Wheat Glu-B1 Bx7 subunit SNP (Single Nucleotide Polymorphism) molecular marker as well as detection method and application thereof

Abstract

The invention discloses a wheat Glu-B1Bx7 subunit SNP (Single Nucleotide Polymorphism) molecular marker as well as a detection method and application thereof, and belongs to the field of molecular biology. A KASP technology is utilized to specifically recognize a single nucleotide polymorphism (SNP) mutation site G / A in a Glu-B1Bx7 mutant gene; by means of the designed specific primer, the genotype of the Glu-B1Bx7 mutation site can be rapidly and accurately tracked and detected on the molecular level, and the mutant gene screening efficiency is effectively improved. The KASP primer provided by the invention can also effectively distinguish wheat varieties containing the Glu-B1Bx7 mutation site, is suitable for molecular marker-assisted selection in wheat breeding, and provides a gene resource for wheat quality improvement.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a wheat Glu-B1 Bx7 subunit SNP molecular marker and a detection method thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is a vital food crop worldwide. Its grains contain rich high-quality plant protein resources, which constitute the core protein supply source in the human diet. The quality characteristics of wheat are mainly affected by high molecular weight glutenins (HMW-GSs). Therefore, in-depth exploration and utilization of excellent HMW-GSs are of great value in improving wheat processing quality.

[0003] The composition and content of HMW-GSs play a crucial role in determining the processing quality of wheat. Studies have shown that the contribution of the Glu-1 locus in wheat to the processing quality is Glu-D1>Glu-B1≥Glu-A1, among which the Glu-B1 locus has extremely rich allelic variation, which makes an important contribution to the protein content. Studies have shown that the protein content and glutenin macropolymer content of the Glu-B1 Bx subunit deletion line showed a significant downward trend. The dough strength of overexpressing Glu-B1 Bx7 was significantly improved, thus showing excellent baking quality; while the lack of Glu-B1 Bx7 led to a weakening of gluten strength, but this change unexpectedly improved the quality characteristics of sugar crisp biscuits. Glu-B1 Bx7 has a significant contribution to the maintenance of dough elasticity and the improvement of processed products. Therefore, in-depth exploration of the allelic variation of the Glu-B1 Bx7 subunit can enrich the genetic resources of wheat quality breeding, which is of great significance for the next step of improving wheat processing quality. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a wheat Glu-B1 Bx7 subunit SNP molecular marker and a detection method thereof.

[0005] The technical solution of the present invention is: a KASP primer set, comprising a forward primer F1, a forward primer F2 and a universal reverse primer R, wherein the nucleotide sequence of the forward primer F1 is shown as SEQ ID No.1, the nucleotide sequence of the forward primer F2 is shown as SEQ ID No.2, and the nucleotide sequence of the universal reverse primer R is shown as SEQ ID No.3 or SEQ ID No.4.

[0006] A kit containing the KASP primer set described above.

[0007] Application of the above-mentioned KASP primer set or kit in breeding of wheat Glu-B1 Bx7 gene mutant materials.

[0008] Furthermore, the wheat Glu-B1 Bx7 gene mutation refers to the mutation of base 2263 of the Glu-B1 Bx7 gene on wheat chromosome 1 from the wild-type G to A, and the positioning reference version is the gene sequence with NCBI accession number X13927.3.

[0009] Furthermore, the SNP site is located at position 2263 of the Glu-B1 Bx7 gene on wheat chromosome 1. When the genotype of the site mutates from GG to AA, a specific subunit phenotype appears in the wheat HMW-GSs region. The positioning reference version is the gene sequence with NCBI accession number X13927.3.

[0010] Furthermore, the substance is the KASP primer set according to claim 1.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] 1. The present invention found that there is a single base missense mutation in the wheat Glu-B1 Bx7 gene. When the base at this site mutates from G to A, the wheat HMW-GSs region specifically expresses an extra subunit band, which is a new allelic variation and enriches the genetic resources for wheat quality breeding. By detecting the genotype of this site, wheat materials carrying the mutant gene can be quickly selected.

[0013] 2. The KASP molecular marker technology provided by the present invention can be used for the rapid screening of wheat Glu-B1 Bx7 mutant genes, which can effectively assist wheat quality breeding. By detecting the SNP sites in wheat Glu-B1 Bx7, the homozygous materials containing the Glu-B1 Bx7 mutant gene can be accurately determined, providing a molecular tool for the selection of wheat quality breeding materials.

[0014] 3. The KASP molecular marker detection method provided by the present invention not only improves the identification efficiency in the process of screening a large number of materials, but also effectively reduces the time cost and manpower investment of the experiment, and can provide a more efficient means for the breeding of wheat processing quality at the molecular level.

[0015] 4. The present invention can be used to select individual plants or varieties containing the Glu-B1 Bx7 mutant gene, further accelerating the wheat quality breeding process, and providing strong technical support for the continuous improvement and optimization of wheat quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electrophoretic profiles of HMW-GSs of WT and Mutant wheat detected by SDS-PAGE, the black arrows without tails indicate the positions of the bands of the expressed additional subunits;

[0017] Figure 2 It is the nucleotide sequence alignment of Glu-B1 Bx7 mutant gene of WT and Mutant (part of key sequence), and the black arrow without tail indicates the SNP mutation site;

[0018] Figure 3 The results of gene analysis of wheat samples detected by the primer set of KASP primers SEQ ID No. 1, 2 and 3 in the present invention, wherein the blue fluorescent signal with the HEX label indicates that the Glu-B1 Bx7 of the sample is a mutant, the orange fluorescent signal with the FAM label indicates that the Glu-B1 Bx7 of the sample is a wild type, the green fluorescent signal indicates that the Glu-B1Bx7 of the sample is a heterozygous type, and NTC indicates a negative control;

[0019] Figure 4 This is the gene analysis result of the wheat sample detected by the primer set of KASP primer SEQ ID No.1, 2 and 4 in the present invention, wherein the blue fluorescent signal with the HEX label indicates that the Glu-B1 Bx7 of the sample is a mutant, the orange fluorescent signal with the FAM label indicates that the Glu-B1 Bx7 of the sample is a wild type, the green fluorescent signal indicates that the Glu-B1Bx7 of the sample is a heterozygous type, and NTC represents the negative control. DETAILED DESCRIPTION

[0020] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0021] Example 1 Discovery of SNP Molecular Markers

[0022] Using EMS (Ethyl methyl sulfonate) to chemically induce common wheat, we screened out materials that specifically expressed additional subunit bands in the HMW-GSs region ( Figure 1 The mutant material was self-pollinated for several generations and stable genetic M5 offspring (named as Mutant) were obtained.

[0023] To further analyze its genetic basis, we sequenced the HMW-GSs region of Mutant, and the results showed that there was a single-base missense mutation (G / A) in Mutant's Glu-B1 Bx7 ( Figure 2 ), and the missense mutation was always closely linked to the HMW-GSs region-specific subunit phenotype. The SNP was located at position 2263 of the Glu-B1 Bx7 gene on wheat chromosome 1. The NCBI accession number of the Glu-B1 Bx7 gene was X13927.3.

[0024] The composition and content of HMW-GSs are key to wheat processing quality, among which the Glu-B1 locus has an important contribution to protein content. The identified Glu-B1 Bx7 is a new allele, which not only enriches the genetic resources of wheat quality breeding, but also has potential application value in the next step of wheat processing quality improvement. In order to study and utilize this SNP more efficiently, we urgently need to develop an efficient, accurate and reliable molecular marker technology.

[0025] Example 2 Detection of SNP Molecular Markers

[0026] (1) Based on the upstream and downstream sequences of the SNP site, KASP primers for detecting the genotype of the SNP site were designed:

[0027] KASP-F1: 5'- GAAGGTGACCAAGTTCATGCT AGCCCATACCATGTTAGCGCGG-3' (underline indicates FAM fluorescent group) (SEQ ID No. 1)

[0028] KASP-F2: 5'- GAAGGTCGGAGTCAACGGATT AGCCCATACCATGTTAGCGCGA-3' (underline indicates HEX fluorescent group) (SEQ ID No. 2)

[0029] Universal reverse-R1: 5'-CTTTAGGCGGGCCGCCTGGTACT-3' (SEQ ID No. 3)

[0030] or 5'-CTTTAGGCGGGCCGCCTGGTACT-3'(SEQ ID No.4)

[0031] The designed primers were sent to Chengdu Jiqingke Biotechnology Co., Ltd. for synthesis.

[0032] (2) The genomic DNA of the wheat sample to be tested was amplified by PCR using the KASP primers in (1). The genomic DNA of the wheat sample to be tested was diluted to a concentration of 100 ng / μL and amplified using a Bio-Rad fluorescent quantitative PCR instrument.

[0033] The amplification system was: 1 μL DNA template, 1.4 μL mixed KASP primers, 5 μL 2×KASP Master Mix, and water was added to make up to 10 μL.

[0034] The amplification program was as follows: pre-denaturation at 95°C for 15 min, followed by one round of PCR cycles, including denaturation at 95°C for 20 sec, gradient annealing and extension at 68°C for 60 sec, and 10 gradient cycles; then denaturation at 94°C for 20 sec, annealing and extension at 57°C for 60 sec, for 32 cycles; and finally, insulation at 12°C.

[0035] (3) Read the genotype through the fluorescence signal and use CFX96 Manager software to determine the genotype. If the above typing results are not ideal, you can optimize it by adding more PCR cycles. The program used is: 95℃ denaturation for 20 seconds, 55℃ extension for 60 seconds, and set 3 cycles.

[0036] Example 3 Verification of SNP Molecular Markers

[0037] Mutant and WT were backcrossed to obtain BC1F1, and BC1F2 seeds were obtained by further selfing. The BC1F2 seeds were planted in a greenhouse and genomic DNA was extracted as the material to be tested. The material to be tested was tested using the detection method of Example 2 to obtain the genotype of the SNP site ( Figure 3 and Figure 4 ). The genotype of the SNP site was compared with the SDS-PAGE pattern of BC1F2 fruiting seeds, and it was found that the actual result was basically consistent with the expected result of the protein phenotype, proving that the SNP of the present invention is closely linked to the specific subunit phenotype of the HMW-GSs region, and the KASP molecular marker of the present invention can be used to track and identify the Glu-B1 Bx7 mutant gene.

Claims

1. KASP primer set, characterized in that It comprises a forward primer F1, a forward primer F2 and a universal reverse primer R, wherein the nucleotide sequence of the forward primer F1 is shown as SEQ ID No.1, the nucleotide sequence of the forward primer F2 is shown as SEQ ID No.2, and the nucleotide sequence of the universal reverse primer R is shown as SEQ ID No.3 or SEQ ID No.

4.

2. A kit comprising the KASP primer set according to claim 1.

3. Use of the KASP primer set according to claim 1 or the kit according to claim 2 in breeding of wheat Glu-B1 Bx7 gene mutant materials.

4. The use according to claim 3, characterized in that: The wheat Glu-B1 Bx7 gene mutation refers to the mutation of the 2263rd base of the Glu-B1 Bx7 gene on wheat chromosome 1 from the wild type G to A, and the positioning reference version is the gene sequence with NCBI accession number X13927.

3.

5. Application of a material for detecting the genotype of a SNP site in the identification of a specific subunit phenotype in the HMW-GSs region of wheat. The SNP site is located at position 2263 of the Glu-B1 Bx7 gene on chromosome 1 of wheat. When the genotype of the site mutates from GG to AA, a specific subunit phenotype appears in the HMW-GSs region of wheat. The positioning reference version is the gene sequence with NCBI accession number X13927.

3.

6. The use according to claim 5, characterized in that: The substance is the KASP primer set according to claim 1.

Images