Penicillium fungus GS218, penicillium fungus GS218 conidium suspension and preparation method and application of penicillium fungus GS218 conidium suspension

Abstract

The invention discloses a penicillium fungus GS218, a penicillium fungus GS218 conidium suspension and a preparation method and application of the penicillium fungus GS218 conidium suspension. The penicillium fungus GS218 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC M 20241477, and the penicillium fungus GS218 is separated from fruits of trifoliate orange in a Hunan Institute of Gardening Institute of Hunan Province in the East Lake Street, Hibiscus District, Changsha City, Hunan Province. The penicillium fungus has a relatively good antagonistic effect on HLB13 fusarium buchneri, colletotrichum spinosus, fusarium solani, fusarium oxysporum cucumber specialized type and botrytis cinerea; the composition can be used for effectively preventing and treating carrot diseases caused by HLB13 fusarium brucellosis, pepper anthracnose caused by colletotrichum spinosus, pepper root rot caused by fusarium solani, cucumber fusarium wilt caused by fusarium oxysporum cucumber specialization and botrytis cinerea caused by botrytis cinerea, and has remarkable and stable technical effects; the method has wide application value in the technical field of microbial strain application.

Description

Technical Field

[0001] The invention relates to the technical field of microbial strains and applications thereof, and in particular to a Penicillium fungus GS218, a Penicillium fungus GS218 conidia suspension, and a preparation method and application thereof. Background Art

[0002] Plant diseases, as an important limiting factor in agricultural production, pose a serious threat to global agriculture and food safety. Although traditional chemical control methods can control plant diseases to a certain extent, they also bring about problems such as environmental pollution, ecological damage, and food residues, which has aroused people's attention to sustainable and environmentally friendly plant disease control technologies. In recent years, green organic agriculture has emerged, and actively exploring the application of biological control technology to replace or partially replace the use of pesticides has become a hot topic in current research.

[0003] Endophytes are fungi or bacteria that live in the tissues and organs of healthy plants at certain stages or all stages. They are commonly found in higher plants, such as woody plants, herbaceous plants, monocots and dicots. At present, plant endophytes have become potential microbial pesticides, yield-increasing bacteria or potential biocontrol vectors for biological control.

[0004] As a potential biocontrol fungus, Penicillium has broad research value in biological control. Actively screening related strains, tapping into microbial resources, and screening out new, highly active, and functionally stable strains are of great significance for the prevention and control of plant diseases. Summary of the invention

[0005] The purpose of the present invention is to solve the above technical problems and provide a new species of Penicillium fungus GS218, a conidia suspension of the new species of Penicillium fungus GS218 and a preparation method and application thereof. The strain has the characteristics of antagonizing multiple fungal pathogens, and its application in the prevention and control of plant diseases shows significant and stable technical effects, and has a wide range of application value in the field of microbial strain application technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention first provides a Penicillium fungus, which is named Penicillium sp. GS218, deposited in China Center for Type Culture Collection on July 3, 2024, with a deposit number of CCTCC M 20241477, and a deposit address of Wuhan University, Wuhan City, Hubei Province, China.

[0008] Based on the above scheme, the Penicillium fungus GS218 was isolated from the fruit of the trifoliate orange at the base of Hunan Horticultural Research Institute, Donghu Street, Furong District, Changsha City, Hunan Province.

[0009] Based on the above scheme, the morphology of the Penicillium fungus GS218 colony is: when cultured on PDA culture medium, the front of the colony is white, the surface is dry and opaque, the hyphae are fluffy, the center of the back of the colony is brown, the surrounding is yellow, the middle is thick, and the edges are thin.

[0010] Based on the above scheme, the PDA culture medium formula is: potato extract powder 6-8g / L, glucose 20-22g / L, agar 20-22g / L, prepared with water, pH 5.6±0.2.

[0011] Based on the above scheme, the ITS rDNA sequence of the Penicillium fungus GS218 is shown as SEQ ID NO.3.

[0012] The present invention also provides a method for preparing a conidia suspension of Penicillium fungus GS218, comprising the following steps:

[0013] The Penicillium fungus GS218 is cultured on a culture medium plate at a constant temperature of 30-35° C. for 5-7 days. After the culture is completed, sterile water is added, and the mixture is fully shaken to wash off the conidia on the culture medium plate, and then filtered. The filtrate is a conidia suspension.

[0014] On the basis of the above scheme, the preparation method further comprises: using a hemocytometer to determine the concentration of conidia in the conidia suspension, and then preparing a conidia suspension with a concentration of 1×10 6 -10 9 CFU / mL of conidia suspension.

[0015] Based on the above scheme, the culture medium is PDA culture medium.

[0016] Based on the above scheme, the PDA culture medium formula is: potato extract powder 6-8g / L, glucose 20-22g / L, agar 20-22g / L, prepared with water, pH 5.6±0.2.

[0017] Based on the above scheme, the filtration is sterilized absorbent cotton filtration.

[0018] The conidia suspension of Penicillium fungus GS218 is prepared according to the above preparation method.

[0019] The present invention also provides an application of the Penicillium GS218 or the conidia suspension of the Penicillium GS218 in inhibiting plant fungal pathogens.

[0020] Based on the above scheme, the plant fungal pathogens include any one of HLB13 Fusariumboothii, Colletotrichum sp., Fusarium solani, Fusarium oxysporumf.sp.cucumerinum, Foc, and Botrytis cinerea.

[0021] Beneficial effects of the present invention:

[0022] The invention provides a new Penicillium sp. fungus GS218. Through a plate confrontation experiment, it is found that the new Penicillium sp. fungus has good antagonistic effects on HLB13 Fusarium buckerii, Colletotrichum thornis, Fusarium solani, Fusarium oxysporum cucumber-specific type and Botrytis cinerea. Through a plant leaf disease resistance experiment, it is further verified that the conidia suspension of the strain can inhibit the growth of HLB13 Fusarium buckerii, Colletotrichum thornis, Fusarium solani, Fusarium oxysporum cucumber-specific type and Botrytis cinerea, and significantly slow down the disease of plants. The new Penicillium sp. fungus has good control effects on carrot diseases caused by HLB13 Fusarium buckerii, pepper anthracnose caused by Colletotrichum thornis, pepper root rot caused by Fusarium solani, cucumber wilt caused by Fusarium oxysporum cucumber-specific type and tomato gray mold caused by Botrytis cinerea, thereby finding a new direction for the control of plant diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The colony morphology of Penicillium sp. GS218 on the front of the plate on PDA medium, MEA medium, CMA medium and OA medium respectively;

[0024] The formula of PDA medium is as follows: 6 g potato powder, 20 g glucose, 20 g agar, dissolved in water, finally fixed to 1000 mL, pH 5.6 ± 0.2, autoclaved at 121 °C for 20 min;

[0025] The formula of MEA medium is: 30 g malt extract, 3 g soy peptone, 20 g agar, distilled water to 1000 mL, pH adjusted to 5.6 ± 0.2, and autoclaved at 121 °C for 20 min;

[0026] The formula of CMA medium is as follows: 25 g corn flour, 20 g agar, distilled water to 1000 mL, pH adjusted to 5.6 ± 0.2, and autoclaved at 121 °C for 20 min;

[0027] The formula of OA medium is: 30g oats, CuSO4 ·5H 2 O 0.005g, ZnSO 4 7H 2 O 0.01g, agar 20g, distilled water to 1000mL, pH 6.5±0.2, autoclave at 121℃ for 20min.

[0028] Figure 2 This is a colony morphology of Penicillium sp. GS218 on the back of a PDA medium plate;

[0029] Figure 3 The electron microscope scanning images of the microscopic morphology of Penicillium sp. GS218, where AD are the details of the conidiophores and conidia of GS218;

[0030] Figure 4 Phylogenetic tree analysis of ITS rDNA sequences of Penicillium sp. GS218 constructed by the neighbor-joining method.

[0031] Figure 5 The diagram shows the antagonistic effect of Penicillium sp. GS218 on HLB13 Fusarium solani, wherein A: HLB13 Fusarium solani; B: confrontation culture effect of Penicillium sp. GS218 and HLB13 Fusarium solani.

[0032] Figure 6 The diagram shows the antagonistic effect of Penicillium sp. GS218 on Colletotrichum spinulosum, wherein A: Colletotrichum spinulosum; B: confrontation culture effect of Penicillium sp. GS218 and Colletotrichum spinulosum.

[0033] Figure 7 The diagram shows the antagonistic effect of Penicillium sp. GS218 on Fusarium solani, wherein A: Fusarium solani; B: confrontation culture effect of Penicillium sp. GS218 and Fusarium solani.

[0034] Figure 8 These are diagrams showing the antagonistic effect of Penicillium sp. GS218 on the cucumber-specific type of Fusarium oxysporum, wherein A: the cucumber-specific type of Fusarium oxysporum; B: the confrontation culture effect diagram of Penicillium sp. GS218 and the cucumber-specific type of Fusarium oxysporum.

[0035] Fig. 9The diagram shows the antagonistic effect of Penicillium sp. GS218 on Botrytis cinerea, wherein A: Botrytis cinerea; B: confrontation culture effect of Penicillium sp. GS218 and Botrytis cinerea. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution in the embodiment of the present invention will be clearly and completely described below in combination with the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the embodiment of the present invention, other embodiments obtained by ordinary technicians in this field without creative work are all within the scope of protection of the present invention.

[0037] The bacterial culture medium used in the following examples is as follows:

[0038] The formula of PDA medium is: 6 g potato powder, 20 g glucose, 20 g agar, add water to dissolve, and finally make up to 1000 mL, pH 5.6±0.2, and autoclave at 121°C for 20 min.

[0039] Example 1 Isolation, purification and identification of Penicillium sp. GS218

[0040] (1) Isolation and purification of strains

[0041] Fresh, disease-free fruits of Poncirus trifoliata were collected from the Hunan Horticultural Research Institute in Furong District, Changsha City, Hunan Province, rinsed with tap water, disinfected with 5% sodium hypochlorite and 75% alcohol, and separated by dilution plate method. The fruits were then placed on PDA medium in a 30°C constant temperature incubator for 7 days. After purification by the mycelium tip cutting method, the strain was numbered GS218. GS218 was cut into pieces and placed in 750 μL of sterile glycerol, gently shaken and mixed, and stored at -80°C for a long time.

[0042] (2) Classification and identification

[0043] Colony morphology of strain GS218: strain GS218 was cultured on PDA medium and grew well. After 7 days of culture in a 30°C constant temperature incubator, the colony diameter was about 3.5 cm. The front of the colony was white, the surface was dry and opaque, the hyphae were fluffy, the back of the colony was brown in the center and yellow around, thick in the middle and thin around the edges, and the growth was relatively dense. The conidia of strain GS218 were spherical, 2-2.5 μm in diameter, with smooth walls and spore stalks (30-40×2.5-3) μm. Figure 1 The colony morphology of strain GS218 on the front of the plate on different culture media; Figure 3 This is a scanning electron microscope image of the microscopic morphology of strain GS218.

[0044] The ITS rDNA gene of strain GS218 was sequenced: the ITS rDNA gene was amplified using the universal primers ITS5 / ITS4 for fungi (sequences shown in SEQ ID NO.1 and SEQ ID NO.2), and the gene sequence obtained after the PCR product was sent for sequencing (the nucleotide sequence of the ITS rDNA gene is shown in SEQ ID NO.3) was compared and analyzed in NCBI, and a phylogenetic tree was constructed, see Figure 4 As shown in the figure, the strain GS218 had the highest homology with Penicillium nepalense culture CBS:203.84, with a sequence similarity of 97.28%. The phylogenetic tree was established using MEGA 7.0 software, and the results showed that the strain GS218 and Penicillium nepalense culture CBS:203.84 were clustered on the same branch, with a confidence value of 100%. After a series of molecular identifications of strains, GS218 was determined to be a new species of Penicillium sp., and was named Penicillium sp. GS218 from a taxonomic point of view.

[0045] The nucleotide sequence of universal primer ITS5 is 5′-GGAAGTAAAAGTCGTAACAAGG-3′, as shown in SEQ ID NO. 1;

[0046] The nucleotide sequence of the universal primer ITS4 is 5′-TCCTCCGCTTATTGATATGC-3′, as shown in SEQ ID NO.2.

[0047] The nucleotide sequence of the ITS rDNA gene is shown in SEQ ID NO.3:

[0048] CTGTGCGATGGACGCAATGATTCCTTCCGCAGTGTACACTTATCGAAGCCTTTGCAGCCACGCAAGTGGTAGACCCGGCACGACTCTAAACAAGGCCAGTCGCGATGCAAGTCGGCACCCGCCGGCGACACTTTCGAATTGACGGGGACACCCTAAAGCCGATCGCACCAACCCGCGGCGGGAAACCGCCCGGGGGCCCGTGGTAATGACACGGGGGATGGTAATAGACGATCCGGATACTTCTGCGGCGCCGCCGTAGAGACCATGGGCAATCCGCAGCGAAGCCTCTAAGTCCCCCCGCCGGGATACGAGGAACGTCCACAGACTAAGTGGAAGTGGGTGGGGGACTCCGTTCCCCCGCTTAAGATATAGTCGGGCCCCCCGGGAGACCGGGGGGGTGAGTACACTGCAACTCTGAAACAAACCCGTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGCGCCCGCCGAAGACACCTGTGAACGCTGTATGA AGATTGCAGTCTGAGCGAAAAGCTAAATTTATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTCCAGGTGACCTCGGATCAGGT

[0049] Example 2 Antagonistic experiment of Penicillium sp. GS218 against HLB13 Fusarium brucei, Colletotrichum spicatum, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea

[0050] The plate confrontation method was used: HLB13 Fusarium brucei, Colletotrichum thorni, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea were inoculated in the center of the PDA medium plate, and Penicillium sp. GS218 was inoculated 2 cm away from the center of the medium by the cross method; the control group was not inoculated with Penicillium sp. GS218, and was cultured at 30°C for 7 days, and the width of the inhibition zone was measured. Each group was treated 3 times. The results are shown in Figure 5-9 And as shown in Table 1.

[0051] Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter * 100%

[0052] Table 1 The inhibitory effect of Penicillium sp. GS218 on HLB13 Fusarium brucei, Colletotrichum spicatum, Fusarium solani, Fusarium oxysporum cucumber-specific type and Botrytis cinerea

[0053]

[0054] The results are as follows Figure 5-9 As shown in Table 1, Penicillium sp. GS218 has significant antagonistic effect on HLB13 Fusarium brucelli, Colletotrichum thornyum, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea, with inhibition rates of 56.57%, 60.75%, 60.38%, 51.37%, and 60.86%, respectively, indicating that Penicillium sp. GS218 has good antagonistic effect on HLB13 Fusarium brucelli, Colletotrichum thornyum, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea.

[0055] Example 3 Preparation of Penicillium sp. GS218 conidia suspension

[0056] Penicillium sp. GS218 was cultured on PDA medium at 30°C for 7 days, then 10 mL of sterile water was added and shaken thoroughly to wash out the conidia. The conidia fell into the sterile water and then filtered with sterilized absorbent cotton. The filtrate was the conidia suspension of the strain. The concentration of conidia in the conidia suspension was measured by a hemocytometer and was 1×10 9CFU / mL. Then, sterile water was added to dilute as needed to prepare a conidia concentration of 1×10 5 CFU / mL, 1×10 6 CFU / mL, 1×10 7 CFU / mL, 1×10 8 CFU / mL, 1×10 9 CFU / mL of conidia suspension.

[0057] Example 4 Disease resistance test of Penicillium sp. GS218 conidia suspension in plant leaves

[0058] Healthy carrot, pepper, cucumber and tomato leaves with basically the same growth were selected, rinsed with sterile water and dried, placed in an inoculation basin, moistened with wet absorbent cotton, and all leaves were pierced with sterile cotton swabs. Five treatment groups were set according to the spraying concentration of Penicillium sp. GS218 conidia: T1 (1×10 5 CFU / mL), T2(1×10 6 CFU / mL), T3(1×10 7 CFU / mL), T4 (1×10 8 CFU / mL) and T5 (1×10 9 CFU / mL), the volume of spore suspension sprayed in each treatment group was the same, and after waiting for 10 minutes, the corresponding plant leaf types and diseases (carrot disease, pepper anthracnose, pepper root rot, cucumber wilt, tomato gray mold) were inoculated with HLB13 Fusarium brucei, Colletotrichum thornis, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea cakes; a control group (CK) was set up, and the control group was evenly sprayed with sterile water. Six leaves in each treatment were used as one replicate, and repeated 3 times. Finally, they were covered with plastic wrap and placed in a 28℃ incubator with alternating light and dark for 7 days. The disease situation was observed regularly, and the severity of the disease, disease index, and endophyte control effect were recorded. The disease index and control effect calculation formula are as follows: disease index = Σ (number of diseased plants × corresponding level) / total number of plants × highest level × 100; control effect = (control group disease index - treatment group disease index) / control group disease index × 100%. The results are shown in Table 2.

[0059] Table 2 Disease index and relative control effect of carrot diseases, pepper anthracnose, pepper root rot, cucumber wilt and tomato gray mold

[0060]

[0061]

[0062]

[0063] According to the analysis in Table 2, after the treatment with Penicillium sp. GS218 conidia suspension, the disease index of crops such as carrots, peppers, cucumbers, and tomatoes was significantly lower than that of the control group. Different concentrations of Penicillium sp. GS218 conidia suspensions had certain control effects on carrot diseases caused by HLB13 Fusarium brucei, pepper anthracnose caused by Colletotrichum spicatum, pepper root rot caused by Fusarium solani, cucumber wilt caused by the cucumber-specific type of Fusarium oxysporum, and tomato gray mold caused by Botrytis cinerea. Moreover, as the concentration of Penicillium sp. GS218 conidia in the suspension gradually increased, its overall control effect on crop diseases showed a trend of first increasing and then decreasing. Among them, the T4 treatment, i.e., the concentration of GS218 conidia was 1×10 8 CFU / mL, the conidia suspension of Penicillium sp. GS218 had the best control effect on different crop diseases such as carrot disease caused by HLB13 Fusarium brucelli, pepper anthracnose caused by Colletotrichum spinulosum, pepper root rot caused by Fusarium solani, cucumber wilt caused by Fusarium oxysporum cucumber-specific type, and tomato gray mold caused by Botrytis cinerea.

Claims

1. A Penicillium sp. GS218, characterized in that: The Penicillium fungus was deposited in the China Center for Type Culture Collection on July 3, 2024, with the deposit number: CCTCC M20241477, and the deposit address: Wuhan University, Wuhan City, Hubei Province, China.

2. The Penicillium sp. GS218 according to claim 1, characterized in that: The ITS rDNA sequence of the Penicillium fungus is shown as SEQ ID No.

3.

3. A method for preparing a conidia suspension of Penicillium GS218, comprising the following steps: The Penicillium fungus GS218 according to claim 1 or 2 is cultured on a culture medium plate at a constant temperature of 30-35° C. for 5-7 days. After the culture is completed, sterile water is added, and the culture medium is fully shaken to wash off the conidia on the culture medium plate, and then filtered. The filtrate is the conidia suspension.

4. The preparation method according to claim 3, characterized in that: The preparation method further comprises: using a hemocytometer to measure the concentration of conidia in the conidia suspension, and then preparing a conidia suspension with a conidia concentration of 1×10 6 -10 9 CFU / mL of conidia suspension.

5. The preparation method according to claim 3, characterized in that: The culture medium is PDA culture medium.

6. The preparation method according to claim 5, characterized in that: The PDA culture medium is formulated as follows: 6-8 g / L potato extract powder, 20-22 g / L glucose, 20-22 g / L agar, prepared with water, pH 5.6±0.

2.

7. The preparation method according to claim 3, characterized in that: The filtration is performed through sterilized absorbent cotton.

8. A conidia suspension of Penicillium GS218 obtained according to the preparation method according to any one of claims 3 to 7.

9. Use of the Penicillium GS218 according to any one of claims 1 to 2 or the conidia suspension of Penicillium GS218 according to claim 8 in inhibiting plant fungal pathogens.

10. The use according to claim 9, characterized in that: The plant fungal pathogens include any one of HLB13 Fusarium boothii, Fusarium solani, Fusarium oxysporumf.sp.cucumerinum, Foc, and Botrytis cinerea.

Images