for identifying wild-type and vaccine strains of Mycoplasma gallisepticum specifically comprises the following steps:

[0087] (1) Sample processing: directly use a commercial DNA extraction kit to extract nucleic acid on a fully automatic nucleic acid extraction instrument, and the obtained nucleic acid sample is stored at -20°C for future use;

[0088] (2) Preparation of fluorescent PCR reaction system: Dilute the upstream and downstream primers and probes of each MG to 10 μmol / μL using ddH2O. Multiplex fluorescence PCR reaction system: MG-U_F / R 0.5μL each (final concentration 0.25μmol / μL), MG-U_P 0.2μL (final concentration 0.10μmol / μL); MG F-36_F / R 0.3μL each (final concentration 0.15μmol / μL), MG F-36_P 0.10μL (final concentration 0.05μmol / μL); MG TS-11_F / R 0.3μL each (final concentration 0.15μmol / μL), MG TS-11_P 0.10μL (final concentration 0.05μmol / μL); MG 6 / 85_F / R 0.3μL each (final concentration 0.15μmol / μL), MG 6 / 85_P 0.10μL (final concentration 0.05μmol / μL); 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, DNA template 2.0 μL, and finally add ddH2O to make up to 20.0 μL.

[0089] (3) Fluorescence PCR amplification: set the reaction program to pre-denaturation at 95°C for 30 s; denaturation at 95°C for 15 s, annealing at 48°C for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle;

[0090] (4) Result determination: The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control amplification curve; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤35, and a specific amplification curve appears, the result is judged as MG positive; at the same time, if the Ct value of any one or more channels of the vaccine strains such as F-36, TS-11 or 6 / 85 is ≤35 and a specific amplification curve appears, the MG vaccine strain is judged to be positive; if the three vaccine strain channels have no Ct value or the Ct value is >35, and there is no specific amplification curve, the MG wild strain is judged to be positive.

[0091] Example 2: Sensitivity of the Screened Primers and Probes

[0092] 2.1. Preparation of positive plasmid standards

[0093] (1) Preparation of positive plasmid

[0094] MG F-36 is derived from a commercial vaccine on the market and is produced by Qingdao Yibang Biotechnology Co., Ltd.; MG-U and MGTS-11 are derived from commercial vaccines on the market and are produced by Australian Bioresources; MG 6 / 85 is derived from a commercial vaccine on the market and is produced by Intervet USA. The DNA templates of MG-U, MG F-36, MG TS-11, and MG 6 / 85 were extracted using a commercial DNA extraction kit according to the instructions and conventional PCR amplification was performed. The specific steps are as follows:

[0095] Reaction system preparation: 25 μL of reaction solution per tube, containing PremixTaq TM (Ex Taq TM Version 2.0plusdye) 12.5μL, 10pmo1 / μL MG-U or (MG F-36, MG TS-11, MG 6 / 85) fluorescent PCR_F and MG-U or (MG F-36, MG TS-11, MG 6 / 85) fluorescent PCR_R 0.5μL each, finally add ddH2O to make up to 25μL, and add 2μL of MG-U or (MG F-36, MG TS-11, MG 6 / 85) DNA template of the corresponding system to different reaction tubes. Among them, PremixTaq TM (ExTaq TM Version 2.0 plus dye) detection reagent (Cat#:RR902A) was purchased from TaKaRa Bio-Tech Co., Ltd., and MG-U, MG F-36, MG TS-11, and MG 6 / 85 primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The reaction conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 45°C annealing for 30 s, and 72°C extension for 30 s, 40 cycles; 72°C final extension for 5 min; and 4°C storage.

[0096] The PCR products were electrophoresed on 1.5% agarose gel (see Figure 5 ), the target fragment was recovered and connected to the pMD19-T vector, transformed into DH5a Escherichia coli, and the positive strains were identified by PCR and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were consistent with the expectations as positive strains, and their plasmids were extracted as positive plasmids.

[0097] Plasmid pTMG-U contains the gene fragment of 218132 to 218306 nt of the MG TS-11 genome, and the sequence of the fragment is as follows:

[0098] GAAGGTGAAACTAATTCCGTTGGTCCAAGAAAGATTACCTCTGAACCCTGATTTTATCCAGTAGTGGGTGCAGGTGCTGGGTTGATTGTTGTTTCTTTACTCTTGGGTTTAGGGATTGGGATTCCGATCGCTAAGAAAAAAGAAAGAATGATGATCCAAGAACGTGAAGAACACC;

[0099] Plasmid pTMG F-36 contains a gene fragment of 598305 to 598403 nt of the MG F-36 genome, the sequence of which is as follows:

[0100] 5'-TGCACTTAAGAAATCTACAAAAGCATCCATTCCACCTAATTGACTAGCAACATCACAA TAATTTATTACATCATAGCCATGATAACTACTAGATGGAGC-3';

[0101] Plasmid pTMG TS-11 contains a gene fragment of 879213 to 886977 nt of the MG TS-11 genome, and the sequence of the fragment is as follows:

[0102] 5'-GCAATAACAACACCGTTAGTGTTTTGTGGTTTGTTAATGTTTTAGCACTGTACAATACT TGTGTAAGCAATAACACCCTAAATATCAAACTCGAACAAGTTGGTTTTAGCACTGTAC AATACTTGTGTAAGCAATAACTGTTTTGTGTAGCTATTGATGTCGTAAAG-3':

[0103] Plasmid pTMG 6 / 85 contains a gene fragment of 526057 to 526140 nt of the MG 6 / 85 genome, the sequence of which is as follows:

[0104] 5'-

[0105] GCTGAGTGATTGTTTTAATCTTTAGTTTTTCAAACACCCGCTCCATTGCTTTTTTTAGTTTTTTAGGATTCACATAATCAGGT-3':

[0106] (2) Preparation of positive plasmid standards

[0107] The OD260 / OD280 ratio and concentration (unit: ng / μL) of the positive plasmid were determined by ultra-micro UV spectrophotometer according to the formula: plasmid copy number (copies / μL) = (plasmid concentration × 10 -9 ×6.02×10 23 ) / (660×plasmid length), and calculate its copy number.

[0108] μmol / μL

[0109] The OD260 / OD280 ratio of the MG-U positive plasmid was 2.01, the initial concentration was 277.1 ng / μL, and the copy number was 8.7344×10 10 copies / μL; MG F-36 positive plasmid OD260 / OD280 ratio was 2.00, initial concentration was 276.8ng / μL, and copy number was 9.0396×10 10 copies / μL; MG TS-11 positive plasmid OD260 / OD280 ratio was 2.02, initial concentration was 320.7ng / μL, and copy number was 9.0144×10 10 copies / μL; MG 6 / 85 positive plasmid OD260 / OD280 ratio was 2.00, initial concentration was 311.7ng / μL, and copy number was 10.238×10 10 The above four plasmids were diluted 10 times in a gradient manner to prepare the following standards:

[0110] Working standard 1, containing 8.7344×10 8 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0111] Working standard 2, containing 8.7344×10 7 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0112] Working standard 3, containing 8.7344×10 6 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0113] Working standard 4, containing 8.7344×10 5 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0114] Working standard 5, containing 8.7344×10 4 copies / μL, positive plasmid MG-U non-infectious DNA fragment;

[0115] Working standard 6, containing 8.7344×10 3 copies / μl positive plasmid MG-U non-infectious DNA fragment;

[0116] Working standard 7, containing 8.7344×10 2 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0117] Working standard 8, containing 8.7344×10 1 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0118] Working standard 9 contains 8.7344×10 0 copies / μL positive plasmid MG-U non-infectious DNA fragment;

[0119] Working standard 10, containing 9.0396×10 8 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0120] Working standard 11, containing 9.0396×10 7 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0121] Working standard 12, containing 9.0396×10 6 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0122] Working standard 13, containing 9.0396×10 5 copies / μL, positive plasmid MG F-36 non-infectious DNA fragment;

[0123] Working standard 14, containing 9.0396×10 4 copies / μl positive plasmid MG F-36 non-infectious DNA fragment;

[0124] Working standard 15, containing 9.0396×10 3 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0125] Working standard 16, containing 9.0396×10 2 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0126] Working standard 17, containing 9.0396×10 1copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0127] Working standard 18, containing 9.0396×10 0 copies / μL positive plasmid MG F-36 non-infectious DNA fragment;

[0128] Working standard 19, containing 9.0144×10 8 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0129] Working standard 20, containing 9.0144×10 7 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0130] Working standard 21, containing 9.0144×10 6 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0131] Working standard 22, containing 9.0144×10 5 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0132] Working standard 23, containing 9.0144×10 4 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0133] Working standard 24, containing 9.0144×10 3 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0134] Working standard 25, containing 9.0144×10 2 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0135] Working standard 26, containing 9.0144×10 1 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0136] Working standard 27, containing 9.0144×10 0 copies / μL positive plasmid MG TS-11 non-infectious DNA fragment;

[0137] Working standard 28, containing 10.238×10 8copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0138] Working standard 29, containing 10.238×10 7 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0139] Working standard 30, containing 10.238×10 6 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0140] Working standard 31, containing 10.238×10 5 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0141] Working standard 32, containing 10.238×10 4 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0142] Working standard 33, containing 10.238×10 3 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0143] Working standard 34, containing 10.238×10 2 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0144] Working standard 35, containing 10.238×10 1 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment;

[0145] Working standard 36, containing 10.238×10 0 copies / μL positive plasmid MG 6 / 85 non-infectious DNA fragment.

[0146] 2.2 Sensitivity test

[0147] The primers and probes selected in Example 1 were used to prepare a reaction system, and a series of working standards and negative controls (components of which were nuclease-free water) were tested and a standard curve was drawn. The specific steps were as follows:

[0148] 1) Preparation of fluorescent PCR reaction system: dilute each forward primer, reverse primer and probe to 10 μmol / μL with ddH2O; each tube of reaction solution is 20 μL, containing 2×Premix Ex Taq TM(Probe qPCR) 10.0 μL, MG-U_F 0.5 μL, MG-U_R 0.5 μL, MG F-36_F 0.3 μL, MG F-36_R 0.3 μL, MG TS-11_F 0.3 μL, MG TS-11_R 0.3 μL, MG 6 / 85_F 0.3 μL, MG 6 / 85_R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, MG-U DNA template 1 μL, MG F-36 DNA template 1 μL, MG TS-11 DNA template 1 μL, MG 6 / 85 DNA template 1 μL, finally add ddH2O to make up to 20.0 μL;

[0149] 2) Fluorescence PCR reaction system amplification: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 15 seconds, 48°C annealing for 30 seconds (HEX, FAM, CY5, and ROX fluorescence signals were collected at the end of each cycle), for a total of 40 cycles;

[0150] 3) Result determination: The threshold setting principle is that the threshold line just exceeds the highest point of the amplification curve of the normal negative control; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged to be negative; if the Ct value of the sample to be tested is ≤35 and there is a specific amplification curve, the result is judged to be positive, among which a HEX signal is judged as MG-U nucleic acid positive, a FAM signal is judged as MG F-36 nucleic acid positive, a CY5 signal is judged as MG TS-11 nucleic acid positive, and a ROX signal is judged as MG 6 / 85 nucleic acid positive.

[0151] The sensitivity of this method for detecting MG-U was evaluated using working standards 1 to 9 and negative controls. Figure 6 As shown. Working standards 1 to 8 only showed typical amplification curves of HEX signals, while working standard 9 and negative control had no amplification curves. The results showed that the minimum detection limit of MG-U using this method was working standard 8, and the sensitivity was 8.7344×10 1 copies / μL. Use working standards 1-8 to draw a standard curve, such as Figure 7 As shown, the linear equation of the standard curve is: y = -3.264x + 39.301, R 2 =0.999, amplification efficiency E=102.458%.

[0152] The sensitivity of this method for detecting MG F-36 was evaluated using working standards 10 to 18 and negative controls. The results are as follows: Figure 8As shown. Working standards 10 to 17 only showed typical amplification curves of ROX signals, while working standard 18 and negative control had no amplification curves. The results showed that the minimum detection limit of MG F-36 was working standard 17, and the sensitivity was 9.0396×10 1 Use 10 to 17 working standards to draw a standard curve, such as Fig. 9 As shown, the linear equation of the standard curve is: y = -3.375x + 38.116, R 2 =0.999, amplification efficiency E=97.824%.

[0153] The sensitivity of this method for detecting MG TS-11 was evaluated using working standards 19 to 27 and negative controls. The results are as follows: Fig.10 As shown in the figure, only the typical amplification curves of CY5 signal appeared in working standards 19 to 26, while no typical amplification curves were observed in working standard 27 and negative control. The results showed that the minimum detection limit of MG TS-11 was working standard 26, and the sensitivity was 9.0144×10 1 copies / μL. Use working standards 19 to 26 to draw a standard curve, such as Fig.11 As shown, the linear equation of the standard curve is: y = -3.379x + 38.052, R 2 =0.998, amplification efficiency E=97.664%.

[0154] The sensitivity of this method for detecting MG 6 / 85 was evaluated using working standards 28 to 36 and negative controls. Fig.12 As shown in the figure, only the typical amplification curves of ROX signal appeared in working standard samples 28 to 35, while no typical amplification curves were observed in working standard sample 36 and negative control. The results showed that the minimum detection limit of MG 6 / 85 was working standard sample 35, and the sensitivity was 10.238×10 1 copies / μL. Use working standard 28 to 36 to draw a standard curve, such as Fig.13 As shown, the linear equation of the standard curve is: y = -3.266x + 37.83, R 2 =0.999, amplification efficiency E=102.406%.

[0155] The above results show that the method has high sensitivity in detecting four mycoplasmas: MG-U, MG F-36, MG TS-11 and MG 6 / 85. Fig.14 , and there is a good linear relationship between the template concentration and the detection value within the detection range.

[0156] Example 3: Repeatability test

[0157] The reaction system was prepared using the primers and probes designed in Example 1. The working standards 3-7, 12-16, 21-25 and 30-34 prepared in Example 2 were tested by fluorescence PCR five times to calculate the inter-batch coefficient of variation: the test was repeated three times in the same fluorescence PCR to calculate the intra-batch coefficient of variation. The coefficient of variation of the Ct values ​​between and within the batch was calculated according to the coefficient of variation CV% = (standard deviation SD / mean value Mean) × 100%. The specific steps are as follows:

[0158] 1) Preparation of fluorescent PCR reaction system: dilute each forward primer, reverse primer and probe to 10 μmol / μL with ddH2O; each tube of reaction solution is 20 μL, 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MGF-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, MG-U DNA template 1 μL, MG F-36 DNA template 1 μL, MG TS-11 DNA template 1 μL, MG 6 / 85 DNA template 1 μL, finally add ddH2O to make up to 20.0 μL;

[0159] 2) Fluorescence PCR reaction system amplification: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 15 seconds, 48°C annealing for 30 seconds (HEX, FAM, CY5, and ROX fluorescence signals were collected at the end of each cycle), for a total of 40 cycles;

[0160] 3) Result determination: The threshold setting principle is that the threshold line just exceeds the highest point of the amplification curve of the normal negative control; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged to be negative; if the Ct value of the sample to be tested is ≤35 and there is a specific amplification curve, the result is judged to be positive, among which a HEX signal is judged as MG-U nucleic acid positive, a FAM signal is judged as MG F-36 nucleic acid positive, a CY5 signal is judged as MG TS-11 nucleic acid positive, and a ROX signal is judged as MG 6 / 85 nucleic acid positive.

[0161] The working standards 3-7, 12-16, 21-25 and 30-34 were tested repeatedly. The results are shown in Table 2. The intra-batch and inter-batch repeatability of the working standards 3-7, 12-16, 21-25, 30-34 were 0.19%≤intra-batch coefficient of variation≤1.68%, and 0.25%≤inter-batch coefficient of variation≤2.41%, indicating that this method has good repeatability.

[0162] Table 2 Intra-batch and inter-batch repeatability test table of quadruple qPCR method

[0163]

[0164]

[0165] Example 4: Specificity test

[0166] 4.1 Verify the applicability of the universal MG-U primer and probe combination using wild-type and vaccine strain DNA templates. Take 4 reaction tubes, and use the MG-U primers and probes designed in Example 1 in each tube to prepare a fluorescent PCR reaction system: 2×Premix ExTaq TM (Probe qPCR) 10.0μL; MG-U_F / R 0.5μL (0.25μmol / μL), MG-U_P 0.2μL (0.10μmol / μL); add 2.0μL of prepared MG-R, MG F-36, MG TS-11, MG 6 / 85 DNA templates to each tube, and finally add ddH2O to make up to 20.0μL.

[0167] 4.2 Verify the specificity of this method using wild strain DNA template. Use the MG-U, MG F-36, MG TS-11, MG 6 / 85 primers and probes designed in Example 1 to prepare a fluorescent PCR reaction system: 2× Premix Ex Taq TM (Probe qPCR) 10.0μL; MG-U_F / R 0.5μL (0.25μmol / μL), MG-U_P 0.2μL (0.10μmol / μL); MG F-36_F / R 0.3μL (0.15μmol / μL), MG F-36_P 0.10μL (0.05μmol / μL); MG TS-11_F / R 0.3μL (0.15μmol / μL), MG TS-11_P 0.10μL (0.05μmol / μL); MG 6 / 85_F / R 0.3μL (0.15μmol / μL), MG 6 / 85_P 0.10μL (0.05μmol / μL); containing prepared MG-R 2.0 μL of DNA template was added, and finally ddH2O was added to make up to 20.0 μL.

[0168] 4.3 Verify the specificity of this method with poultry-related pathogens. The primers and probes designed in Example 1 were used to prepare the reaction system, and the Newcastle disease virus lasota strain, chicken synoviae Mycoplasma MS-H strain, Salmonella enterica serovar Typhi ATCC54003 strain, avian Escherichia coli O78 type SH strain, H9 subtype avian influenza virus SS strain, chicken infectious bronchitis virus H120 strain, avian Pasteurella multocida inactivated vaccine (1502 strain), SPF chicken-derived blood, SPF chicken-derived saliva, SPF chicken-derived skin tissue, as well as positive controls (components are prepared MG-U, MG F-36, MG TS-11, MG 6 / 85 DNA template mixture) and negative controls (components are nuclease-free water) were tested. Fluorescence PCR reaction system preparation: 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MG F-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, add 2 μL of the DNA template of the sample to be tested, and finally add ddH2O to make up to 20.0 μL;

[0169] 4.4 Source of materials: MG F-36 strain, virulent strain MG-R, and infectious bronchitis virus H120 strain were derived from commercial vaccines on the market and produced by Qingdao Yibang Biotechnology Co., Ltd.; MG TS-11 strain and Mycoplasma synoviae MS-H strain were derived from commercial vaccines on the market and produced by Australian Bioresources; MG 6 / 85 strain was derived from commercial vaccines on the market and produced by Intervet USA; avian Pasteurella multocida inactivated vaccine (strain 1502) and Newcastle disease virus lasota strain were derived from commercial vaccines on the market, and blood, saliva, and skin tissue samples from SPF chickens were provided by Guangxi Lichengdong Biological Co., Ltd.; avian Escherichia coli O78 type SH strain was derived from commercial vaccines on the market and produced by Pulike Bioengineering Co., Ltd.; H9 subtype avian influenza virus SS strain was derived from commercial vaccines on the market and produced by Zhaoqing Dahuanong Biological Pharmaceutical Co., Ltd.; and Salmonella enterica serovar Typhi ATCC54003 strain was preserved by the Guangxi Animal Disease Prevention and Control Center.

[0170] 4.5 The specific steps are as follows:

[0171] 4.5.1 Preparation of specific samples: Whole blood, saliva, skin tissue, bacteria, virus samples, etc. were processed and directly extracted manually using the commercial TaKaRa MiniBEST Viral RNA / DNAExtraction kit Ver.5.0DNA kit, which was sourced from Bio-Rad Biotechnology Co., Ltd. (Code No.9766). The nucleic acid samples obtained were stored at -20°C for future use. The prepared DNA templates of MG-U, MG F-36, MG TS-11, and MG 6 / 85 were appropriately diluted for positive control.

[0172] 4.5.2 Detection of specific samples:

[0173] 1) The reaction solution is prepared as described in 4.1, 4.2, and 4.3 of Example 4 for the fluorescent PCR reaction system;

[0174] 2) Fluorescence PCR reaction system amplification: 95°C pre-denaturation for 30 s, 95°C denaturation for 15 s, 48°C annealing for 30 s (HEX, FAM, CY5, and ROX fluorescence signals were collected at the end of each cycle), for a total of 40 cycles;

[0175] 3) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the normal negative control amplification curve; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤35, and a specific amplification curve appears, the result is judged as MG positive; at the same time, if the Ct value of any one or more channels of the vaccine strains such as F-36, TS-11 or 6 / 85 is ≤35 and a specific amplification curve appears, the MG vaccine strain is judged to be positive; if the three vaccine strain channels have no Ct value or the Ct value is >35, and there is no specific amplification curve, it is judged to be MG wild strain positive.

[0176] The results are as follows Fig.15 The Ct values ​​of MGR, MG F-36, MG TS-11, and MG 6 / 85 DNA added to the four tubes of MG-U channel were all ≤35, and specific amplification curves appeared. The results showed that MG-U could detect the strong wild strain MG-R as well as the vaccine strains MG F-36, MG TS-11, and MG 6 / 85.

[0177] The results are as follows Fig.16, MG-U channel Ct value ≤ 35, and a specific amplification curve appeared; MG F-36, MG TS-11, MG6 / 85 channels had no Ct value or Ct value > 35, and no specific amplification curve. The results showed that the specific primer probes of vaccine strains MG F-36, MG TS-11, and MG 6 / 85 could not detect the strong strain MG-R, while the MG-U primer probe detected the strong strain MG-R.

[0178] The results are as follows Fig.17 In the positive control, the MG-U template only showed a typical amplification curve of HEX signal, the MG F-36 template only showed a typical amplification curve of FAM signal, the MG TS-11 template only showed a typical amplification curve of CY5 signal, and the MG 6 / 85 template only showed a typical amplification curve of ROX signal. No amplification signal was found in the negative control, indicating that the experiment was established. In this experiment, no amplification signal was found in the detection of Newcastle disease virus lasota strain, chicken synoviae Mycoplasma MS-H strain, Salmonella enterica serovar Typhimurium ATCC54003 strain, avian Escherichia coli O78 type SH strain, H9 subtype avian influenza virus SS strain, chicken infectious bronchitis virus H120 strain, avian Pasteurella multocida inactivated vaccine (1502 strain), SPF chicken blood, SPF chicken saliva, and SPF chicken skin tissue sample nucleic acid. The results showed that this method had no cross-reaction in the detection of related bacteria, viruses and samples from healthy animals, and had good specificity.

[0179] Example 6: Detection of actual clinical field samples

[0180] The primers and probes designed in Example 1 were used to prepare the reaction system, and the clinical samples collected from clinically suspected MG infection and the positive control (the components were the working standard samples 6, 15, 24, and 33 prepared in Example 2, all at a concentration of 10 3 ) and negative control (component is nuclease-free water) for detection, and the PCR product is sequenced and identified. The specific steps are as follows:

[0181] Preparation of clinical samples: A total of 200 pharyngeal swab samples of cleft palate chickens not clinically immunized with MG were collected from three random live poultry stalls in Sanjin Live Poultry Market in Nanning; a total of 30 nucleic acid samples of cleft palate pharyngeal swabs of SPF chickens collected one week after immunization with MG F-36 attenuated vaccine strain, a total of 30 nucleic acid samples of cleft palate pharyngeal swabs of SPF chickens collected one week after immunization with MG TS-11 attenuated vaccine strain, and a total of 30 nucleic acid samples of cleft palate pharyngeal swabs of SPF chickens collected one week after immunization with MG 6 / 85 attenuated vaccine strain. All SPF chickens in the immunized group were from Guangxi Lichengdong Biological Co., Ltd. The nucleic acid of cleft palate pharyngeal swab samples was directly extracted on a fully automatic nucleic acid extractor using a commercial DNA extraction kit, and the obtained nucleic acid samples were stored at -20℃ for later use.

[0182] Testing of clinical samples:

[0183] 1) Preparation of fluorescent PCR reaction system: dilute each forward primer, reverse primer and probe to 10 μmol / μL with ddH2O; each tube of reaction solution is 20 μL, containing 2×Premix Ex Taq TM (Probe qPCR) 10.0 μL, MG-U_F / R 0.5 μL, MG F-36_F / R 0.3 μL, MG TS-11_F / R 0.3 μL, MG 6 / 85_F F / R 0.3 μL, MG-U_P 0.2 μL, MG F-36_P 0.1 μL, MG TS-11_P 0.1 μL, MG 6 / 85_P 0.1 μL, add 2 μL of the DNA template of the sample to be tested, and finally add ddH2O to make up to 20.0 μL;

[0184] 2) Fluorescence PCR reaction system amplification: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 48°C for 30 s (while collecting HEX, FAM, CY5, and ROX fluorescence signals at the end of each cycle), for a total of 40 cycles;

[0185] 3) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the normal negative control amplification curve; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged as MG negative. If the Ct value of the MG-U channel of the sample to be tested is ≤35, and a specific amplification curve appears, the result is judged as MG positive; at the same time, if the Ct value of any one or more channels of the vaccine strains such as F-36, TS-11 or 6 / 85 is ≤35 and a specific amplification curve appears, the MG vaccine strain is judged to be positive; if the three vaccine strain channels have no Ct value or the Ct value is >35, and there is no specific amplification curve, it is judged to be MG wild strain positive.

[0186] The results are shown in Table 3. This method detected 30 nucleic acid samples from pharyngeal swabs of SPF chickens with cleft palate that were immunized with the MG F-36 vaccine strain, of which 26 were positive for MG-U and 26 were positive for the MG F-36 vaccine strain; 30 nucleic acid samples from pharyngeal swabs of SPF chickens with cleft palate that were immunized with the MGTS-11 vaccine strain, of which 23 were positive for MG-U and 23 were positive for the MG TS-11 vaccine strain; 30 nucleic acid samples from pharyngeal swabs of SPF chickens with cleft palate that were immunized with the MG 6 / 85 vaccine strain, of which 24 were positive for MG-U and 24 were positive for the MG 6 / 85 strain; 200 nucleic acid samples from pharyngeal swabs of cleft palate chickens with unclear clinical sources and not immunized with MG were detected, of which 142 were positive for MG-U, 32 were positive for the MGF-36 strain, 67 were positive for the MG TS-11 strain, 25 were positive for the MG 6 / 85 strain, and 18 were wild strains. All PCR products that tested positive were sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results were verified by BLAST comparison in Genebank. It was verified that the results of all sample review were consistent with the PCR test results and were in line with expectations.

[0187] Table 3: Actual clinical field sample test results

[0188]

[0189] In summary, the primer-probe combination of the present invention and the quadruple Taqman fluorescent PCR method using the primer-probe combination have high sensitivity, good specificity, simplicity and rapidity, and are suitable for the detection and identification of MG wild strains and vaccine strains MG F-36, MG TS-11, and MG 6 / 85 in my country.

[0190] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A quadruple fluorescent PCR primer-probe combination for distinguishing wild strains and vaccine strains of Mycoplasma gallisepticum, characterized in that: The primer-probe combination includes the following primer-probe groups: A universal primer-probe set for detecting MG, comprising: a forward primer MG-U_F as shown in SEQ ID NO: 1, a reverse primer MG-U_R as shown in SEQ ID NO: 2, and a probe MG-U_P as shown in SEQ ID NO: 9; A primer probe set for detecting MG vaccine strain F-36, comprising: a forward primer MG F-36_F as shown in SEQ ID NO:3, a reverse primer MG F-36_R as shown in SEQ ID NO:4, and a probe MG F-36_P as shown in SEQ ID NO:10; A primer probe set for detecting MG vaccine strain TS-11, comprising: a forward primer MG TS-11_F as shown in SEQ ID NO:5, a reverse primer MG TS-11_R as shown in SEQ ID NO:6, and a probe MG TS-11_P as shown in SEQ ID NO:11; The primer probe set for detecting MG vaccine strain 6 / 85 comprises: a forward primer MG 6 / 85_F as shown in SEQ ID NO:7, a reverse primer MG 6 / 85_R as shown in SEQ ID NO:8 and a probe MG 6 / 85_P as shown in SEQ ID NO:

12.

2. The quadruple fluorescent PCR primer-probe combination according to claim 1, characterized in that: The probe MG-U_P, the probe MG F-36_P, the probe MG TS-11_P and the probe MG 6 / 85_P are respectively labeled with modification groups that exhibit different fluorescent colors.

3. A quadruple fluorescent PCR reaction system for identifying wild strains and vaccine strains of Mycoplasma gallisepticum, characterized in that: Comprising the primer-probe combination of claim 1 or 2.

4. The quadruple fluorescent PCR reaction system according to claim 3, characterized in that: In the reaction system, the concentrations of the forward primer MG-U_F and the reverse primer MG-U_R are 0.2-0.3 μmol / μL, and the concentration of the probe MG-U_P is 0.05-0.15 μmol / μL; The concentration of the forward primer MG F-36_F and the reverse primer MG F-36_R is 0.1-0.2 μmol / μL, and the concentration of the probe MG F-36_P is 0.03-0.08 μmol / μL; The concentration of the forward primer MG TS-11_F and the reverse primer MG TS-11_R is 0.1-0.2 μmol / μL, and the concentration of the probe MG TS-11_P is 0.03-0.08 μmol / μL; The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R are 0.1-0.2 μmol / μL, and the concentration of the probe MG 6 / 85_P is 0.03-0.08 μmol / μL.

5. The quadruple fluorescent PCR reaction system according to claim 4, characterized in that: In the reaction system, the concentration of the forward primer MG-U_F and the reverse primer MG-U_R is 0.25 μmol / μL, and the concentration of the probe MG-U_P is 0.1 μmol / μL; The concentration of the forward primer MG F-36_F and the reverse primer MG F-36_R was 0.15 μmol / μL, and the concentration of the probe MG F-36_P was 0.05 μmol / μL; The concentrations of the forward primer MG TS-11_F and the reverse primer MG TS-11_R were 0.15 μmol / μL, and the concentration of the probe MGTS-11_P was 0.05 μmol / μL; The concentrations of the forward primer MG 6 / 85_F and the reverse primer MG 6 / 85_R were 0.15 μmol / μL, and the concentration of the probe MG 6 / 85_P was 0.05 μmol / μL.

6. Use of the quadruple fluorescent PCR primer-probe combination according to claim 1 in the preparation of a product for simultaneously identifying wild strains and vaccine strains of Mycoplasma gallisepticum.

7. Use of the quadruple fluorescent PCR primer-probe combination of claim 1 or the quadruple fluorescent PCR reaction system of claim 2 or 3 in the simultaneous detection and identification of wild strains and vaccine strains of Mycoplasma gallisepticum for non-disease diagnosis or treatment purposes.

8. The use according to claim 7, characterized in that: The vaccine strains are MG F-36, TS-11, and 6 / 85.

9. A quadruple fluorescence PCR detection method for distinguishing wild strains and vaccine strains of Mycoplasma gallisepticum for non-disease diagnosis or treatment purposes, characterized in that: The following steps are involved: (1) Preparation of fluorescent PCR reaction system: adding DNA template of the sample to be tested, and adding the quadruple fluorescent PCR primer probe combination described in any one of claims 1 to 2 to prepare a quadruple fluorescent PCR reaction system; (2) Fluorescence PCR reaction system amplification; (3) Result determination: The threshold setting principle is that the threshold line just exceeds the highest point of the amplification curve of the normal negative control; if the sample to be tested has no Ct value or the Ct value is >35, and there is no specific amplification curve, the result is judged as MG negative; if the Ct value of the MG-U channel of the sample to be tested is ≤35 and a specific amplification curve appears, the result is judged as MG positive; at the same time, if the Ct value of any one or more channels of F-36, TS-11 or 6 / 85 vaccine strains is ≤35 and a specific amplification curve appears, the MG vaccine strain is judged to be positive; if the three vaccine strain channels have no Ct value or the Ct value is >35 and there is no specific amplification curve, the MG wild strain is judged to be positive.

10. The detection method according to claim 9, characterized in that: In the step (2), the detection reaction conditions are set as follows: pre-denaturation at 95° C. for 30 s; denaturation at 95° C. for 15 s, annealing at 48° C. for 30 s, for a total of 40 cycles; and collecting the fluorescence signal at the end of each cycle.

Images