PCR (Polymerase Chain Reaction) primer combination for detecting mycoplasma and application of PCR primer combination

Abstract

The invention belongs to the technical field of biological detection, and relates to a PCR (Polymerase Chain Reaction) primer combination for detecting mycoplasma and application of the PCR primer combination, an upstream primer sequence of the PCR primer combination is as shown in SEQ ID NO.1, and a downstream primer sequence of the PCR primer combination is as shown in SEQ ID NO.2. When the PCR amplification primer combination is used for detecting mycoplasma, the specificity is high, the sensitivity is high, the pollution can be accurately detected under the mycoplasma DNA concentration as low as 0.5 ng / mu L, and meanwhile, the PCR amplification primer combination has the potential of high-throughput screening. A reliable and efficient technical means is provided for conventional mycoplasma detection, a mycoplasma detection kit prepared from the PCR primer combination can detect the most common mycoplasma in cell culture in a laboratory, and the PCR primer combination has the advantages of being high in specificity and sensitivity and wide in detection range and has good application prospects. The method has important application value for biomedical research and biotechnology industry.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and particularly relates to a PCR primer combination for detecting mycoplasma and an application thereof. Background Art

[0002] Mycoplasma contamination is a common problem in cell culture. About 15% to 35% of cell lines are contaminated with mycoplasma to varying degrees. This contamination is difficult to detect through conventional detection methods, but it can significantly affect cell metabolism, gene expression and the accuracy of experimental results. Because mycoplasmas lack cell walls, are small in size and grow slowly, they are difficult to remove with conventional antibiotics and filtration methods, resulting in their widespread spread in laboratories, seriously threatening the reliability of scientific research. Therefore, the development of efficient and sensitive mycoplasma detection methods is crucial to ensure the quality of cell culture.

[0003] The current methods for detecting mycoplasma mainly include culture method, staining method and PCR technology. Although the culture method is considered the "gold standard", it has a long cycle and complex operation, and it is difficult to meet the needs of high-throughput detection. The staining method and immunoassay method are fast, but the sensitivity and specificity are insufficient. In contrast, PCR technology has gradually become the mainstream method for mycoplasma detection due to its high sensitivity and specificity. However, the existing PCR method has limited detection range of primers and difficulty in standardization, which limits its wide application in laboratories and different cell lines. Summary of the invention

[0004] To solve the above problems, the present invention provides a PCR primer combination for detecting mycoplasma and its application. The present invention first provides a pair of specific primer combinations for the highly conserved region of the mycoplasma 16S rRNA gene, and the PCR detection of mycoplasma using this primer combination has the characteristics of high sensitivity, strong specificity and wide detection range. Secondly, a kit for detecting mycoplasma and a method for detecting mycoplasma are provided. The present invention provides an efficient and reliable conventional mycoplasma detection scheme and product for laboratories, promotes the standardization and popularization of mycoplasma detection technology, and provides a solid guarantee for the stability and accuracy of biomedical research.

[0005] The first aspect of the present invention provides a PCR primer combination for detecting mycoplasma, wherein the primer combination comprises an upstream primer and a downstream primer, and the specific sequence is:

[0006] Upstream primer: 5'-GAGGGTGCGGAACATTAGCT-3',

[0007] Downstream primer: 5′-AGTTAGCTGCCTTCGCCATT-3′.

[0008] A second aspect of the present invention provides an application of the above PCR primer combination in detecting mycoplasma.

[0009] Furthermore, the PCR primer combination is used to detect mycoplasma in cell culture; the cells are any one or more of human embryonic kidney cells (HEK293, HEK293T), human liver cancer cells (SNU-398, SNU-449, Hep 3b), human gastric cancer cells (HGC-27), human cervical cancer cells (HeLa), human pancreatic cancer cells (PANC-1) and mouse renal tubular epithelial cells (TCMK-1).

[0010] The third aspect of the present invention provides a kit for detecting mycoplasma, the kit comprising the primer combination described in the first aspect of the present invention.

[0011] Furthermore, the kit also includes dNTP, PCR stabilizer, Taq DNA polymerase and PCR buffer.

[0012] The fourth aspect of the present invention provides a method for detecting mycoplasma, the method comprising: using the primer combination described in the first aspect of the present invention to detect a sample to be tested, and judging whether the sample to be tested contains a mycoplasma gene according to the detection result.

[0013] Furthermore, the method is specifically as follows:

[0014] Extracting DNA from the sample to be tested;

[0015] Performing PCR amplification or qPCR amplification using the primer combination to obtain an amplified product;

[0016] The amplified product was analyzed by electrophoresis. If a band was present at 500 bp, it was determined that the sample contained mycoplasma genes.

[0017] Furthermore, the PCR amplification system is: 12.5 μL of PCR Mix, 0.5 μL to 1 μL of the upstream primer, 0.5 μL to 1 μL of the downstream primer, 1 μL to 2 μL of the DNA template of the sample to be tested, and nuclease-free water is added to make up to 25 μL.

[0018] Preferably, the PCR amplification system is: 12.5 μL of PCRMix, 0.5 μL of the upstream primer, 0.5 μL of the downstream primer, 1 μL of the DNA template of the sample to be tested, and 10.5 μL of nuclease-free water.

[0019] Furthermore, the reaction procedure of the PCR amplification is: (1) initial denaturation; (2) denaturation; annealing: 54°C to 56°C, 2 min; extension; a total of 30 to 32 cycles; (3) terminal extension.

[0020] Preferably, the reaction procedure of PCR amplification is: (1) initial denaturation; (2) denaturation; annealing: 55°C, 2 min; extension; a total of 30 cycles; (3) terminal extension.

[0021] Furthermore, the amplification system of the qPCR is: 10 μL of PCR Mix, 0.5 μL to 1 μL of the upstream primer, 0.5 μL to 1 μL of the downstream primer, 1 μL to 2 μL of the DNA template of the sample to be tested, and nuclease-free water is added to make up to 20 μL.

[0022] Preferably, the amplification system of the qPCR is: 10 μL of PCRMix, 0.5 μL of the upstream primer, 0.5 μL of the downstream primer, 1 μL of the DNA template of the sample to be tested, and 8 μL of nuclease-free water.

[0023] Furthermore, the reaction procedure of the qPCR amplification is: (1) initial denaturation; (2) denaturation; annealing and extension: 62°C to 65°C, 1 min; a total of 39 to 41 cycles.

[0024] Preferably, the reaction procedure of the qPCR amplification is: (1) initial denaturation; (2) denaturation; annealing and extension: 64°C, 1 min; a total of 40 cycles.

[0025] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0026] (1) The present invention provides a PCR primer combination for detecting mycoplasma. This primer combination can be used to detect mycoplasma, especially to detect mycoplasma present in a variety of cell lines commonly found in laboratories, such as human embryonic kidney cells, human liver cancer cells, human gastric cancer cells, human cervical cancer cells, human pancreatic cancer cells, and mouse renal tubular epithelial cells. It has a wide range of applications and high specificity. At the same time, it can stably detect contamination at a mycoplasma DNA concentration as low as 0.5 ng / μL, and has excellent sensitivity.

[0027] (2) The present invention provides a kit for detecting mycoplasma, which has strong specificity and high sensitivity for detecting mycoplasma, is convenient, rapid and economical, and has very high application potential and value in laboratory scientific research.

[0028] (3) The present invention provides a method for detecting mycoplasma. Compared with traditional detection methods, the PCR technology provided by the present invention has significant advantages in shortening detection time, simplifying operation procedures and improving detection accuracy. In particular, after combining with the qPCR platform, accurate quantitative analysis is achieved, further enhancing its practical value. The present invention provides reliable technical support for conventional mycoplasma detection and lays a solid foundation for laboratory practice in the fields of biomedical research and biotechnology. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Figure 1 is the experimental result of PCR validity verification and sensitivity analysis; Figure A is the PCR detection result of mycoplasma contamination in different cell lines, L represents DNA ladder, Pos.Control is the positive control (oral mycoplasma quality control product), H2O is the negative control (water sample without mycoplasma DNA), and the remaining lanes correspond to samples of culture supernatant of different cell lines; Figure B is the sensitivity analysis result of the PCR method, L represents 2000bp DNA ladder, and each lane corresponds to the gradient dilution samples of oral mycoplasma quality control product DNA with different concentrations.

[0030] Figure 2 The electrophoresis diagram of qPCR detection results of mycoplasma contamination in different cell lines; L represents DNA ladder, Pos.Control is the positive control (oral mycoplasma quality control product), H2O is the negative control (water sample without mycoplasma DNA), and the remaining lanes correspond to samples of supernatant cultured with different cell lines.

[0031] Figure 3 is the result of qPCR gradient sensitivity test; Figure B is the qPCR amplification curve of samples with different concentration gradients, curves 1 to 11 and 13 are the melting curves of oral mycoplasma quality control DNA containing 75ng / μL, 50ng / μL, 25ng / μL, 20ng / μL, 15ng / μL, 10ng / μL, 5ng / μL, 1ng / μL, 0.5ng / μL, 0.1ng / μL, 0.05ng / μL, and 0ng / μL, respectively, and curve 12 is the melting curve of oral mycoplasma quality control; Figure A is the melting curve analysis, L represents DNA ladder, Pos.Control is the positive control (oral mycoplasma quality control), H2O is the negative control (water sample without mycoplasma DNA), and the other lanes correspond to gradient dilution samples of oral mycoplasma quality control DNA with different concentrations.

[0032] Figure 4It is the electrophoresis result diagram of mycoplasma detection by different primer combinations in Comparative Example 1; Lane L is 2000bp DNA ladder, and lanes 1 to 3 are the experimental results of primer combination 1 detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water sample without mycoplasma DNA; Lanes 4 to 6 are the experimental results of primer combination 2 detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water sample without mycoplasma DNA; Lanes 7 to 9 are the experimental results of primer combination 3 detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water sample without mycoplasma DNA; Lanes 10 to 12 are the experimental results of primer combination 4 detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water sample without mycoplasma DNA. , and the experimental results of water samples without mycoplasma DNA; lanes 13 to 15 are the experimental results of primer combination 5 for detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water samples without mycoplasma DNA, respectively; lanes 16 to 18 are the experimental results of primer combination 6 for detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water samples without mycoplasma DNA, respectively; lanes 19 to 21 are the experimental results of primer combination 7 for detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water samples without mycoplasma DNA, respectively; lanes 22 to 24 are the experimental results of the primer combination of Example 1 of the present invention for detecting Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water samples without mycoplasma DNA, respectively. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0034] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0035] Mycoplasma contamination is a common problem in cell culture. The current detection methods for mycoplasma mainly include culture method, staining method and PCR technology. The culture method is difficult to meet the needs of high-throughput detection due to its long cycle and complex operation; the staining method and immunoassay method are fast, but the sensitivity and specificity are insufficient; the existing PCR method has limited detection range of primers and difficulty in standardization, which limits its wide application in laboratories and different cell lines.

[0036] The present invention provides a PCR primer combination for detecting mycoplasma and its application. The PCR primer combination can detect contaminating mycoplasma in various cell lines, and has versatility and specificity. At the same time, it can stably detect contamination at a mycoplasma DNA concentration as low as 0.5 ng / μL, and has super sensitivity. The present invention provides a method for detecting mycoplasma using the PCR primer combination of the present invention, and the method has the advantages of short detection time, high efficiency, etc.

[0037] The present invention utilizes a variety of cell lines to verify the universality of the PCR primer combination of the present invention. The experimental cells used in the following examples are all purchased from Beijing Zhongsheng Aobang Biotechnology Co., Ltd. The experimental cells used include: human embryonic kidney cells (HEK293, HEK293T), human liver cancer cells (SNU-398, SNU-449, Hep 3b), human gastric cancer cells (HGC-27), human cervical cancer cells (HeLa), human pancreatic cancer cells (PANC-1) and mouse renal tubular epithelial cells (TCMK-1).

[0038] The PCR Mix used in the following examples was purchased from Shanghai Biotech Biotechnology Co., Ltd.; qPCR Mix was purchased from Beijing Dinning Biotechnology Co., Ltd.; primers were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.; nuclease-free water was purchased from Wuhan Sewell Biotechnology Co., Ltd.; oral Mycoplasma quality control products and hyorhinal Mycoplasma quality control products were purchased from Beijing Beina Chuanglian Biotechnology Research Institute; the remaining reagents were imported and packaged abroad or domestically produced analytical grade.

[0039] Example 1: PCR primer design and PCR detection method construction

[0040] 1. Design of primer combination

[0041] In order to develop a universal, highly sensitive, and highly specific PCR detection primer and method for mycoplasma, the present invention selects a highly species-specific and highly conserved 16S rRNA consensus sequence in mycoplasma as a target sequence (SEQ ID NO.3), uses Primer Express software to design primers, and then uses NCBI online tools to perform sequence analysis and comparison to design a pair of primer combinations. The upstream primer sequence is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2, which are as follows:

[0042] SEQ ID NO.1: 5'-GAGGGTGCGGAACATTAAGCT-3',

[0043] SEQ ID NO.2: 5'-AGTTAGCTGCCTTCGCCATT-3',

[0044] SEQ ID NO.3:

[0045] NNNNNNNNNNNGATGAACGCTGGCTGTGTGCCTAATACATGCATGTCGAN

[0046] CGGNNNGTAGCAATACNNTTAGNGGCGAATGGGTGAGTAACACGTNCNTA

[0047] ANCTACCNTTTAGNNTGGNATANCNANTGGAAACANTNGNTAATNCCGNA

[0048] TANANNNNATCGCATGANNNNNNNNNNAAAGNAGCNTTTGCTTCNC

[0049] TANANGATGNGGTGCGGAACATTAGNTAGTTGGTNGGGTAATGGCCNAC

[0050] CAAGNCNATGATGTTTAGCNGGGTTGAGAGNCTGAACNGCCACANTGGG

[0051] ACTGAGANACGGCCCANACTCCTACGGGAGGCAGCAGTAGGGAATNTTC

[0052] CACAATGNGCGAAAGCNTGATGGAGCNACACAGCGTGNANGATGAAGGT

[0053] CTTCGGATTGTAAANTNCTGTTNTANGGGAAGAANANNTAGTANAGGAAA

[0054] TGNTNTTANNTTGACGGTACCNTNTNAGAAAGCNACGGCTAACTATGTGC

[0055] CAGCAGCCGCGGTAATACATAGGTNGCAAGCGTTATCCGGAATTATTGGGC

[0056] GTAAAGCGTNCGTAGGNGTTTATTAAGTCTGGNGTNAAATNCNNGNGCT

[0057] CAACNCNNGNNCGCNTTGGATACTGGTANACTAGAGTTNNNTAGAGGTTA

[0058] GCGGAATTCCNTGTGAAGCGGTGAAATGCGTAGATATANGAAGAACACC

[0059] AANGGCGAAGGCAGCTAACTGGNNNNATACTGACNCTGAGGGACGAAA

[0060] GCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACG

[0061] ATGATNATTAGNTGNTGGANANNTCANTGNCGCAGCTAACGCATTAAATN

[0062] ATCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTTAAAGGAATTGACGG

[0063] GGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGNAG

[0064] AACCTTACCCACTCTTGACATCNTNTGCAAAGCTATAGAGATATAGTGGAG

[0065] GTTAACAGANTGACAGATGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAG

[0066] ATGTTNGGTTAAGTCCTGCAACGAGCGCAACCCTTNTCNTTAGTTACTNN

[0067] NNTTANGTNNAGNACTCTANNGANACTGCCNGNGTAANNNGGAGGAAGG

[0068] TGGGGATGACGTCAAATCATCATGCCTCTTACGAGTGGGGCAACACACGT

[0069] GCTACAATGGNCGGTACAAAGAGANGCAANNTNGTGANATGGAGCAAAT

[0070] CTCAAAAANCCGNTCTCAGTTCGGATTGNAGTCTGCAANTCGACTNCATG

[0071] AAGTCGGAATCGCTAGTAATCGNAGATCAGCTANGCTNCGGTGAATACGT

[0072] TCTCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTAATNCC

[0073] CNAAGTCGGTTTGNTAACNNCGGAGNCNANNGCCTAAGGNAGGACTGGTGACTGGGGTGAAGTCGTANNNNNNNNNNNNN, where N is any one of A, T, C, and G.

[0074] 2. PCR detection system

[0075] The PCR reaction system is: 12.5 μL of PCR Mix, 0.5 μL of the upstream primer of the sequence shown in SEQ ID NO.1, 0.5 μL of the downstream primer of the sequence shown in SEQ ID NO.2, 1 μL of the DNA template of the sample to be tested, and 10.5 μL of nuclease-free water.

[0076] The PCR amplification program was as follows: (1) initial denaturation at 94°C for 30 s; (2) denaturation at 94°C for 30 s; annealing at 55°C for 2 min; extension at 72°C for 1 min; 30 cycles in total; (3) final extension at 72°C for 5 min.

[0077] 3. Validation of primer combination

[0078] To verify the effectiveness of the present invention in detecting mycoplasma contamination in cell culture, the present invention has carried out PCR detection on cell lines of various different sources. The detection objects include human gastric cancer cells (HGC-27), human embryonic kidney cells (HEK293), human cervical cancer cells (HeLa) and mouse renal tubular epithelial cells (TCMK-1). The culture supernatant of each cell line is extracted as a test sample, and PCR amplification is performed using the primer combination and PCR detection system provided by the present invention, and the result is analyzed by agarose gel electrophoresis.

[0079] The experimental results are as follows Figure 1 As shown in Figure A, all the cell lines tested had obvious amplified bands at 500 bp, which was consistent with the size of the amplified product of the positive control. This indicates that mycoplasma contamination exists in the samples tested, and the PCR primer combination can effectively detect mycoplasma DNA. At the same time, the negative control did not show any bands, indicating the functionality and reliability of the primer combination of the present invention in detecting mycoplasma contamination in a variety of cell lines. At the same time, the primer combination provided by the present invention was used to detect different cell lines, and it was found that the intensity of the amplified bands in different samples also suggested that the degree of mycoplasma contamination may vary between different cell lines, which provides the possibility for subsequent quantitative analysis.

[0080] 4. Sensitivity analysis of primer combinations

[0081] In order to evaluate the sensitivity of the PCR primer combination of the present invention in detecting mycoplasma DNA, the present invention conducted a gradient dilution experiment. First, the DNA of the oral mycoplasma quality control product was extracted, and the DNA concentration range was set from 300ng / μL to 0.05ng / μL. After stepwise dilution, PCR amplification was performed according to the primer combination and PCR detection system provided by the present invention. Finally, the PCR product band intensity under each concentration gradient was analyzed by agarose gel electrophoresis to determine the minimum detection limit of the PCR primer combination.

[0082] The experimental results are as follows Figure 1 As shown in Figure B, it was found that in the range of higher concentrations (300ng / μL to 10ng / μL), each lane showed a strong amplification band at 500bp, indicating that the PCR primer combination has a high sensitivity at these concentrations. However, as the concentration of mycoplasma DNA decreases, the intensity of the band gradually weakens. When the DNA concentration is reduced to 0.5ng / μL, the band is still visible, but it is relatively weak; at concentrations below 0.1ng / μL, the band is almost invisible or disappears completely. The results show that the PCR primer combination provided by the present invention can still effectively detect mycoplasma DNA at a DNA concentration of 0.5ng / μL.

[0083] In order to further verify the reliability of this result, the present invention has repeated experiments for many times under different concentration gradients. Each experimental result shows a similar band intensity distribution, proving that the sensitivity of the universal PCR primer combination has good repeatability and reliability. In addition, the negative control did not show any bands in all experiments, further verifying the specificity of the primer combination. These sensitivity analysis results show that the PCR primer combination provided by the present invention can still accurately detect the presence of mycoplasma at a mycoplasma DNA concentration as low as 0.5ng / μL, and has a high detection sensitivity.

[0084] Example 2: Application and verification of qPCR detection method

[0085] qPCR has quantitative analysis capabilities and high-throughput detection characteristics. After completing the functionality and sensitivity verification of traditional PCR, the present invention further verified the PCR primer combination provided by the present invention on a fluorescent quantitative PCR (qPCR) platform. The sensitivity and specificity of the detection primer combination were further explored, a qPCR detection method was constructed, and its practicality in a conventional laboratory environment was evaluated.

[0086] 1. qPCR detection system

[0087] The primer combination provided in Example 1 of the present invention was used to perform qPCR detection on the cell culture medium supernatant samples of human embryonic kidney cells (HEK293, HEK293T), human liver cancer cells (SNU-398, SNU-449, Hep 3b), human gastric cancer cells (HGC-27), human cervical cancer cells (HeLa), human pancreatic cancer cells (PANC-1) and mouse renal tubular epithelial cells (TCMK-1) after continuous culture for 5 days, and finally the qPCR products were analyzed and evaluated by melting curve and electrophoresis analysis.

[0088] Each sample was repeated three times to ensure the accuracy and reliability of the data. Melting curve analysis was used to verify whether there was nonspecific amplification in the amplification products of each concentration of the sample. Agarose gel electrophoresis was used to further confirm the specificity of the amplification products.

[0089] The qPCR reaction system was: 10 μL of qPCR Mix, 0.5 μL of the upstream primer of the sequence shown in SEQ ID NO.1, 0.5 μL of the downstream primer of the sequence shown in SEQ ID NO.2, 1 μL of the DNA template of the sample to be tested, and 8 μL of nuclease-free water.

[0090] The detailed steps of the qPCR amplification procedure are shown in Table 1, which includes melting curve analysis to ensure the specificity of the amplification product.

[0091] Table 1 qPCR amplification procedure

[0092]

[0093] Note: “-” means there is no such item.

[0094] 2. Experimental results

[0095] The results of the qPCR reaction were analyzed by the Ct value (cycle threshold). The Ct value refers to the number of cycles in the PCR reaction at which the fluorescence signal exceeds the background level. The lower the Ct value, the higher the concentration of target DNA in the sample. The oral mycoplasma quality control product was used as the positive control sample, and the water sample without mycoplasma DNA was used as the negative control sample.

[0096] Table 2 qPCR test results Ct value

[0097] Cell Name 1 2 3 4 5 Mean ± SD HEK293 30.44 30.53 30.52 30.40 30.69 30.52±0.11* HEK293T 29.05 29.27 29.51 29.53 28.49 29.17±0.43* SNU-398 33.00 33.38 34.03 33.70 32.55 33.33±0.58 SNU-449 32.72 32.53 33.30 34.08 34.10 33.35±0.73 HGC-27 33.33 34.10 33.72 32.49 32.08 33.14±0.84 Hep3b 33.24 33.19 34.07 33.47 32.81 33.36±0.46 Hela 29.02 28.92 28.98 28.53 28.08 28.71±0.40* PANC-1 31.96 31.61 32.80 33.18 34.10 32.73±0.99 TCMK-1 32.00 30.42 33.29 31.03 32.25 31.80±1.11 Positive Control 26.69 26.39 26.16 26.31 27.17 26.54±0.40* Negative control 34.58 34.04 33.45 33.02 33.45 33.71±0.61

[0098] Note: * indicates significant difference compared with the negative control result (p<0.05).

[0099] As can be seen from the results of qPCR in Table 2, the Ct values ​​of all positive controls are <27, and the Ct values ​​of negative controls are >33. Among the 9 cell samples tested, the Ct values ​​of HEK293, HEK293T and Hela cells are between 28 and 31, which are significantly lower than those of the negative control group. By performing correlation analysis on the results of HEK293, HEK293T, Hela cells and positive samples and negative samples, it was found that there were significant differences between the results of HEK293, HEK293T, Hela cells and negative samples, indicating that HEK293, HEK293T and Hela cells have obvious mycoplasma infection characteristics, which is highly consistent with the amplification band intensity detected by the PCR method in Example 1, further verifying the effectiveness of the PCR primer combination of the present invention. In contrast, the Ct values ​​of the negative controls are all higher than 33, indicating that mycoplasma DNA is not detected, which further confirms the specificity of the primer combination.

[0100] 3. Effectiveness of primer combinations in qPCR platform detection

[0101] The qPCR amplification products were analyzed by agarose gel electrophoresis. Figure 2 As shown, it can be found that HEK293, HEK293T and Hela cells all amplified obvious specific amplification bands at 500 bp, and no non-specific bands were seen, indicating that the amplified product has a high degree of specificity and no non-specific amplification occurs. The electrophoresis results are consistent with the results in Table 2, indicating that the primer combination and qPCR method provided by the present invention can detect mycoplasma contamination in the supernatant of various cell culture media, proving the functionality and feasibility of PCR primers in qPCR platform detection and the feasibility of the qPCR method.

[0102] 4. Sensitivity test of primer combination on qPCR platform

[0103] In order to further evaluate the sensitivity of the primer combination of the present invention on the qPCR platform, verify the applicability of the primer combination in a wide concentration range, and evaluate its detection ability and quantitative accuracy at different DNA concentrations, the present invention conducted a gradient dilution experiment.

[0104] (1) Experimental design

[0105] DNA of oral mycoplasma quality control was extracted and diluted to multiple concentration levels ranging from 75 ng / μL to 0.05 ng / μL. Each concentration of sample was amplified by qPCR, and the reaction system and amplification procedure were consistent with the reaction system and amplification procedure of qPCR in this example. After amplification, the qPCR product was analyzed and evaluated by melting curve and agarose gel electrophoresis to ensure the specificity and accuracy of the amplified product.

[0106] To ensure the accuracy of the data, all samples were subjected to three independent replicates at each concentration. Melting curve analysis was used to verify whether there was nonspecific amplification of the amplified products of each concentration of the sample. Agarose gel electrophoresis was used to further confirm the specificity of the amplified products.

[0107] (2) Results and analysis

[0108] like Figure 3 The qPCR results shown in Figure A show that in high concentration samples (75ng / μL to 10ng / μL), the amplified products appear as clear and intense bands in the electrophoresis image. As the concentration is further reduced to 5ng / μL and 1ng / μL, the intensity of the bands also weakens accordingly. When the sample concentration is reduced to 0.5ng / μL, the amplified bands are still visible, indicating that the qPCR primer combination still has detection ability at this concentration. However, at lower concentrations (0.1ng / μL and 0.05ng / μL), the amplified bands are almost invisible in the electrophoresis image, which means that the detection ability of the qPCR primer combination is significantly reduced at these concentrations.

[0109] Figure 3 Figure B is the result of melting curve analysis. It can be found that in all samples, the main melting peak appears at about 85°C, and no other non-specific peaks are observed, which indicates that the qPCR amplification product has a high degree of specificity. Electrophoresis analysis further verifies this point, and no non-specific amplification bands are seen in all positive samples.

[0110] Through the qPCR gradient sensitivity test, it can be determined that the minimum detection limit of the PCR primer combination provided by the present invention on the qPCR platform is 0.5 ng / μL, indicating that the PCR primer combination of the present invention can reliably detect mycoplasma DNA at a lower concentration and provide an accurate Ct value.

[0111] Comparative Example 1: PCR primer design and PCR method verification

[0112] 1. PCR primer design

[0113] According to the primer design principles, the inventors also designed primer combination 1 to primer combination 7 for detecting mycoplasma during the exploration process. The nucleotide sequences corresponding to primer combination 1 to primer combination 7 are shown in Table 3.

[0114] Table 3 Nucleotide sequence table of primer combination 1 to primer combination 7

[0115]

[0116]

[0117] The present invention uses primer combination 1 to primer combination 7, according to the qPCR reaction system and amplification procedure in Example 2, to amplify the hyorhinis Mycoplasma quality control DNA, oral Mycoplasma quality control DNA and mycoplasma-free DNA water samples, and the amplification results are analyzed by electrophoresis results.

[0118] exist Figure 4 In the electrophoresis results shown, lanes 1 to 21 are the test results of primer combination 1 to primer combination 7 for detecting Mycoplasma hyorhinis quality control DNA, Mycoplasma oralis quality control DNA, and water samples without mycoplasma DNA, respectively, and lanes 22 to 24 are the experimental results of Mycoplasma hyorhinis quality control, Mycoplasma oralis quality control, and water samples without mycoplasma DNA, respectively, using the primer combination of Example 1 of the present invention.

[0119] from Figure 4 The agarose electrophoresis result shows that lanes 1 to 21 do not amplify specific bands at 500 bp, while lanes 22 to 23 can amplify specific bands at 500 bp. This indicates that primer combination 1 to primer combination 7 cannot detect Mycoplasma hyorhinis and Mycoplasma oralis, while the primer combination of Example 1 of the present invention can detect Mycoplasma hyorhinis and Mycoplasma oralis.

[0120] Table 4 qPCR test results Ct value

[0121]

[0122]

[0123] Note: * indicates significant difference compared with the negative control result (p<0.05).

[0124] From the results of qPCR in Table 4, it can be seen that the Ct values ​​of swine rhinitis mycoplasma, oral mycoplasma and negative samples detected by primer combination 1 to primer combination 3, primer combination 5 to primer combination 6 are similar, with no significant difference. The Ct values ​​of swine rhinitis mycoplasma and oral mycoplasma detected by primer combination 4, primer combination 7 and the primer combination in Example 1 are significantly different from the Ct values ​​of negative samples. The results were subjected to correlation analysis, and it was found that there were significant differences in the results (p<0.05), indicating that primer combination 4, primer combination 7 and the primer combination in Example 1 have obvious mycoplasma infection characteristics, and other primer combinations have no obvious mycoplasma infection characteristics. At the same time, the primer combination in Example 1 has a lower Ct value when detecting mycoplasma, which is quite different from the negative sample. The Ct values ​​of primer combination 4 and primer combination 7 when detecting mycoplasma are slightly different from the negative sample, indicating that the primer combination developed in this study has high sensitivity.

[0125] The Ct value of the qPCR result was compared with the electrophoresis result. Primer combination 4 and primer combination 7 did not detect Mycoplasma hyorhinis and Mycoplasma oralis during qPCR electrophoresis detection, while the primer combination provided in Example 1 was able to stably detect the presence of mycoplasma in both qPCR and PCR electrophoresis detection.

[0126] A comprehensive comparison of the agarose gel electrophoresis test results of the primer combination 1 to primer combination 7 and the primer combination provided in Example 1 shows that when the primer sequences are different, even if the amplification system and conditions are the same, significantly different test results will still be obtained. This shows that the effects of different primer sequences designed by the primer design principle are not equivalent, and there is no regularity to follow in determining the quality of agarose electrophoresis results.

[0127] In summary, the present invention provides a PCR primer combination for detecting mycoplasma and its application, and verifies the universality, specificity and sensitivity of the primer combination through experiments. This primer combination can stably detect contamination at a mycoplasma DNA concentration as low as 0.5 ng / μL. The mycoplasma detection kit prepared using the primer combination of the present invention has the characteristics of easy operation, strong detection specificity, high sensitivity, etc., and can be used for the detection of mycoplasma in various cell cultures in the laboratory.

Claims

1. A PCR primer combination for detecting mycoplasma, characterized in that: The primer combination comprises an upstream primer and a downstream primer, and the specific sequence is: Upstream primer: 5'-GAGGGTGCGGAACATTAGCT-3', Downstream primer: 5′-AGTTAGCTGCCTTCGCCATT-3′.

2. Use of the PCR primer combination according to claim 1 in detecting mycoplasma.

3. The use of the PCR primer combination according to claim 2 in detecting mycoplasma, characterized in that: The PCR primer combination is used to detect mycoplasma in cell culture; the cells are any one or more of human embryonic kidney cells, human liver cancer cells, human gastric cancer cells, human cervical cancer cells, human pancreatic cancer cells and mouse renal tubular epithelial cells.

4. A kit for detecting mycoplasma, characterized in that: The kit comprises the primer combination according to claim 1.

5. A method for detecting mycoplasma, characterized in that: include: The primer combination according to claim 1 is used to detect the sample to be tested, and whether the sample to be tested contains mycoplasma genes is determined according to the test results.

6. The method according to claim 5, characterized in that include: Extracting DNA from the sample to be tested; Performing PCR amplification or qPCR amplification using the primer combination to obtain an amplified product; The amplified product was analyzed by electrophoresis. If a band was found at 500 bp, it was determined that the sample contained mycoplasma genes.

7. The method according to claim 5, characterized in that The PCR amplification system is: PCRMix 12.5 μL, the upstream primer 0.5 μL to 1 μL, the downstream primer 0.5 μL to 1 μL, the DNA template of the sample to be tested 1 μL to 2 μL, and nuclease-free water to make up to 25 μL.

8. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is: (1) initial denaturation; (2) denaturation; annealing: 54°C to 56°C, 2 min; extension; a total of 30 to 32 cycles; (3) terminal extension.

9. The method according to claim 5, characterized in that The amplification system of the qPCR is: 10 μL of PCRMix, 0.5 μL to 1 μL of the upstream primer, 0.5 μL to 1 μL of the downstream primer, 1 μL to 2 μL of the DNA template of the sample to be tested, and nuclease-free water is added to 20 μL.

10. The method according to claim 5, characterized in that The reaction procedure of the qPCR amplification is: (1) initial denaturation; (2) denaturation; annealing and extension: 62°C to 65°C, 1 min; a total of 39 to 41 cycles.

Images