Application of YTHDC1 gene as detection target and application of SNP (Single Nucleotide Polymorphism) molecular marker related to sheep monoembryonic multilambing traits

Abstract

The invention provides an application of a YTHDC1 gene as a detection target and an application of an SNP molecular marker related to a sheep monoembryonic multilambing character, and belongs to the technical field of molecular markers and genetic breeding. The invention provides an application of a YTHDC1 gene as a detection target. The lambing performance of the sheep to be detected can be determined by quickly typing the YTHDC1 genotype of the newborn sheep, so that the breeding ewes can be conveniently selected and remained. The invention further provides application of the SNP molecular marker related to the sheep single-birth multi-lambing character, based on sheep genome sequence information (Arv3.1), the SNP molecular marker is located on the 84064404bp site on the sixth chromosome of sheep, and A / G polymorphism exists. The SNP molecular marker disclosed by the invention is remarkably related to the single-birth high-lambing-number character of sheep, and individuals with GG-type polymorphic sites can be selected and remained in the production process of the sheep, so that the fecundity of a sheep group is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers and genetic breeding, and particularly relates to the application of a YTHDC1 gene as a detection target and the application of a SNP molecular marker related to the trait of multiple lambs in a single birth in sheep. Background Art

[0002] Sheep (Ovis aries) are mammals of the genus Ovis in the family Bovidae. Sheep meat is popular for its unique flavor and high protein content. The single lamb birth of sheep has greatly restricted the development of the mutton industry. Therefore, increasing the number of lambs per litter is an important measure to improve the efficiency of mutton breeding. At present, there is no report on the use of YTHDC1 gene as a detection target in sheep molecular markers and genetic breeding. Summary of the invention

[0003] The purpose of the present invention is to provide the application of the YTHDC1 gene as a detection target and the application of SNP molecular markers related to the sheep single-birth multiple-lamb trait. The YTHDC1 gene as a detection target can be used for the identification of the sheep single-birth multiple-lamb trait.

[0004] The present invention provides any of the following applications of the YTHDC1 gene as a detection target:

[0005] (1) Used for the breeding of sheep with multiple lambs per litter;

[0006] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0007] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0008] (4) For genetic improvement of sheep breeds;

[0009] The YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the version number of the sheep genome sequence information is Oar_v3.1, and the NCBI accession number is XM_012180084.1.

[0010] The present invention also provides any of the following applications of SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0011] (1) Used for the breeding of sheep with multiple lambs per litter;

[0012] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0013] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0014] (4) For genetic improvement of sheep breeds;

[0015] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the sheep genome sequence information version number is Oar_v3.1, and the NCBI accession number is XM_012180084.1;

[0016] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0017] The present invention also provides any of the following applications of primers for amplifying SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0018] (1) Used for the breeding of sheep with multiple lambs per litter;

[0019] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0020] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0021] (4) For genetic improvement of sheep breeds;

[0022] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1;

[0023] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0024] The present invention also provides any of the following applications of a reagent or kit containing primers for amplifying SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0025] (1) Used for the breeding of sheep with multiple lambs per litter;

[0026] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0027] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0028] (4) For genetic improvement of sheep breeds;

[0029] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1;

[0030] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0031] Preferably, the SNP molecular marker associated with the trait of multiple lambs per single birth in sheep is located at the 84064404bp position on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1.

[0032] Preferably, the primers include an upstream primer of the nucleotide sequence shown in SEQ ID NO.2, a downstream primer of the nucleotide sequence shown in SEQ ID NO.3 and an extension primer of the nucleotide sequence shown in SEQ ID NO.4.

[0033] The present invention also provides a method for breeding sheep with the trait of multiple lambs per litter, comprising the following steps:

[0034] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0035] 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA;

[0036] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0037] The present invention also provides a method for breeding a sheep strain with the trait of single-birth multiple lambs, comprising the following steps:

[0038] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0039] 2) selecting the individuals with genotype GG in step 1) as breeding ewes, and breeding the breeding ewes;

[0040] 3) detecting SNP molecular markers related to the trait of single-birth multiple lambs in sheep from the sheep bred in step 2), retaining individuals with the genotype of GG, eliminating individuals with the genotype of GA or AA, and then breeding to obtain a sheep strain with the trait of single-birth multiple lambs;

[0041] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0042] The present invention also provides a method for genetic improvement of sheep, comprising the following steps:

[0043] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0044] 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA;

[0045] 3) using the individuals with genotype GG in step 2) as breeding ewes, and continuing to select sheep individuals with genotype GG in the offspring, and eliminating individuals with genotype GA or AA; so as to increase the frequency of allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep;

[0046] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0047] The present invention also provides a method for screening sheep with the trait of single-birth multiple lambs, comprising the following steps:

[0048] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0049] 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of single-birth multiple lambs and is retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of single-birth multiple lambs and is eliminated;

[0050] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0051] The present invention provides any of the following applications of the YTHDC1 gene as a detection target: (1) for the breeding of sheep with multiple lambs per litter; (2) for the early prediction of sheep individuals with the multiple lambs per litter trait; (3) for the identification of sheep strains with the multiple lambs per litter trait; (4) for the genetic improvement of sheep breeds. In the present invention, the YTHDC1 gene can be used as a detection target for the identification of the multiple lambs per litter trait in sheep. The lambing performance of the sheep to be tested can be determined by rapid typing of the YTHDC1 genotype of newborn sheep, which is convenient for the selection of breeding ewes.

[0052] The present invention also provides any of the following applications of SNP molecular markers related to the trait of single-birth multiple lambs in sheep: (1) for breeding of single-birth multiple lambs in sheep; (2) for early prediction of sheep individuals with the trait of single-birth multiple lambs; (3) for identification of sheep strains with the trait of single-birth multiple lambs; (4) for genetic improvement of sheep breeds; (5) for YTHDC1 genotyping; the nucleotide sequence of the SNP molecular marker related to the trait of single-birth multiple lambs in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the trait of single-birth multiple lambs, and the genotype of the site with the polymorphism is AA, corresponding to the trait of no single-birth multiple lambs. The SNP molecular marker of the present invention is significantly correlated with the trait of high number of lambs produced in single-birth in sheep. In the sheep production process, individuals with the polymorphic site of GG type can be selected, thereby improving the reproductive capacity of the sheep population. The statistical data of the number of lambs born in three litters of Small-tailed Han sheep showed that the number of lambs born by the homozygous mutation type (GG) of the polymorphic site was significantly higher than that of the wild homozygous AA type and heterozygous type (P<0.01), indicating that the mutation of this site increased the lambing capacity of Small-tailed Han sheep. Therefore, by subsequently performing genotyping on the SNP molecular markers and selecting GG genotype individuals, sheep carrying the trait of multiple lambs can be screened out, providing a reliable tool for the selection of sheep breeds with multiple lambs per litter and improving the reproductive performance of the group. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0054] Figure 1 This is the flight mass spectrometry detection diagram of the product after amplification and extension in Example 1. DETAILED DESCRIPTION

[0055] The present invention provides any of the following applications of the YTHDC1 gene as a detection target:

[0056] (1) Used for the breeding of sheep with multiple lambs per litter;

[0057] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0058] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0059] (4) For genetic improvement of sheep breeds;

[0060] The YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the version number of the sheep genome sequence information is Oar_v3.1, and the NCBI accession number is XM_012180084.1.

[0061] The invention can determine the lambing performance of the sheep to be tested by quickly typing the YTHDC1 genotype of the newborn sheep, which is convenient for selecting and retaining breeding sheep.

[0062] The present invention also provides any of the following applications of SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0063] (1) Used for the breeding of sheep with multiple lambs per litter;

[0064] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0065] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0066] (4) For genetic improvement of sheep breeds;

[0067] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the sheep genome sequence information version number is Oar_v3.1, and the NCBI accession number is XM_012180084.1;

[0068] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0069] In the present invention, the nucleotide sequence shown in SEQ ID NO.1 is specifically: (5' to 3')

[0070] GACGTTTCTCCCTTTTTTCATTTTGTAAATTACTGCTTTCTTATTCCAGG AR(A / G)ATTGAACTTGAATGTGGAACCCAGCTTTGTCTTCTATTTCCCCCTGATGAAA.

[0071] In the present invention, the 52nd position is the 52nd position from the 5' end.

[0072] In the specific implementation process of the present invention, the SNP molecular marker related to the trait of single-birth multiple lambs in sheep is located at the 84064404bp position on chromosome 6 of the sheep, and the sheep genome sequence information version number is Oar_v3.1; the SNP molecular marker is significantly correlated with the trait of high lamb number per birth in sheep, and can be used for breeding new breeds of single-birth multiple lambs sheep and improving the reproductive capacity of sheep populations.

[0073] The present invention also provides any of the following applications of primers for amplifying SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0074] (1) Used for the breeding of sheep with multiple lambs per litter;

[0075] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0076] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0077] (4) For genetic improvement of sheep breeds;

[0078] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep (NC_019463.1), and the version number of the sheep genome sequence information is Oar_v3.1;

[0079] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0080] In the present invention, the primers are based on Sequenom SNP technology is used to amplify primers for SNP molecular markers related to the trait of single-birth multiple lambs in sheep.

[0081] In the specific implementation of the present invention, the primers include an upstream primer (F) of the nucleotide sequence shown in SEQ ID NO.2, a downstream primer (R) of the nucleotide sequence shown in SEQ ID NO.3, and an extension primer (E) of the nucleotide sequence shown in SEQ ID NO.4. The primers provided by the present invention for amplifying SNP molecular markers related to the trait of single-birth multiple lambs in sheep have high detection sensitivity, good accuracy and stability, and high cost performance. The SNP molecular markers can be automatically detected, and tens to hundreds of SNP sites in hundreds to thousands of samples can be detected at the same time. The operation is more convenient and the detection results are true and reliable.

[0082] In the specific implementation of the present invention, the primers are synthesized by Beijing Compson Biotechnology Co., Ltd.

[0083] The present invention also provides any of the following applications of a reagent or kit containing primers for amplifying SNP molecular markers associated with the trait of multiple lambs per litter in sheep:

[0084] (1) Used for the breeding of sheep with multiple lambs per litter;

[0085] (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs;

[0086] (3) Used for identification of sheep strains with the trait of single-birth multiple lambs;

[0087] (4) For genetic improvement of sheep breeds;

[0088] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1;

[0089] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0090] In the specific implementation process of the present invention, the reagent or kit also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme and SNP molecular marker standard positive template.

[0091] The present invention also provides a method for breeding sheep with the trait of multiple lambs per litter, comprising the following steps:

[0092] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0093] 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA;

[0094] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0095] In the sheep production process, the present invention can select individuals whose genotype at the polymorphic site is GG type, thereby improving the reproductive capacity of the sheep population.

[0096] The present invention also provides a method for breeding a sheep strain with the trait of single-birth multiple lambs, comprising the following steps:

[0097] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0098] 2) selecting the individuals with genotype GG in step 1) as breeding ewes, and breeding the breeding ewes;

[0099] 3) detecting SNP molecular markers related to the trait of single-birth multiple lambs in sheep from the sheep bred in step 2), retaining individuals with the genotype of GG, eliminating individuals with the genotype of GA or AA, and then breeding to obtain a sheep strain with the trait of single-birth multiple lambs;

[0100] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0101] The present invention also provides a method for genetic improvement of sheep, comprising the following steps:

[0102] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0103] 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA;

[0104] 3) using the individuals with genotype GG in step 2) as breeding ewes, and continuing to select sheep individuals with genotype GG in the offspring, and eliminating individuals with genotype GA or AA; so as to increase the frequency of allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep;

[0105] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0106] The present invention also provides a method for screening sheep with the trait of single-birth multiple lambs, comprising the following steps:

[0107] 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested;

[0108] 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of single-birth multiple lambs and is retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of single-birth multiple lambs and is eliminated;

[0109] Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

[0110] In the specific implementation process of the present invention, the detection of SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested includes the following steps:

[0111] Extract the genomic DNA of the sheep to be tested; use the genomic DNA of the sheep to be tested as a template, and adopt the upstream primer and the downstream primer in the primers described in the above scheme to carry out PCR reaction to obtain PCR products; digest the PCR products with SAP enzyme to obtain digestion products; use the digestion products as a template, and adopt the extension primer in the primers described in the above scheme to carry out extension reaction to obtain extension products; use matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology to analyze the extension products, and determine the genotype of SNP molecular markers related to the single-birth multiple-lamb trait of sheep.

[0112] The present invention has no particular limitation on the method for extracting the genomic DNA of the sheep to be tested. In the specific implementation of the present invention, the phenol-chloroform method is used to extract the genomic DNA.

[0113] In the specific implementation process of the present invention, the reaction system of the PCR reaction is 5 μL, including 1 μL of genomic DNA with a concentration of 10 ng / μL, 0.5 μL of 10×PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2 solution, 0.1 μL of 25 μmol / L dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL of 10 pmol / L upstream primer and downstream primer respectively, and 1.8 μL of deionized water; the reaction procedure of the PCR reaction is: pre-denaturation at 95°C for 2 min; 95°C for 20 s, annealing at 58°C for 30 s, extension at 72°C for 60 s, 40 cycles; extension at 72°C for 5 min.

[0114] In the specific implementation process of the present invention, the reaction system of the extension reaction is 2 μL, including 10×iplexBufferPlus 0.2 μL, iplex Terminator 0.2 μL, 0.6-1.3 μmol / Lprimermix 0.94 μL, and iplexEnzyme 0.041 μL; the reaction procedure of the extension reaction is: 95°C, 30 s; 95°C, 5 s, (52°C, 5 s, 80°C, 5 s, 5 cycles), 40 cycles; 72°C, 3 min.

[0115] In the specific implementation process of the present invention, the breed of sheep is small-tailed Han sheep.

[0116] The above scheme in the present invention can realize automatic detection of the SNP site, and in the process of sheep breeding and practical production, GG homozygous individuals can be selected and retained, thereby improving the reproductive capacity of sheep, and has potential application value for large-scale molecular breeding of sheep.

[0117] To further illustrate the present invention, the application of the YTHDC1 gene provided by the present invention as a detection target and the application of SNP molecular markers related to the single-birth multiple-lamb trait in sheep are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0118] Example 1

[0119] A method using Sequenom Method for detecting sheep YTHDC1 genotype using SNP technology and predicting the average number of lambs per litter in ewes

[0120] 1. Experimental Materials

[0121] 380 Small-tail Han sheep with lambing records were selected as test subjects.

[0122] 2. Reagents and instruments

[0123] Reagents: 10×PCR reaction buffer, 25mmol / LMgCl2 solution, 25μmol / LdNTPs, 5U / μLTaq DNA polymerase, amplification primers F and R, 10×iplex BufferPlus, iplex Terminator, 1μmol / Lprimermix, iplex Enzyme, deionized water, etc.;

[0124] Gene amplification: ABI 9700384Dual;

[0125] Mass spectrometry spotting: MassARRAY Nanodispenser RS1000;

[0126] Mass spectrometry: MassARRAY Compact System;

[0127] All reagents and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.

[0128] 3. Extraction of genomic DNA

[0129] Take 1 mL of sheep blood treated with EDTA-K2 anticoagulant, use red blood cell lysis buffer to lyse and remove red blood cells, then use lysis buffer to lyse other cells to release genomic DNA, and then use phenol chloroform method to extract genomic DNA.

[0130] 4. Use Sequenom SNP technology for genotyping

[0131] The primer combination was designed for the 84064404 bp site on sheep chromosome 6 (YTHDC1, NC_019463.1: 84,064,253-84,064,556) based on the sheep genome sequence information version number Oar_v3.1 (August 2012).

[0132] The nucleotide sequences of the PCR amplification primers are as follows:

[0133] SEQ ID NO.2(F): ACGTTGGATGGTCTATCAGACGTTTCTCCC;

[0134] SEQ ID NO.3(R): ACGTTGGATGAGCTGGGTTCCACATTCAAG;

[0135] SEQ ID NO. 4(E): TTCCAATTCAAGTTCAAT.

[0136] The above primers were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0137] The testing process is as follows:

[0138] 1. Extract the genomic DNA of the sheep to be tested;

[0139] 2. Using the genomic DNA of the sheep to be tested as a template, perform PCR amplification reaction using the above primers F and R;

[0140] 3. Digest the PCR amplification product with SAP enzyme;

[0141] 4. Using the digested PCR amplification product as a template, an extension reaction is performed using the extension primer E;

[0142] 5. Analyze the extension products to determine the ESR1 genotype of sheep.

[0143] The reaction system used in the PCR amplification reaction was (5 μL): 1 μL of 10 ng / μL genomic DNA, 0.5 μL of 10× PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2, 0.1 μL of 25 μmol / L dNTPs, 1 μL of 0.5 μmol / L PCR primer mixture (including 0.5 μL of primers F and R, and the concentrations of primers F and R were 10 pmol / L, respectively), 0.2 μL of 5 U / μL Taq DNA polymerase, and 1.8 μL of deionized water;

[0144] The amplification program of the PCR amplification reaction was: 95°C, 2 min; 95°C, 20 s, 56°C, 30 s, 72°C, 60 s, 40 cycles; 72°C, 5 min; and stored at 4°C.

[0145] The PCR amplification product was digested using the following SAP enzyme digestion system (2 μL): 10×SAP Buffer 0.17 μL, 1.7 U / μL SAP Enzyme 0.3 μL, and deionized water 1.53 μL;

[0146] The reaction conditions were: 37°C for 40 min, 85°C for 5 min, and storage at 4°C.

[0147] The extension reaction system was (2 μL): 10×iplex BufferPlus 0.2 μL, iplexTerminator 0.2 μL, 0.6-1.3 μmol / L primermix 0.94 μL, iplex Enzyme 0.041 μL;

[0148] The reaction conditions were: 95°C, 30 s; [95°C, 5 s, (52°C, 5 s, 80°C, 5 s, 5 cycles), 40 cycles]; 72°C, 3 min; and stored at 4°C.

[0149] The resin-purified extension products were transferred to a 384-well Spectro CHIP (Sequenom) chip for MALDI-TOF-MS (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) reaction. The mass spectrum peaks were detected using Typer4.0 software, and the genotype of the target site of each sample was interpreted based on the mass spectrum peak diagram.

[0150] The mass spectrometry analysis revealed that the size of the PCR amplification product was 106 bp, and the mass spectrometry detection results of the extension product were as follows: Figure 1 shown.

[0151] Statistical results:

[0152] The statistical results of different genotype analysis at the 84064404bp site on chromosome 6 of the tested sheep and the association analysis between different genotypes and the number of lambs born in Small Tail Han sheep are shown in Table 1.

[0153] Table 1 Association analysis between different genotypes at 84064404bp on chromosome 6 and the number of lambs born in Small-tail Han sheep

[0154]

[0155] Note: Different lowercase letters in the same column represent extremely significant differences (P<0.01).

[0156] It can be seen that the lambing performance of the sheep to be tested can be determined by typing the 84064404bp site on chromosome 6 of the sheep provided by the present invention; in practice, GG homozygous individuals can be selected and retained, which can significantly improve the reproductive capacity of sheep, and has potential application value for large-scale molecular breeding of sheep and large-scale production of meat sheep.

[0157] As can be seen from the above embodiments, the present invention provides a SNP molecular marker related to the trait of multiple lambs per litter in sheep and an application of a detection kit thereof, and specifically provides a method for detecting multiple lambs per litter using Sequenom The method of using SNP technology to detect the genotype of the SNP site of sheep has the advantages of higher sensitivity and accuracy.

[0158] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Any of the following applications of YTHDC1 gene as a detection target: (1) Used for the breeding of sheep with multiple lambs per litter; (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs; (3) Used for identification of sheep strains with the trait of single-birth multiple lambs; (4) For genetic improvement of sheep breeds; The YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the version number of the sheep genome sequence information is Oar_v3.1, and the NCBI accession number is XM_012180084.

1.

2. Any of the following applications of SNP molecular markers associated with the trait of multiple lambs per litter in sheep: (1) Used for the breeding of sheep with multiple lambs per litter; (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs; (3) Used for identification of sheep strains with the trait of single-birth multiple lambs; (4) For genetic improvement of sheep breeds; (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, the sheep genome sequence information version number is Oar_v3.1, and the NCBI accession number is XM_012180084.1; in, The nucleotide sequence of the SNP molecular marker associated with the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

3. Any of the following applications of primers for amplifying SNP molecular markers associated with the trait of multiple lambs per litter in sheep: (1) Used for the breeding of sheep with multiple lambs per litter; (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs; (3) Used for identification of sheep strains with the trait of single-birth multiple lambs; (4) For genetic improvement of sheep breeds; (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1; in, The nucleotide sequence of the SNP molecular marker associated with the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

4. Any of the following uses of a reagent or kit containing primers for amplifying SNP molecular markers associated with the trait of single birth and multiple lambs in sheep: (1) Used for the breeding of sheep with multiple lambs per litter; (2) Used for early prediction of sheep individuals with the trait of single-birth multiple lambs; (3) Used for identification of sheep strains with the trait of single-birth multiple lambs; (4) For genetic improvement of sheep breeds; (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at sites 84,064,253 to 84,064,556 on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.1; in, The nucleotide sequence of the SNP molecular marker associated with the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

5. The use according to any one of claims 2 to 4, characterized in that: The SNP molecular marker associated with the trait of single-birth multiple lambs in sheep is located at the 84064404bp position on chromosome 6 of sheep, and the version number of the sheep genome sequence information is Oar_v3.

1.

6. The use according to claim 3 or 4, characterized in that: The primers include an upstream primer of the nucleotide sequence shown in SEQ ID NO.2, a downstream primer of the nucleotide sequence shown in SEQ ID NO.3 and an extension primer of the nucleotide sequence shown in SEQ ID NO.

4.

7. A method for breeding sheep with the trait of multiple lambs per litter, characterized in that: The following steps are involved: 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested; 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA; Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

8. A method for breeding a sheep strain with the trait of single-birth multiple lambs, characterized in that: The steps include: 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested; 2) selecting the individuals with genotype GG in step 1) as breeding ewes, and breeding the breeding ewes; 3) detecting SNP molecular markers related to the trait of single-birth multiple lambs in sheep from the sheep bred in step 2), retaining individuals with the genotype of GG, eliminating individuals with the genotype of GA or AA, and then breeding to obtain a sheep strain with the trait of single-birth multiple lambs; Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

9. A method for genetic improvement of sheep, characterized in that: The steps include: 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested; 2) Retain individuals with genotype GG in step 1) and eliminate individuals with genotype GA or AA; 3) using the individuals with genotype GG in step 2) as breeding ewes, and continuing to select sheep individuals with genotype GG in the offspring, and eliminating individuals with genotype GA or AA; so as to increase the frequency of allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep; Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

10. A method for screening sheep with the trait of single-birth multiple lambs, characterized in that: The steps include: 1) Detecting SNP molecular markers related to the single-birth multiple-lamb trait in the sheep to be tested; 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of single-birth multiple lambs and is retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of single-birth multiple lambs and is eliminated; Among them, the nucleotide sequence of the SNP molecular marker related to the single-birth multiple-lamb trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the single-birth multiple-lamb trait, and the genotype of the site with the polymorphism is AA, corresponding to the non-single-birth multiple-lamb trait.

Images