Application of dapam nitrile and medicine

Abstract

The invention discloses an application of dapam nitrile and a medicine. The invention relates to the field of medicines, in particular to application of dapam nitrile in preparation of medicines for treating and / or preventing metabolism-related fatty liver diseases and the medicines for treating and / or preventing the metabolism-related fatty liver diseases, and active ingredients of the medicines comprise dapam nitrile and further comprise pharmaceutically acceptable excipients, carriers and / or diluents. The dapam-susulonitrile can target NLRP3 inflammasomes, maintain the mitochondrial homeostasis in liver cells, reduce lipid deposition of the liver cells and the liver and improve glucose metabolism and lipid metabolism.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an application of dapamoxonil and a medicine. Background Art

[0002] Metabolic Associated Fatty Liver Disease (MAFLD) is one of the most common chronic liver diseases in the world. Currently, no drug has been approved by the FDA or EMA for the indication of MAFLD. Some marketed drugs have shown effectiveness for metabolic associated fatty liver disease in clinical trials, such as pioglitazone, GLP-1RA, SGLT-2 inhibitors, vitamin E and pentoxifylline, but these drugs have different degrees of side effects. Pioglitazone can improve liver histology, but there are edema, weight gain, bladder cancer risk and bone mineral density reduction risks, so its clinical application is limited. GLP-1RA improves liver histology, but has gastrointestinal adverse reactions. SGLT-2 inhibitors can reduce fat content and improve liver histology, but their effects on liver fibrosis still need further study. Vitamin E can effectively improve liver histology, but may increase the risk of prostate cancer. Pentoxifylline can improve lobular inflammation and NAS scores, but cannot improve fatty degeneration, ballooning and fibrosis.

[0003] Dapansutrile (OLT1177) is a small molecule β-ketonitrile compound with the following molecular structure:

[0004]

[0005] There have been studies on the use of dapoxetine for diseases such as knee osteoarthritis and gout, but the effect of dapoxetine on metabolic-related fatty liver disease is still unclear. Summary of the invention

[0006] In order to overcome the problems existing in the prior art, the present invention provides an application and medicine of dapanoxicola.

[0007] The present invention adopts the following technical solution:

[0008] 1. Application of Dapansunil

[0009] Dapansutamide is used for preparing medicines for treating and / or preventing metabolism-related fatty liver disease.

[0010] Specifically, the dapoxetine is used to reduce lipid deposition in mammalian hepatocytes and liver, thereby achieving the treatment and / or prevention of metabolism-related fatty liver disease.

[0011] The mammal is a human or a mouse.

[0012] 2. A drug for treating and / or preventing metabolic-related fatty liver disease

[0013] The active ingredient of the drug contains dapoxetine.

[0014] Optionally, the only active ingredient of the drug is dapoxetine.

[0015] Furthermore, the medicine also contains a pharmaceutically acceptable excipient, carrier and / or diluent.

[0016] Furthermore, the medicine is an oral tablet, capsule, oral liquid, granule or injection.

[0017] Preferably, the drug is an injection.

[0018] The beneficial effects of the present invention are:

[0019] 1. In the application of the present invention, dapamoic acid or a drug containing dapamoic acid can improve lipid deposition in hepatocytes by targeting NLRP3-Caspase1 (NLRP3 inflammasome).

[0020] 2. In the application of the present invention, dapamoic acid or a drug containing dapamoic acid can improve the function of liver cells by regulating the mitochondrial oxidative stress of liver cells.

[0021] 3. In the application of the present invention, dapamoic acid or a drug containing dapamoic acid can improve liver function by improving glucose metabolism and lipid metabolism.

[0022] 4. The results of existing clinical trials show that dapanoxacin has good safety, high tolerance and no obvious adverse reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the effect of dapamoxonil in the present invention on improving glucose metabolism in the HFD+STZ mouse model (n=5 mice in each group); (A) is the weight monitoring result, (B) is the blood glucose level, (C) is the insulin level, (D) is the glucose tolerance test result, (E) is the AUC value of the glucose tolerance test result, (F) is the insulin tolerance test result, and (G) is the AUC value of the insulin tolerance test result;

[0024] Figure 2Schematic diagram of the effect of dapamoxonil in the present invention on improving glucose metabolism in db / db mouse model (n=5 mice in each group); (A) is the weight monitoring result, (B) is the blood glucose level, (C) is the insulin level, (D) is the glucose tolerance test result, (E) is the AUC value of the glucose tolerance test result, (F) is the liver index (liver weight / body weight), (G) is the liver total cholesterol, (H) is the liver triglyceride, (I) is the serum AST, and (J) is the serum ALT;

[0025] Figure 3 Schematic diagram of the effect of dapanoxacin in the present invention on improving lipid metabolism; (A) is a liver morphology diagram, and (B) is a representative diagram of liver tissue H&E staining (upper) and Oil Red O staining (lower);

[0026] Figure 4 Schematic diagram of the effect of dapanoxacin in the present invention on improving mitochondrial dynamics (n=3); (A) is a representative image of Oil Red O staining, (B) is the determination of mitochondrial reactive oxygen levels in HepG2 cells, (C) is deep red staining of HepG2 cell mitochondria, (D) is JC-1 staining of HepG2 cell mitochondria, (E) is oxygen consumption rate (OCR) analysis of hepG2 cells, and (F) is oxygen consumption rate (OCR) analysis of hepG2 cells;

[0027] Figure 5 The figures are the molecular test results of dapoxetine in the present invention for improving mitochondrial dynamics; (A) is a relative mRNA comparison diagram of Nlrp3 protein; (B) is a relative mRNA comparison diagram of Asc protein; (C) is a relative mRNA comparison diagram of Caspase-1 protein; (D) is a relative mRNA comparison diagram of Dsdmd protein; (E) is a western blotting result diagram; (F) is a comparison diagram of IL-1β protein expression; (G) is a comparison diagram of IL-18 protein expression. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0029] The present invention provides an application of dapoxetine in the preparation of a drug for treating and / or preventing metabolic-related fatty liver disease. The potential mechanism of dapoxetine for treating and / or preventing metabolic-related fatty liver disease is as follows: dapoxetine targets the NLRP3 inflammasome, protects mitochondrial homeostasis and reduces liver cell damage by targeting the NLRP3-Caspase1 signaling axis, and improves metabolic-related fatty liver disease.

[0030] Specifically, the present invention provides an application of dapoxetine to treat and / or prevent metabolic-related fatty liver disease by maintaining mitochondrial homeostasis in unknown hepatocytes by targeting NLRP3 inflammasomes. Maintaining mitochondrial homeostasis in hepatocytes specifically means that after using dapoxetine, the level of reactive oxygen species in diseased cells is significantly reduced and the downward trend of mitochondrial potential is slowed down.

[0031] Specifically, the present invention provides a use of dapanoxacil for treating and / or preventing metabolism-related fatty liver disease by regulating lipid metabolism of hepatocytes. Regulating lipid metabolism of hepatocytes specifically refers to reducing lipid deposition in hepatocytes.

[0032] Specifically, the present invention provides a use of dapoxetine for treating and / or preventing metabolism-related fatty liver disease by reducing lipid deposition in the liver of a mammal.

[0033] Specifically, the present invention provides a use of dapanoxacil for treating and / or preventing metabolic-related fatty liver disease by improving glucose metabolism and lipid metabolism in mammals. The mammals are humans or mice. Improving glucose metabolism and lipid metabolism specifically refers to: lowering blood sugar, enhancing blood sugar regulation ability, improving insulin resistance, and reducing liver index and triglycerides and cholesterol in serum.

[0034] Furthermore, the present invention also provides a drug for treating and / or preventing metabolism-related fatty liver disease, wherein the active ingredient of the drug comprises dapoxetine.

[0035] Furthermore, the drug also contains pharmaceutically acceptable excipients, carriers and / or diluents.

[0036] Optionally, dapagliflozin is the only active ingredient of the drug.

[0037] Optionally, the drug is in the form of oral tablets, capsules, oral liquid, granules or injections.

[0038] Preferably, the drug is an injection.

[0039] In the present invention, the results of molecular experiments, cell experiments and animal experiments have successively confirmed the effects of dapamoate on protecting mitochondrial homeostasis and reducing hepatocyte damage, reducing mitochondrial oxidative stress and function, regulating hepatocyte lipid metabolism, and improving mammalian glucose and lipid metabolism by targeting the NLRP3-Caspase1 signaling axis. Therefore, dapamoate can effectively treat and / or prevent metabolism-related fatty liver disease.

[0040] The specific embodiments of the present invention are as follows:

[0041] Example 1

[0042] This example uses the glucose and lipid metabolism of a mouse metabolic fatty liver disease model induced by a high-fat diet (HFD) + streptozotocin (STZ) and a db / db mouse metabolic fatty liver disease model to verify the effect of dapoxetine on improving mouse glucose and lipid metabolism.

[0043] 1. Construction and grouping of animal models

[0044] Male C57BL / 6 mice, db / db mice, and db / m mice (5 weeks old) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. All animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee of Zhejiang University and adhered to the institutional laboratory animal care and guidelines (ethical approval number: ZJU20230454).

[0045] HFD+STZ mouse model: Mice were randomly divided into a control group (CTR, normal diet) and a HFD group (60% kcal% fat, D12492). After 30 days of feeding, 30 mg / kg of STZ (freshly dissolved in 0.1 mol / L sodium citrate buffer, pH = 4.2) was intraperitoneally administered to HFD mice for one day, while the control group was given the same volume of normal saline. Each group included 5 mice. The fasting blood glucose level of the mice was measured as ≥11.1 mmol / L twice, and the model was determined.

[0046] db / db mouse model: The fasting blood glucose levels of db / db mice were monitored weekly until 8 weeks of age. Each group consisted of 5 mice, and the fasting blood glucose levels of the db / db mouse model were measured as ≥11.1mmol / L twice.

[0047] Both model mice were divided into two groups: a model group and a DAPA group. The DAPA group was intraperitoneally injected with 200 mg / kg dapasulin (dissolved in normal saline) every day, while the model group was intraperitoneally injected with normal saline every day.

[0048] After 8 weeks of treatment with dapoxetine in the HFD+STZ mouse model and db / db mice, the mice were sacrificed and their tissues were harvested.

[0049] 2. Test methods

[0050] 2.1 Glucose tolerance test (GTT) and insulin tolerance test (ITT)

[0051] Glucose tolerance test (GTT): Mice were fasted overnight (approximately 16 hours). Tail vein blood samples were collected at 0, 15, 30, 60 and 120 minutes after oral glucose administration of 1 g / kg body weight. Blood glucose levels from 0 to 120 minutes after glucose challenge were measured using a glucometer (ACCU, Roche) to determine the area under the blood glucose curve over time (AUC).

[0052] Insulin tolerance test (ITT): Mice were fasted for 4 hours and injected intraperitoneally with insulin saline solution (1 U / kg body weight). Blood glucose levels were measured by tail clipping blood samples at 0, 15, 30, 60 and 120 minutes after injection.

[0053] 2.2. Hematoxylin and eosin (H&E) and Oil Red O staining analysis

[0054] Hematoxylin and eosin staining (H&E): Liver tissue sections were fixed with 4% paraformaldehyde by mass volume, embedded in paraffin, cut into sections with a thickness of 5 μm, and placed on glass slides. The sections were stained with hematoxylin and eosin (H&E) to evaluate liver histology.

[0055] Oil Red O staining analysis: The frozen liver tissue for Oil Red O (ORO) staining was embedded and cut into 5 μm thick sections, and stained with Oil Red O kit (Nanjing Jiancheng Bioengineering Institute). Images were acquired under a microscope (Zeiss).

[0056] 2.3 Serum and liver biochemical parameters

[0057] Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), hepatic triglyceride (TG), and total cholesterol (TC) levels were determined using commercial test kits (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's protocol.

[0058] 3. Test results

[0059] 3.1. Dapanchonamide improves glucose metabolism and lipid metabolism in a mouse model of metabolic-associated fatty liver disease

[0060] Schematic diagram of the effect of dapanoxacin on improving glucose metabolism in the HFD+STZ mouse model Figure 1 . Figure 1 Data are presented as mean ± SEM and analyzed using one-way or two-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001. Figure 1 In the figure, CTR represents the control group mice with normal diet, HFD+STZ represents the model group HFD+STZ mice injected with normal saline every day, and DAPA represents the DAPA group HFD+STZ mouse model injected with dapasulin every day.

[0061] Depend on Figure 1 As shown in (A), there was no significant difference in body weight among the three groups of mice (P>0.05), and dapoxetine had no effect on the body weight of mice. Figure 1 (B) shows that after 8 weeks of injection of dapoxetine, the Figure 1 Compared with HFD+STZ in the control group, the fasting blood glucose level of HFD+STZ-induced diabetic mice injected with dapoxetine was significantly lower (P<0.001). Figure 1 As shown in (C), injection of dapoxetine increased the plasma insulin level in the mouse model (P<0.05). Figure 1 (D) and Figure 1 As shown in (F), the results of glucose tolerance test and insulin tolerance test showed that the model group ( Figure 1 Glucose tolerance and insulin sensitivity were impaired in the HFD+STZ group. Figure 1 (E) and Figure 1 As shown in (G), after the injection of dapasunitranil, the DAPA group mice not only significantly improved the deterioration of glucose tolerance and insulin sensitivity (P<0.001), but also significantly decreased AUC (P<0.05).

[0062] Schematic diagram of the effect of dapamoic acid on improving glucose metabolism in db / db mouse model Figure 2 . Figure 2 In the table, *P<0.05, **P<0.01, ***P<0.001. Figure 2 In the figure, CTR represents the control group mice with normal diet, db / db represents the model group db / db mice injected with normal saline every day, and DAPA represents the DAPA group db / db mouse model injected with dapamoate every day.

[0063] Depend on Figure 2 (A)~ Figure 2 (E) shows that after injection of dapoxetine, the glucose and lipid metabolism of the db / db mouse metabolic fatty liver disease model was improved. Figure 2 (F)~ Figure 2 As shown in (J), after the injection of dapasunitran, the liver index and serum triglycerides and cholesterol in the DAPA group were significantly lower than those in the model group (P<0.05).

[0064] In summary, dapanoxacil can effectively improve the glucose and lipid metabolism in the metabolic-related fatty liver disease mouse model.

[0065] 3.2. Dapanchonamide can reduce lipid deposition in the liver

[0066] The schematic diagram of the effect of dapanoxacin on improving lipid metabolism and reducing lipid deposition in the liver is shown in Figure 3. Figure 3 In the figure, CTR represents the control group mice with normal diet, db / db represents the model group db / db mice injected with normal saline every day, and DAPA represents the DAPA group db / db mouse model injected with dapamoate every day.

[0067] Depend on Figure 3 (A) and Figure 3 (B) shows that ectopic cellular lipids were deposited on the liver cell sections of db / db mice in the model group, while in the DAPA group, this phenomenon was significantly improved and lipid deposition in the liver was reduced.

[0068] Thus, dapanoxacin can reduce lipid deposition in the liver.

[0069] Example 2

[0070] This example uses HepG2 cells as an example to support the effect of dapoxetine in regulating lipid metabolism in hepatocytes.

[0071] 1. Cell culture

[0072] Cell culture: HepG2 is a human hepatoma cell line obtained from ATCC and cultured in DMEM medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and 1× GlutaMax (Invitrogen). Cells were plated at 4×10 5 The cells were seeded in 6-well plates at a density of 100 cells / well. After seeding, the cells were treated with 0.5 mol / L free fatty acid (FFA) alone or 0.5 mol / L FFA + 10 μmol / L dapanoxacil for 24 hours.

[0073] Cell grouping: CTR group: PBS (control group); FFA group: 0.5 mol / L FFA stock solution; DAPA group: 0.5 mol / L FFA stock solution + 10 μmol / L dapamoate.

[0074] HepG2 cells were divided into normal control group ( Figure 4 CTR in), model group ( Figure 4 FFA) and DAPA group ( Figure 4 The number of samples in each group was 3. The normal control group was incubated with PBS buffer for 24 hours, the model group was incubated with 0.5mmol / L free fatty acid (FFA) for 24 hours, and the DAPA group was incubated with 0.5mmol / L free fatty acid (FFA) and 10μmol / L dapamoate for 24 hours.

[0075] Preparation of FFA mother solution:

[0076] a. Palmitic acid (PA): Dissolve 21.18 mg of palmitic acid in 0.4 mL of anhydrous ethanol; mix 0.4 mL of the above solution with 5 mL of a 10% bovine serum albumin (BSA) solution with a mass concentration of 10% to achieve a final concentration of palmitic acid of 15 mol / L.

[0077] b. Oleic acid (OA): Dissolve 50 mg of oleic acid in 0.8 mL of 0.1 mol / L NaOH solution; mix 0.8 mL of the above solution with 10 mL of 10% bovine serum albumin solution to make the final concentration of oleic acid reach 15 mol / L.

[0078] c. FFA mother solution: Use the PA solution obtained in step a and the OA solution obtained in step b to prepare an FFA mixed mother solution with a molar ratio of OA:PA=2:1.

[0079] 2. Test methods

[0080] Oil Red O staining: HepG2 cells were treated with 0.5 mol / L FFA stock solution alone or 0.5 mol / L FFA and 10 μmol / L dapamoate for 24 hours, then washed 3 times with PBS, fixed with 4% formaldehyde for 20 minutes, washed 3 times with PBS, stained with Oil Red O (Nanjing Institute of Biotechnology) for 15 minutes, counterstained with nuclei for 1 minute, and washed 3 times with PBS. Observed under an electron microscope and photographed.

[0081] 3. The results of dapanoxacin regulating lipid deposition in hepatocytes

[0082] Figure 4 Schematic diagram of the effect of dapanoxacil in the present invention on improving mitochondrial dynamics (n=3). Figure 4 Data are expressed as mean ± SEM and analyzed by one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001. Figure 4 In the figure, CTR represents the HepG2 cells in the normal control group, FFA represents the HepG2 cells in the FFA group after incubation with free fatty acids, and DAPA represents the HepG2 cells in the DAPA group after incubation with free fatty acids + dapamoate.

[0083] Figure 4 (A) is the Oil Red O staining result of HepG2 cells. It can be seen that compared with normal cells (CTR group), incubation of cells with free fatty acids at a concentration of 0.5 mmol / L (FFA group) effectively induced ectopic lipid deposition in HepG2 cells, while incubation of cells with free fatty acids + dapamoate effectively reduced ectopic lipid deposition in HepG2 cells (DAPA group).

[0084] This indicates that dapanoxacil can significantly regulate lipid deposition in hepatocytes.

[0085] Example 3

[0086] This example verifies that dapoxetine intervention can reduce mitochondrial oxidative stress and function.

[0087] 1. Cell culture: Same as Example 2

[0088] 2. Test methods

[0089] 2.1 Detection of MitoTracker, ROS and MMP

[0090] HepG2 cells were treated with 0.5 mol / L FFA stock solution or 0.5 mol / L FFA and 10 μmol / L dapanoxanil for 24 hours. They were then cultured in a humidified incubator at 37°C, 5% CO2, and 50 nmol / L Mito Tracker Deepred (Beyotime Institute of Biotechnology) solution for 30 minutes. Subsequently, Hoechst was used to stain the cell nuclei. After three PBS washes, cell morphology was observed using a Zeiss microscope under 640 nm excitation.

[0091] Cellular ROS levels were assessed using a detection kit provided by Bio-Tech Research Institute according to the supplier's protocol. HepG2 cells were treated with diacetyldichlorofluorescein (DCFH-DA) for 30 min at 37°C in the dark. After three PBS washes, cell fluorescence intensity was measured using a fluorescence microscope (Zeiss) at 488 nm excitation according to the supplier's instructions.

[0092] MMPs were detected using the JC-1 detection kit (Biyuntian Biotechnology Research Institute). JC-1 was incubated with HepG2 cells at 37°C for 20 minutes. The accumulation of JC-1 was detected using a fluorescence microscope under 488 nm and 561 nm excitation.

[0093] 2. Mitochondrial respiration analysis

[0094] Mitochondrial respiration was measured using a Seahorse XF96 analyzer (Agilent Seahorse Bioscience) and related consumables (plates, kits, and inhibitor kits) according to the manufacturer's instructions. In brief, the assay medium was prepared by supplementing a specific combination of 10 mol / L glucose (100X reserve, Agilent), 1 mol / L pyruvate (100X stock, Agilent) and 2 mol / L L-glutamine (Sigma) in Seahorse XF-Base medium (pH = 7.4). First, cells were harvested and inoculated into Seahorse 96-well XF cell culture microplates (20,000 cells / well) in 80 μL of medium. Cells were incubated for 24 hours in a pre-sterilized incubator at 37°C in an environment containing 10% CO2 and 95% constant humidity. Before running the XF assay, the Seahorse XF sensor box was hydrated for 24 hours by filling each well of the XF utility plate with 200 μL of sterile water. On the day of the instrumentation, sterile water was replaced with Seahorse XF calibrant. The hydrated kit was kept in an incubator at 37°C for 24 h without CO2 to remove CO2 from the culture medium that could interfere with the measurement by changing the pH. Mitochondrial respiration was measured using a pre-formulated and optimized Seahorse specific Mito stress test kit (all from Agilent). Afterwards, the concentrations of oligomycin, carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP), and rotenone / antimycin used were 1.0, 3.0, and 1.0 μmol / L, respectively. Seahorse controller software version 2.6.3 (Agilent Seahorse Bioscience) was used to operate and control the Seahorse XF96 analyzer. After the measurement was completed, the data were exported for processing and analysis.

[0095] 3. Test results

[0096] Mito Tracker staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in Figure 4 (B). It can be seen that compared with cells treated with FFA, cells in the DAPA group treated with dapamoate maintained a uniform distribution of mitochondria, showing aggregation and fragmentation. This further confirmed that dapamoate can restore the dynamic balance between mitochondrial fusion and fragmentation.

[0097] Reactive oxygen staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in Figure 4 (C). It can be seen that compared with cells treated with FFA, the level of reactive oxygen species in the DAPA group cells treated with dapamoate was significantly reduced. This further confirmed that dapamoate can significantly reduce the level of mitochondrial ROS, thereby protecting mitochondrial function.

[0098] Mitochondrial JC-1 staining and fluorescence analysis were performed on each group of HepG2 cells in Example 2. The results are shown in Figure 4 (D). It can be seen that compared with cells treated with FFA, the DAPA group cells treated with dapasulin slowed down the decline of mitochondrial membrane potential (MMP), and the mitochondrial membrane potential was improved. This further confirmed that dapasulin protected mitochondrial function by slowing down the decline of mitochondrial membrane potential.

[0099] Thus, the results of this example indicate that dapanoxacil corrects the imbalance between mitochondrial fusion and fission, while reducing the generation of reactive oxygen species (ROS) in hepatocytes, slowing down the downward trend of mitochondrial membrane potential (MMP), and improving liver function.

[0100] The HepG2 cells in Example 2 were analyzed using a hippocampal energy metabolism analyzer. The results are shown in Figure 4 (E) and Figure 4 (F). It can be seen that free fatty acid treatment inhibited the basal respiration and maximal respiration of HepG2 cells, and this phenomenon was improved after intervention with dapoxetine (P<0.05).

[0101] In summary, the results of this example further demonstrate that dapoxetine intervention can reduce mitochondrial oxidative stress and improve mitochondrial function.

[0102] Example 4

[0103] This example verifies the molecular mechanism by which dapoxetine protects mitochondrial homeostasis and reduces hepatocyte damage through the NLRP3-Caspase1 signaling axis by using a Western blotting detection method.

[0104] 1. Cell culture: Same as Example 2

[0105] 2. Test methods

[0106] 2.1 Real-time quantitative PCR (qRT-PCR)

[0107] After treatment with 0.5 mol / L FFA stock solution and 10 μmol / L dapanoxic acid for 24 h, RNA was isolated from the cells using AG RNAex Pro reagent (Acori Biotech). RNA concentration was measured on a Nanodrop 2000C spectrophotometer. OD 260 / OD 280Samples with ratios between 1.8 and 2.0 were used for the experiments. RNA was reverse transcribed into cDNA using the Evo M-MLV RT Premix Kit (Acori Biotech) following the supplier's guidelines. cDNA was used as a template for quantitative real-time PCR using the LightCycler 480II system (Roche) and the SYBR Green Premix Pro Taq HS qPCR Kit (Acori Biotech). Each sample was analyzed in duplicate. Melting curves were generated during amplification to verify the presence of primer dimers or incorrectly paired products. After correction, the comparison cycle threshold ( 2-△△ The relative mRNA expression level of the target gene was calculated by CT method.

[0108]

[0109] 2.2 Western Blot

[0110] After treatment with FFA mother solution at a concentration of 0.5 mol / L, or FFA at a concentration of 0.5 mol / L and 10 μmol / L of dapanoxic acid for 24 hours, cells were broken using a cell lysis buffer containing a mixture of protease inhibitors. Protein concentration was estimated using a BCA protein concentration assay kit (#P0012S, Biyuntian) and adjusted to 4 μg / μL. Samples with the same protein concentration were boiled at 100°C for 8 minutes, and 15 μL of each sample was loaded into a 10% sodium dodecyl sulfate acrylamide gel. Protein molecules were separated at a constant voltage of 120 V and then transferred to a nylon membrane. After blocking with 5% skim milk, the membranes were incubated with primary antibodies against NLRP3 (1:1000, Abcam), ASC (1:1000, Ibotek Biotech), Caspase-1 (1:11000, Ibotek Biotech), P20 (1:1000, Cell Signaling Technology), GSDMD (Abcam), and β-actin (1:500, Abcam) at 4°C overnight. The membranes were washed three times for 5 min with Tris-buffered saline containing 0.1% Tween-20 and incubated with peroxidase-conjugated goat anti-rabbit or mouse IgG for 1 h at room temperature. After washing, the membranes were reacted with enhanced chemiluminescence solution (FdBio, Science) and imaged. Protein bands were quantified using Image J 2.0 software. The ratio of the intensity of the target protein band to the intensity of the β-actin band was calculated.

[0111] 2.3 Enzyme-linked immunosorbent assay

[0112] The supernatants of cell cultures were collected after treatment with 0.5 mol / L FFA stock solution or 0.5 mol / L FFA and 10 μmol / L dapamoate for 24 h, and the IL-1β- and IL-18 concentrations were determined according to the manufacturer's instructions (R&D, eBioscience). All samples were analyzed twice. A standard curve was generated during the assay by plotting the absorbance values ​​against the concentration gradient of the standard provided by the kit. Positive controls and blank controls were analyzed simultaneously on the same plate.

[0113] 3. Test results

[0114] In this example, each group of HepG2 cells in Example 2 was subjected to Western blotting detection. The results are shown in Figure 5 (A)~ Figure 5 (G). It can be seen that compared with the FFA group, the expression levels of NLRP3, ASC, Caspase-1 and GSDMD mRNA and protein in the DAPA group were significantly decreased (P<0.0001). In addition, compared with the FFA group, the DAPA group had less IL-1β and IL-18 in the cell culture supernatant.

[0115] It can be seen that dapanoxacin improves liver inflammation, oxidative stress and liver function by specifically targeting the NLRP3-Caspase-1 signaling axis.

[0116] In summary, the active ingredient of the drug can target NLRP3 and regulate the mitochondrial homeostasis of hepatocytes, thereby improving hepatocyte function. After the animal model was injected with dapoxetine, the hepatocyte function of the animal model was significantly improved. It can be seen that dapoxetine has a significant medicinal effect as a drug for the treatment or prevention of metabolic-related fatty liver disease.

[0117] The above specific implementation modes are used to explain the present invention rather than to limit the present invention. Any modification and change made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.

[0118] The nucleotide sequences involved in the present invention are as follows:

[0119] SEQ ID NO.1:

[0120] Name: F primer sequence of β-actin protein Sequence type: DNA (other DNA)

[0121] Organism source: synthetic construct

[0122] CGTAAAGACCTCTATGCCAACASEQ ID NO.2:

[0123] Name: R primer sequence of β-actin protein Sequence type: DNA (other DNA)

[0124] Organism source: synthetic construct

[0125] AGCCACCAATCCACACAGAG

[0126] SEQ ID NO.3:

[0127] Name: F primer sequence of Nlrp3 protein

[0128] Sequence type: DNA (other DNA)

[0129] Organism source: synthetic construct

[0130] TCAGGATCTCGCATTGGTTCT

[0131] SEQ ID NO.4:

[0132] Name: R primer sequence of Nlrp3 protein Sequence type: DNA (other DNA)

[0133] Organism source: synthetic construct

[0134] GAGCAGCACAGTGAAGTAAGGSEQ ID NO.5:

[0135] Name: Asc protein F primer sequence Sequence type: DNA (other DNA)

[0136] Organism source: synthetic construct

[0137] CCAACACAGGCAAGCACTC

[0138] SEQ ID NO.6:

[0139] Name: R primer sequence of Asc protein

[0140] Sequence type: DNA (other DNA)

[0141] Organism source: synthetic construct

[0142] TGTCCTTCAGTCAGCACATTG

[0143] SEQ ID NO.7:

[0144] Name: Primer F sequence of Caspase-1 protein Sequence type: DNA (other DNA) Organism source: synthetic construct CTGGTCTTGTGACTTGGAGGA SEQ ID NO.8:

[0145] Name: R primer sequence of Caspase-1 protein Sequence type: DNA (other DNA) Organism source: synthetic construct TCAGTGGTTGGCATCTGTAGT SEQ ID NO.9:

[0146] Name: F primer sequence of GSDMD protein Sequence type: DNA (other DNA) Organism source: synthetic construct CAACTTCCAAGTCTCCGATGTC SEQ ID NO.10:

[0147] Name: R primer sequence of GSDMD protein Sequence type: DNA (other DNA) Organism source: synthetic construct GAGTCACACGCAGCATACAC.

Claims

1. An application of dapanoxacin, characterized in that: Used for preparing drugs for treating and / or preventing metabolism-related fatty liver disease.

2. The use according to claim 1, characterized in that: The dapoxetine is used for reducing lipid deposition in hepatocytes and the liver.

3. A drug for treating and / or preventing metabolic-related fatty liver disease, characterized in that: The active ingredient of the drug contains dapoxetine.

4. The drug according to claim 3, characterized in that: The only active ingredient of the drug is dapoxetine.

5. The drug according to claim 3, characterized in that: The medicament further comprises a pharmaceutically acceptable excipient, carrier and / or diluent.

6. The drug according to claim 3, characterized in that: The medicine is in the form of oral tablets, capsules, oral liquids, granules or injections.

7. The drug according to claim 3, characterized in that: The medicine is an injection.

Images