Short-chain ssDNA sequencing library construction method, sequencing method and application

Abstract

The invention relates to the field of DNA sequencing, in particular to a short-chain ssDNA sequencing library construction method, a sequencing method and application. The construction method of the sequencing library of the short-chain ssDNA comprises the following steps: a step of adding a polynucleotide tail: taking the short-chain ssDNA as a template, carrying out enzyme reaction by utilizing terminal deoxynucleotidyl transferase, and adding the polynucleotide tail at the 3'terminal of the short-chain ssDNA to obtain tailed short-chain ssDNA; carrying out PCR (Polymerase Chain Reaction) amplification on the short-chain ssDNA; a tail end repairing step; a linker connection step: taking the product obtained in the terminal repairing step as a template, carrying out a reaction by using ligase to obtain a template with a linker, and purifying the template with the linker; and a PCR enrichment and purification step of dsDNA: designing a second primer by taking a purified product obtained in the step of connecting the joints as a template, and carrying out PCR enrichment and purification to obtain the sequencing library. According to the short-chain ssDNA sequencing library construction method, the defects in the prior art are overcome, the short-chain ssDNA sequencing library construction method is not limited by ssDNA in a fixed state any more, and library construction of special ssDNA is achieved.

Description

Technical Field

[0001] The present invention relates to the field of DNA sequencing, and in particular to a method for constructing a sequencing library of short-chain ssDNA, a sequencing method and an application thereof. Background Art

[0002] The Next Generation Sequencing technology is the current mainstream high-throughput sequencing technology, represented by the Illumina sequencing platform using SBS and its related technologies. Compared with the first and third generation sequencing, it has high sequencing throughput, fast speed, high single-base accuracy, wide application development, efficient library preparation and easy automation, and has become a more commonly used means of obtaining sequence information in scientific research and clinical diagnosis.

[0003] The classic DNA library construction strategy is to fragment the long-chain dsDNA (Double-Stranded DNA), add sequencing adapters at both ends, and then enrich the library. However, for special samples of short-chain ssDNA (Single-Stranded DNA), especially ssDNA fixed on a carrier, due to the small number of molecules and short chain length, the connection is difficult and the library cannot be successfully constructed.

[0004] In the short ssDNA library construction method, the current methods mainly include: adding a short adapter at one end and then extending in reverse, adding a short adapter at the other end, and finally amplifying with primers with indexes. This method requires that the sequences are unconstrained at both ends and sequences can be added at will, but it is not applicable to sequences fixed on solid phase carriers.

[0005] CN110904512A discloses a method for constructing a high-throughput sequencing library suitable for single-stranded DNA. The method comprises: connecting a single-stranded template with a double-stranded adapter with degenerate bases (a special adapter with degenerate bases makes it possible to connect the single-stranded template with the double-stranded adapter, and the double-stranded adapter can be randomly bound to the single-stranded template, so that the adapter sequence and the template are sufficiently close, and then T4 DNA ligase is used to complete the connection); using an extension primer to extend to obtain a double-stranded product; connecting the double-stranded product with the adapter; using the obtained connection product as a template, PCR amplification is performed to obtain the desired library.

[0006] CN110791814A discloses a rapid single-strand library construction method, comprising the following steps: providing sample DNA, phosphorylating the sample DNA to obtain a single-strand DNA template; connecting the 3' end of the single-strand DNA template to a first linker, and then purifying it with a first magnetic bead to obtain a first connection product containing the first magnetic bead; connecting the 5' end of the first connection product to a second linker, and then purifying it with a second magnetic bead to obtain a second connection product containing the first magnetic bead and the second magnetic bead; performing PCR amplification on the second connection product with a universal primer to obtain a library; wherein the first linker and the second linker are double-stranded linkers.

[0007] It can be seen that the above-mentioned prior art also requires that there are no constraints on both ends of the sequence, and there are no relevant reports on the method for constructing a sequencing library for short-chain ssDNA on a solid phase carrier.

[0008] In view of this, this application is filed. Summary of the invention

[0009] The object of the present invention is to provide a method for constructing a sequencing library of short-chain ssDNA, a sequencing method and an application thereof, so as to solve at least one technical problem in the background technology.

[0010] Specifically, in the first aspect of the present application, a method for constructing a sequencing library of a short-chain ssDNA is provided, wherein the 5' end of the short-chain ssDNA is connected to a fixed carrier and the 3' end is an exposed end, and the method for constructing a sequencing library comprises the steps of: a step of adding a polynucleotide tail, using the short-chain ssDNA as a template, using terminal deoxynucleotidyl transferase to perform an enzyme reaction, adding a polynucleotide tail to the 3' end of the short-chain ssDNA, and obtaining a tailed short-chain ssDNA; PCR amplification steps of short-chain ssDNA: using the tailed short-chain ssDNA as a template, designing the first primer for PCR amplification reaction, and purifying the amplified product; End repair step: Using the purified amplified product as a template, perform 5' end repair and 3' end tailing reactions; Connector ligation step: using the product obtained in the end repair step as a template, using a ligase to react, obtaining a template with a connector, and purifying it; dsDNA PCR enrichment and purification step: using the purified product obtained in the adapter ligation step as a template, design a second primer for PCR enrichment and purification to obtain a sequencing library; It can be understood that the exposed end is in a state where sequence extension can be achieved.

[0011] Preferably, the short-chain ssDNA is 20-100 nt in length.

[0012] Preferably, in the step of adding a polynucleotide tail, the polynucleotide is polyadenine deoxyribonucleotide or polyguanine deoxyribonucleotide.

[0013] Preferably, in the step of adding a polynucleotide tail, when the polynucleotide is a polyadenylated deoxyribonucleotide, at least one of the second primers comprises a sequence segment identical to the primer body segment of the first primer, and the length of the sequence segment is at least 5 bp.

[0014] Preferably, in the step of adding a polynucleotide tail, when the polynucleotide is a polyadenosine deoxyribonucleotide, the second primer includes a first-stage primer for complementary amplification with the polyadenosine deoxyribonucleotide tail, and a second-stage primer for re-amplification, and at least one of the second-stage primers contains the same sequence segment as the first-stage primer, and the length of the sequence segment is at least 5 bp.

[0015] Preferably, in the step of adding the polynucleotide tail, the tailing reaction rate is controlled at 30-40 nt / min.

[0016] Preferably, in the PCR amplification step of the short-chain ssDNA, the first primer comprises a poly tail segment and a primer body segment, the poly tail segment is complementary to the polynucleotide tail, and the primer body segment is complementary to a partial sequence of the short-chain ssDNA.

[0017] Preferably, in the step of adding the polynucleotide tail, the enzyme reaction temperature is 29-31°C, the reaction time is 8-10 min, and finally the enzyme is inactivated at 96-99°C. More preferably, the enzyme reaction temperature is 30°C, the reaction time is 8-10 min, and finally the enzyme is inactivated at 98°C.

[0018] Preferably, the step of adding the polynucleotide tail comprises, by volume: 5× terminal deoxynucleotidyl transferase reaction buffer (terminal deoxynucleotidyl transferase buffer) 15-25 copies; Terminal deoxynucleotidyl transferase (TdT enzyme) 4-6 copies; 70-80 parts of enzyme-free water; 10 μM dNTP 1-3 copies.

[0019] More preferably, the step of adding the polynucleotide tail comprises, by volume: 5× terminal deoxynucleotidyl transferase reaction buffer (terminal deoxynucleotidyl transferase buffer) 20 copies; Terminal deoxynucleotidyl transferase (TdT enzyme) 5 copies; 73 parts of enzyme-free water; 10 μM dNTP 2 copies.

[0020] Preferably, the terminal deoxynucleotidyl transferase is muTdT enzyme from mouse.

[0021] Preferably, the dNTP is dATP or dGTP.

[0022] Preferably, the dsDNA PCR amplification step comprises, by volume: 40-45 parts of enzyme-free water; 2×PCR Buffer 45-55 copies; dNTP mix 1-3 parts; 1-3 copies of DNA polymerase; 3-5 copies of the first primer mixture.

[0023] More preferably, the PCR amplification step of the short-chain ssDNA comprises, by volume: 42 parts of enzyme-free water; 2×PCR Buffer 50 copies; dNTP mix 2 parts; DNA polymerase 2 copies; 4 copies of the first primer mixture.

[0024] Preferably, in the PCR amplification step of the short-chain ssDNA, the reaction conditions include the steps of: Place in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 2-4min, preferably 3min; Denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 10-20s, preferably 15s; Annealing stage: reaction temperature is 45-55°C, preferably 50°C, reaction time is 10-20s, preferably 15s; Extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 8-12s, preferably 10s; Final extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 4-6 min, preferably 5 min; Storage stage: temperature is 3-5°C, preferably 4°C.

[0025] The denaturation stage to the extension stage were performed for no less than 30 cycles, and the pre-denaturation stage and the storage stage were performed once each to obtain a dsDNA sample for library construction.

[0026] Preferably, the PCR amplification step of the short-chain ssDNA includes a purification step of the dsDNA sample for library construction, specifically including: Recover 50-150 copies of dsDNA samples for library construction by volume, add 150-200 copies of magnetic beads, mix by pipetting, and centrifuge at low speed to remove droplets on the wall of the reaction tube to evenly disperse the magnetic beads in the solution, and react at room temperature for 5-15 minutes; Place the reaction tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, remove the solution, rinse the tube wall with 60-85% alcohol, remove the solution, wait for the surface of the magnetic beads to dry without cracks, add 20-40μl enzyme-free water to mix the magnetic beads, and react at room temperature for 3-6 minutes; Place the reaction tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, and detect the nucleic acid concentration.

[0027] Preferably, in the purification step of the dsDNA sample for library construction, 100 dsDNA samples for library construction were recovered, 180 magnetic beads were added, and after pipetting and mixing, the droplets on the wall of the reaction tube were shaken off by low-speed centrifugation to evenly disperse the magnetic beads in the solution, and the reaction was carried out at room temperature for 10 minutes.

[0028] Preferably, in the purification step of the dsDNA sample for library construction, Place the reaction tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then aspirate the solution, rinse the tube wall with 80% alcohol, aspirate the solution, wait for the surface of the magnetic beads to dry without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0029] Preferably, in the end repair step, the 5' end repair reaction comprises, by volume: After purification, the amplification product is x copies. End prep Mix 10-20 copies, Ultrapure water (MQ) is added to 60-70 parts; Wherein, the x parts contain at least 0.02 parts by weight of the amplification product.

[0030] Preferably, in the end repair step, the 5' end repair reaction comprises, by volume: After purification, the amplification product is x copies. End prep Mix 15 parts, Ultrapure water (MQ) Make up to 65 parts.

[0031] Preferably, in the 5' end repair reaction, the reaction conditions include: The temperature of the end repair enzyme phosphorylation reaction is 18-22°C, and the reaction time is 12-18 minutes; the temperature of the A-tailing reaction is 64-66°C, and the reaction time is 12-16 minutes.

[0032] Preferably, in the 5' end repair reaction, the reaction conditions include: The temperature of the end repair enzyme phosphorylation reaction was 20°C and the reaction time was 15 min; the temperature of the A-tailing reaction was 65°C and the reaction time was 15 min.

[0033] Preferably, the connecting joint step comprises: The A tail at the 3' end of the product obtained in the end repair step is complementary connected to the thymine deoxyribonucleotide tail protruding at the 5' end of the adapter sequence, the reaction temperature is 18-22° C., the reaction time is 13-16 minutes, and the reaction solution includes by volume: 60-70 copies of end repair products, Rapid Ligation Buffer 20-30 copies, DNA ligase (Rapid DNA Ligase) 4-6 copies, DNA Adapter: 4-6 copies.

[0034] Preferably, the reaction conditions in the step of connecting the joint are: reaction temperature is 20° C., and reaction time is 15 min.

[0035] Preferably, the reaction solution in the step of connecting the joint comprises: 65 end-repair products, Rapid Ligation Buffer 25 copies, DNA ligase (Rapid DNA Ligase) 5 copies, DNA Adapter 5 copies.

[0036] Preferably, in the PCR enrichment and purification step, the reaction solution comprises, by volume: 18-22 parts of the joint product, PCR Primer Mix 4-6 copies, Amplification mixture (VAHTS HiFi Amplification Mix) 20-30 copies, The amplification mixture includes a second primer.

[0037] Preferably, in the dsDNA PCR enrichment and purification step, the reaction solution comprises, by volume: 20 parts of the connecting joint product, PCR Primer Mix 5 copies, Amplification mixture (VAHTS HiFi Amplification Mix) 25 copies.

[0038] Preferably, in the dsDNA PCR enrichment and purification step, the reaction conditions include the steps of: Place in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 2-4min, preferably 3min; Denaturation stage: reaction temperature is 97-99°C, preferably 98°C, reaction time is 15-25s, preferably 20s; Annealing stage: reaction temperature is 55-65°C, preferably 60°C, reaction time is 10-20s, preferably 15s; Extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 25-35s, preferably 30s; Final extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 4-6 min, preferably 5 min; Storage stage: temperature is 3-5°C, preferably 4°C.

[0039] The denaturation stage to the extension stage is performed for no less than 7 cycles, and the pre-denaturation stage and the storage stage are performed once each to obtain the target sequencing library.

[0040] The second aspect of the present application provides a second-generation sequencing method, which includes the method for constructing a sequencing library of short-chain ssDNA as described in the first aspect of the present application.

[0041] The third aspect of the present application provides an application of the method for constructing a short-chain ssDNA sequencing library according to the first aspect of the present application in the synthesis of short-chain ssDNA.

[0042] Compared with the prior art, the present invention has the following advantages: The present invention proposes for the first time a method for constructing a sequencing library for short-chain ssDNA on a solid phase carrier, which makes up for the shortcomings of the prior art and is no longer limited to the fixed state of ssDNA. The construction of a library of special ssDNA is realized, and the sequencing library constructed by the construction method of the present invention has a high sequencing accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 To construct the capillary electrophoresis quality control chart of the library for A-tailing; Figure 2 Capillary electrophoresis quality control chart for library construction with G-tailing. DETAILED DESCRIPTION

[0044] Exemplary embodiments will be described in detail herein, examples of which are shown in the accompanying drawings. When the following description refers to the drawings, the same numbers in different drawings represent the same or similar elements unless otherwise indicated. The implementations described in the following exemplary embodiments do not represent all implementations consistent with the present application. Instead, they are merely examples of devices and methods consistent with some aspects of the present application as detailed in the appended claims.

[0045] The terms used in this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The singular forms of "a", "said" and "the" used in this application and the appended claims are also intended to include plural forms unless the context clearly indicates other meanings. It should also be understood that the term "and / or" used herein refers to and includes any or all possible combinations of one or more associated listed items.

[0046] The present application will be described in detail below through examples.

[0047] After synthesis, short-chain ssDNA (Single-Stranded DNA) is often sequenced to verify the accuracy of the sequence. However, the synthesized short-chain ssDNA is often fixed on a carrier at one end, and due to the small number of molecules, short chain length, and high connection difficulty, it is impossible to successfully build a library, making it difficult to achieve efficient sequencing. In the existing short-chain ssDNA library construction methods, both ends of the sequence are required to be unconstrained, and sequences can be added at will, which is not applicable to sequences fixed on a solid phase carrier.

[0048] In view of this, in order to solve the existing technical problems in the background technology, the inventive concept of the present application is to provide a method for constructing a sequencing library of a short-chain ssDNA, wherein the 5' end of the short-chain ssDNA is connected to a fixed carrier, and the sequencing library construction method comprises the following steps: a polynucleotide tail adding step, wherein the short-chain ssDNA is used as a template, and an enzyme reaction is performed using terminal deoxynucleotidyl transferase to add a polynucleotide tail to the 3' end of the short-chain ssDNA to obtain a tailed short-chain ssDNA; a PCR amplification step: wherein the tailed short-chain ssDNA is used as a template, a first primer is designed to perform a PCR amplification reaction, and the amplified product is purified; an end repair step: wherein the purified amplified product is used as a template, 5' end repair and 3' end tailing reactions are performed; an adapter ligation step: wherein the product obtained in the end repair step is used as a template, a ligase is used to react, a template with an adapter is obtained, and the template is purified; a PCR enrichment and purification step: wherein the purified product obtained in the adapter ligation step is used as a template, a second primer is designed to perform PCR enrichment and purification, and a sequencing library is obtained.

[0049] According to the inventive concept, by adding a polynucleotide tail to the end of the short-chain ssDNA, on the one hand, the chain length of the short-chain ssDNA can be increased, and on the other hand, it is also convenient to design primers, thereby making up for the shortcomings of the existing technology, no longer limited to the fixed state of ssDNA, and realizing the construction of a special ssDNA library.

[0050] In order to better understand the above technical solution, the above technical solution will be described in detail in combination with specific implementation methods. Those skilled in the art should also understand that the reaction time and component feeding involved in this application cannot be absolutely accurate in actual production or experimental processes, but are all within the allowable error range. For example, if you want to heat the sample for 30 minutes, the actual operation may be 1 second more or less than 1 second in 30 minutes; if you want to weigh 30g of sample, you may actually weigh 30.001g or 29.998g.

[0051] The following are specific embodiments of the present invention, and the embodiments are intended to further describe the present invention rather than to limit the present invention.

[0052] The reagents used in this application are usually commercially available without any description. The specific sources of the reagents are listed as follows: DNA polymerase: Novozymes product number P505-d1 Phanta Max Super-Fidelity DNA Polymerase reagent; Magnetic beads: Norwegian product number N411-03-AA VAHTS DNA Clean Beads magnetic beads; DNA library construction kit: Novozymes catalog number ND607-02 VAHTS Universal DNA Library PrepKit for Illumina V3 kit; Terminal deoxynucleotidyl transferase: Thermo Fisher Scientific Catalog No. EP0162 Terminal deoxynucleotidyl transferase.

[0053] Those skilled in the art should understand that the above reagents are only provided as a reference for the source of reagents and do not limit the scope of protection of the present application. Unless otherwise specified, the above reagents are not the only choice.

[0054] Example 1 Adding A tail to build library S0. Design primers According to the ssDNA sequence to be synthesized, the required primers in this example were designed taking into account factors such as secondary structure, GC content between 40-60%, and moderate length.

[0055] First primer for PCR amplification of short ssDNA: 5'-TTTTTTTTTTT-GGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3' (SEQ ID NO. 1), wherein the "TTTTTTTTTTT" sequence is a thymine segment (i.e., a poly tail segment), and the "GGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG" sequence is a primer body segment.

[0056] Second primer for PCR enrichment and purification step of dsDNA: 5'-AAGGATTCATTCCCGGCTAGAGACTCCTACG-3' (SEQ ID NO. 2); 5'-TTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO. 3).

[0057] Among them, at least one primer in the second primer contains a sequence segment that is identical to the primer main segment of the first primer, and the length of the sequence segment is at least 5 bp. In this embodiment, the identical sequence segment is "GGCTAGAGACTCCTACG".

[0058] Those skilled in the art should understand that this step can be performed before the implementation of the technical solution or during the implementation, and has no substantial impact on the realization of the technical solution.

[0059] S1. Obtain sample chip Short-chain ssDNA sequences are synthesized according to demand, wherein the 5' end of the ssDNA sequence is connected to a fixed carrier and has a length of 20-100 nt.

[0060] In some embodiments, the fixed carrier is a gene chip.

[0061] S2, add polynucleotide A tail The sample short-chain ssDNA obtained in step S1 is used as a template, and a polynucleotide tail of a certain length is added to the 3' end of the short-chain ssDNA using TdT enzyme. The TdT enzyme can be selected from muTdT enzyme from mouse, and the tailing speed is controlled at 30-40nt / min, and the tailing length is 40-100nt.

[0062] The specific process steps of this step are as follows: cut the sample chip to be built into a 4×4 mm square and place it at the bottom of a 1.5 mL centrifuge tube. Add the reaction solution prepared with the components shown in Table 1 to ensure that the reaction solution evenly covers the chip without bubbles.

[0063] Table 1

[0064] The reaction temperature of the muTdT enzyme was 30°C, the reaction time was 8-10 min, and it was finally inactivated at 98°C.

[0065] S3. PCR amplification reaction and purification In this step, the product obtained in step S2 is used as a template, and a mixture of DNA polymerase and primers complementary to the template is used to perform a PCR amplification reaction to enrich the target fragment.

[0066] The specific process steps of this step are: wash the remaining reaction liquid in the product obtained in step S2, then wash it twice with enzyme-free water, and then add the reaction liquid formed by the components shown in Table 2 to ensure that the reaction liquid covers the product and there are no bubbles.

[0067] Table 2

[0068] Place the above components in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 95°C, reaction time is 3 min; Denaturation stage: reaction temperature is 95°C, reaction time is 15s; Annealing stage: reaction temperature is 50°C, reaction time is 15s; Extension stage: reaction temperature is 72°C, reaction time is 10s; Final extension stage: reaction temperature was 72°C and reaction time was 5 min; Storage stage: The reaction temperature is 4°C.

[0069] The denaturation stage to the extension stage were performed for 30 cycles, and the pre-denaturation stage and the final extension stage were performed once each. After the PCR amplification reaction was completed, the product was recovered, and the DNA fragments were purified to obtain the dsDNA sample for library construction.

[0070] The obtained dsDNA sample for library construction is further purified. The operation in this step is as follows: Recover 100 μl of dsDNA sample for library construction, add 180 μl of magnetic beads (1.8×), mix well by pipetting, and centrifuge at low speed to remove droplets on the wall of the EP tube so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0071] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0072] Insert the EP tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, and use Qubit4.0 to detect the nucleic acid concentration.

[0073] S4, end repair and A addition Using the purified product obtained in step S3 as a template, the two enzyme mixtures in the DNA library construction kit are used to perform end repair enzyme reaction and tailing reaction on the DNA fragment on the template to achieve the flattening of the 5' end protrusion of the DNA fragment and the addition of an adenine deoxyribonucleotide tail (adding an A tail) at the 3' end.

[0074] In the specific process steps, the input volume x is calculated according to the concentration, and 20 ng is taken to prepare the reaction solution shown in Table 3 below: Table 3

[0075] Place in PCR instrument, the temperature of terminal repair enzyme phosphorylation reaction is 20℃, and the reaction time is 15min; the temperature of A-tailing reaction is 65℃, and the reaction time is 15min.

[0076] S5, Connector In this step, the product obtained in step S4 is used as a template and a ligase is used to react to connect the A tail added at the 3' end in step S4 and the protruding T at the 5' end of the adapter sequence to form a "adapter-fragment-adapter" structure.

[0077] In this step, in the specific process steps, a reaction solution formed by the components shown in Table 4 is prepared and mixed by blowing.

[0078] Table 4

[0079] Place in a PCR instrument. The optimal reaction temperature for this step is 20°C and the reaction time is 15 minutes. After the linker connection step, two purification processes are required. The two purification processes are as follows: For the first time, recover 100 μl of sample and add 60 μl of magnetic beads (0.6×). Mix by pipetting and centrifugation at low speed to remove droplets on the wall of the EP tube, so that the magnetic beads are evenly dispersed in the solution, and react at room temperature for 10 min.

[0080] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0081] Insert the EP tube into the magnetic rack and pipette 20 μl of solution after the magnetic beads are adsorbed to the tube wall.

[0082] The second time, add 30 μl of magnetic beads (1.5×) to 20 μl of the recovered solution, pipette and mix, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0083] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0084] Insert the EP tube into the magnetic rack, and after the magnetic beads are adsorbed to the tube wall, aspirate 20 μl of solution for use.

[0085] S6. PCR enrichment and purification In this step, the purified product obtained in step S5 is used as a template, and the fragments with adapters are amplified by PCR using an enzyme mixture and universal primers to enrich the target fragments and obtain a DNA second-generation sequencing library.

[0086] In the specific process steps of this step, the components shown in Table 5 below are added to the PCR tube for PCR amplification.

[0087] Table 5

[0088] Place in a PCR instrument and follow the following conditions: Pre-denaturation stage: reaction temperature is 95°C, reaction time is 3 min; Denaturation stage: reaction temperature is 98°C, reaction time is 20s; Annealing stage: reaction temperature is 60°C, reaction time is 15s; Extension stage: reaction temperature is 72°C, reaction time is 30s; Final extension stage: reaction temperature was 72°C and reaction time was 5 min; Storage stage: The reaction temperature is 4°C.

[0089] Among them, 7 cycles are performed from the denaturation stage to the extension stage, and the pre-denaturation stage and the final extension stage are performed once each. After the PCR amplification is completed, the product is recovered and the DNA fragments are purified to obtain the target library. The purification is performed as follows: Recover 50 μl of sample, add 60 μl of magnetic beads (1.2×), mix thoroughly by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0090] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0091] Insert the EP tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, measure the concentration, and perform capillary electrophoresis quality control.

[0092] Example 2 Adding G tail to build library S0. Design primers According to the ssDNA sequence to be synthesized, the required primers in this example were designed taking into account factors such as secondary structure, GC content between 40-60%, and moderate length.

[0093] First primer for PCR amplification of short ssDNA: 5'-TTTTTTTTTTT-GGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3' (SEQ ID NO. 4), wherein the "TTTTTTTTTTT" sequence is a thymine segment (i.e., a poly tail segment), and the "GGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG" sequence is a primer body segment.

[0094] Second primer for PCR enrichment and purification step of dsDNA: Includes first stage primers for use with G-tails: 5'-GACTGCTAGAGAAGGTACTATTCCGCTTGGACTTGTGGTGCCCCCCCCCCCCCCC-3' (SEQ IDNO.5), And the second stage primers for PCR amplification: 5'-GACTGCTAGAGAAGGTACTATTCCGCTT-3' (SEQ ID NO. 6); 5'-GGCTAGAGACTCCTACGCGACTTG-3' (SEQ ID NO. 7).

[0095] The second primers include first-stage primers for complementary amplification with the G tail and second-stage primers for re-amplification. At least one of the second-stage primers contains the same sequence segment as the first-stage primer, and the length of the sequence segment is at least 5 bp. In this embodiment, the same sequence segment is "GACTGCTAGAGAAGGTACTATTCCGCTT".

[0096] Those skilled in the art should understand that this step can be performed before the implementation of the technical solution or during the implementation, and has no substantial impact on the realization of the technical solution.

[0097] S1. Obtain sample chip Short-chain ssDNA sequences are synthesized according to demand, wherein the 5' end of the ssDNA sequence is connected to a fixed carrier and has a length of 20-100 nt.

[0098] In some embodiments, the fixed carrier is a gene chip.

[0099] S2, add polynucleotide G tail The sample short-chain ssDNA obtained in step S1 is used as a template to add a certain length of polynucleotide tail to the 3' end of the short-chain ssDNA using TdT enzyme. The TdT enzyme can be selected from muTdT enzyme from mouse, the tailing speed is controlled at 30-40nt / min, and the tailing length is 40-100nt.

[0100] In the experiment, the applicant found that the speed of synthesizing the G tail is easier to control than synthesizing the A tail. Therefore, in Example 1, the added A tail can be directly used for complementary amplification on the vector to achieve one amplification; in this example, since the increased length of the G tail is easier to control, a poly C + fixed sequence is designed to complement the added G tail for amplification, and the fixed sequence is the lower primer for the second amplification, achieving two amplifications, and the library construction process is easier to operate.

[0101] The specific process steps of this step are as follows: cut the sample chip to be built into a 4×4 mm square and place it at the bottom of a 1.5 mL centrifuge tube. Add the reaction solution prepared with the components shown in Table 6 below to ensure that the reaction solution evenly covers the chip without bubbles.

[0102] Table 6

[0103] The reaction temperature of the muTdT enzyme was 30°C, the reaction time was 8-10 min, and it was finally inactivated at 98°C.

[0104] S3. PCR amplification reaction and purification In this step, the product obtained in step S2 is used as a template, phanta enzyme is used to perform PCR amplification reaction, the sequence complementary to the G tail and extended is designed as the first-stage primer, and the primer complementary to the extended sequence is designed as the second-stage primer mixture to enrich the target fragment.

[0105] The specific process steps of this step are: suck out the remaining reaction liquid in the product obtained in step S2, wash the slice twice with enzyme-free water, and then add the reaction liquid prepared by the components shown in Table 7 to ensure that the liquid covers the product and there are no bubbles.

[0106] Table 7

[0107] Place the above components in a PCR instrument and perform the following steps: Pre-denaturation stage: reaction temperature is 98°C, reaction time is 10 min; First denaturation stage: reaction temperature is 98°C, reaction time is 30s; The first annealing stage: reaction temperature is 60°C, reaction time is 15s; The first extension stage: reaction temperature is 72°C, reaction time is 20s; The second denaturation stage: reaction temperature is 98°C and reaction time is 30s; The second annealing stage: reaction temperature is 45°C, reaction time is 15s; The second extension stage: reaction temperature is 72°C, reaction time is 20s; Final extension stage: reaction temperature was 72°C and reaction time was 5 min; Storage stage: The reaction temperature is 4°C.

[0108] Among them, 10 cycles are performed from the first denaturation stage to the first extension stage, which is the first stage PCR; 24 cycles are performed from the second denaturation stage to the second extension stage, which is the second stage PCR; the pre-denaturation stage and the final extension stage are performed once each. After the PCR amplification is completed, the product is recovered, and the DNA fragments are purified to obtain the dsDNA sample for library construction.

[0109] The obtained dsDNA sample for library construction is further purified. The operation in this step is as follows: Recover 100 μl of sample, add 180 μl of Novozyme magnetic beads (1.8×), mix thoroughly by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0110] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0111] Insert the EP tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, and use Qubit4.0 to detect the nucleic acid concentration.

[0112] S4, end repair and A addition Using the purified product obtained in step S3 as a template, the two enzyme mixtures in the DNA library construction kit are used to perform end repair enzyme reaction and tailing reaction on the DNA fragment on the template to achieve the flattening of the 5' end protrusion of the DNA fragment and the addition of an adenine deoxyribonucleotide tail (adding an A tail) at the 3' end.

[0113] In the specific process steps, the input volume was calculated according to the concentration, and 20 ng was taken to prepare the reaction solution shown in Table 8 below: Table 8

[0114] Place in PCR instrument, the temperature of end repair phosphorylase reaction is 20℃, the reaction time is 15min; the temperature of A-tailing reaction is 65℃, the reaction time is 15min.

[0115] The subsequent steps are the same as in Example 1.

[0116] Test Example 1 This test example investigates the sequencing accuracy of the second-generation sequencing Illumina platform library with short-chain ssDNA fixed on the chip constructed by the present invention.

[0117] Three different batches of sample chips were taken, and the second-generation sequencing Illumina platform libraries with short-chain ssDNA fixed on the chip were constructed according to the method of Example 1 of the present invention, namely, A-tail sample 1, A-tail sample 2, and A-tail sample 3; Three different batches of sample chips were taken, and the second-generation sequencing Illumina platform libraries with short-chain ssDNA fixed on the chip were constructed according to the method of Example 2 of the present invention, namely G-tail sample 1, G-tail sample 2 and G-tail sample 3. The obtained 6 samples were sequenced using the second-generation sequencing Miseq platform, and the quality control chart is shown in Figure 1 and Figure 2 .

[0118] The results are shown in Table 9: Table 9

[0119] From the results in Table 9, it can be seen that the accuracy and Q30 of each sample in Examples 1 and 2 of the present application are basically within the reasonable range, and the sequencing effect is basically at the level of ordinary sequences. It can be understood that the sequencing library of the short-chain ssDNA fixed by the carrier constructed by the method of the present invention can be applied to sequencing experiments such as the second-generation sequencing Illumina platform, and can obtain relatively accurate experimental results, realizing efficient and accurate sequencing of special sequences.

[0120] In summary, the sequencing library construction method, sequencing method and application of short-chain ssDNA provided in the embodiments of the present invention solve the technical problem that the ssDNA connected to the vector cannot be sequenced in the prior art by adding a polynucleotide tail to the end of the short-chain ssDNA, and realizes the construction of a special ssDNA library, which has a good commercial prospect.

[0121] It should be pointed out that for ordinary technicians in this field, the technical features in the above embodiments can be freely combined, and the formed technical solutions also belong to the embodiments disclosed in this application.

[0122] Furthermore, without departing from the principles of the present application, several improvements and modifications may be made to the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for constructing a sequencing library of short-chain ssDNA, characterized in that: The 5' end of the short-chain ssDNA is connected to a fixed carrier, and the 3' end is an exposed end. The sequencing library construction method comprises the steps of: Adding a polynucleotide tail step: using the short-chain ssDNA as a template, using terminal deoxynucleotidyl transferase to perform an enzyme reaction, adding a polynucleotide tail to the 3' end of the short-chain ssDNA, and obtaining a tailed short-chain ssDNA; PCR amplification steps of short-chain ssDNA: using the tailed short-chain ssDNA as a template, designing the first primer for PCR amplification reaction, and purifying the amplified product; End repair step: Using the purified amplified product as a template, perform 5' end repair and 3' end tailing reactions; Connector ligation step: using the product obtained in the end repair step as a template, using a ligase to react, obtaining a template with a connector, and purifying it; dsDNA PCR enrichment and purification step: Using the purified product obtained in the linker ligation step as a template, design a second primer for PCR enrichment and purification to obtain a sequencing library.

2. The method for constructing a sequencing library of short-chain ssDNA according to claim 1, characterized in that: The short-chain ssDNA has a length of 20-100 nt.

3. The method for constructing a sequencing library of short-chain ssDNA according to claim 1, characterized in that: In the step of adding a polynucleotide tail, the polynucleotide is a polyadenine deoxyribonucleotide.

4. The method for constructing a sequencing library of short-chain ssDNA according to claim 1, characterized in that: In the step of adding end repair, an adenine deoxyribonucleotide tail or a guanine deoxyribonucleotide tail is added, and the tailing reaction rate is controlled at 30-40 nt / min.

5. The method for constructing a sequencing library of short-chain ssDNA according to claim 1, characterized in that: In the PCR amplification step of the short-chain ssDNA, the first primer includes a poly tail segment and a primer main segment, the poly tail segment is complementary to the polynucleotide tail, and the primer main segment is complementary to a partial sequence of the short-chain ssDNA.

6. The method for constructing a sequencing library of short-chain ssDNA according to claim 5, characterized in that: In the step of adding the polynucleotide tail, the enzyme reaction temperature is 29-31°C, the reaction time is 8-10 minutes, and finally the enzyme is inactivated at a high temperature of 96-99°C.

7. The method for constructing a sequencing library of short-chain ssDNA according to claim 6, characterized in that: The step of adding the polynucleotide tail comprises, by volume: 15-25 copies of 5× terminal deoxynucleotidyl transferase reaction buffer; 4-6 copies of terminal deoxynucleotidyl transferase; 70-80 parts of enzyme-free water; 10 μM dNTP 1-3 copies.

8. The method for constructing a sequencing library of short-chain ssDNA according to claim 1, characterized in that: The dsDNA PCR amplification step includes, by volume: 40-45 parts of enzyme-free water; 2×PCR buffer 45-55 copies; dNTP mixture 1-3 parts; 1-3 copies of DNA polymerase; 3-5 copies of the first primer mixture.

9. A second generation sequencing method, characterized in that: The sequencing method comprises the method for constructing a sequencing library of short-chain ssDNA as described in any one of claims 1 to 8.

10. Use of the method for constructing a sequencing library of short-chain ssDNA according to any one of claims 1 to 8 in the synthesis of short-chain ssDNA.

Images