Gene AcMYB22 for regulating and controlling biosynthesis of kiwi fruit flavonoids and application of gene AcMYB22

Abstract

The invention discloses a gene AcMYB22 for regulating and controlling biosynthesis of kiwi fruit flavonoids and application of the gene AcMYB22, and belongs to the technical field of gene engineering. According to the invention, two alleles, namely AcMYB22-1 and AcMYB22-2, of an AcMYB22 transcription factor are cloned from 'Hongyang' kiwi fruit and a bud mutation material of the 'Hongyang' kiwi fruit. Plant expression vectors of the AcMYB22-1 and the AcMYB22-2 are constructed, and an agrobacterium-mediated method is adopted to obtain overexpressed kiwi fruits and stable overexpressed kiwi plants. The accumulation of flavone and anthocyanin is promoted in an overexpression material. The research enriches the mechanism of regulating and controlling the biosynthesis of the kiwi fruit flavonoids by the MYB transcription factor, provides technical support for improving the synthesis of the plant flavonoids, and has important significance for improving the quality of kiwi fruits and breeding new varieties.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a gene AcMYB22 for regulating the biosynthesis of flavonoids in kiwifruit and an application thereof. Background Art

[0002] Flavonoids are a class of polyphenolic secondary metabolites with low molecular weight, which have natural antioxidant activity and participate in plant growth and development, physiological metabolism, biological and non-stress response processes. Flavonoids are natural products widely found in plants, and their structures and types are extremely rich. According to statistics, more than 10,000 flavonoids have been identified in plants. Although flavonoids have diverse structures, they all have a common flavonoid aglycone, namely C6-C3-C6 structure, and its basic structure consists of two aromatic rings plus a heterocyclic ring. Based on the different structures, flavonoid substances can be further subdivided into six main subclasses: flavones, flavonols, flavanones, flavanols, anthocyanins and isoflavones. The synthesis pathway of flavonoids has been fully studied in model plants. It originates from the metabolism of phenylalanine. The genes involved include phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), 4-coumaric acid: CoA ligase (4CL), chalcone synthase (CHS), coumarin isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS), anthocyanin synthase (ANS), anthocyanin reductase (ANR), flavonoid 3′-hydroxylase (F3′H), flavonoid 3′,5′-hydroxylase (F3′5′H), dihydroflavanol 4-reductase (DFR), anthocyanin synthase (ANS), etc.

[0003] In plants, some MYB transcription factors have been identified to be involved in the regulation of the synthesis of flavonoid compounds, some of which play a positive regulatory role and some of which play a negative regulatory role. For example, Arabidopsis AtMYB4 inhibits the transcription of genes from PAL to 4CL, thereby inhibiting the synthesis of flavonoids, etc.; AtMYB7 inhibits anthocyanin synthesis by negatively regulating the expression of genes encoding key enzymes DFR and UDP in the flavonoid pathway. The transcription factors of the 5th to 7th subgroups of R2R3-MYB mostly play a positive regulatory role in the flavonoid biosynthesis pathway. The 5th subgroup of R2R3-MYB (TT2 / SG5 / PA2) is generally considered to be an activator of proanthocyanidin biosynthesis; members of the 6th subfamily AtMYB75 / 90 / 113 / 114 positively regulate genes such as DFR, LDOX and ANS, and MdMYB10 binds to the W-box in the MdUFGT promoter to positively regulate the accumulation of anthocyanins; members of the 7th subfamily such as AtMYB11, AtMYB12 and AtMYB111 mainly affect the synthesis of flavonols by promoting the expression of early genes such as CHS, CHI, FLS, and CsMYB12 positively regulates the FLS gene to produce flavonols.

[0004] Multiple MYB transcription factors were found in kiwifruit to regulate the biosynthesis of anthocyanins. When AcMYB75 was introduced into Arabidopsis, the content of anthocyanins in leaves was significantly increased, and the expression of anthocyanin biosynthesis genes was greatly upregulated. AcMYB10 interacted with AcbHLH42 to activate the biosynthesis of anthocyanins by activating the transcription of AcLDOX and AcF3GT. Overexpression of AcMYB10 can positively regulate the accumulation of anthocyanins in 'Hongyang' tissue culture seedlings. Co-expression of AcMYB123 and AcbHLH42 activates the transcription of late flavonoid biosynthesis genes AcF3GT1 and AcANS to produce anthocyanins. AcMYB110 was overexpressed in kiwifruit fruits and petals, and anthocyanins were significantly upregulated. However, there are few reports on MYB transcription factors regulating the biosynthesis of other flavonoid components. Therefore, enriching the application of MYB transcription factors in regulating the biosynthesis of flavonoids in kiwifruit is of great significance for improving the nutritional quality of kiwifruit and breeding new varieties. Summary of the invention

[0005] The purpose of the present invention is to provide a gene AcMYB22 for regulating the biosynthesis of flavonoids in kiwi fruit and its application, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is the use of the AcMYB22 gene or its expression vector in regulating the biosynthesis of flavonoids in plant fruits, wherein the plants include kiwifruit.

[0008] The second technical solution of the present invention is a method for regulating the biosynthesis of flavonoids in plant fruits, overexpressing the AcMYB22 gene to promote the biosynthesis of flavonoids in plant fruits; silencing or knocking out the AcMYB22 gene to reduce the biosynthesis of flavonoids in plant fruits.

[0009] Based on the above technical solution, the present invention has the following technical effects:

[0010] The present invention found that AcMYB22-1 and AcMYB22-2 can bind to and activate the AcF3H and AcUFGT promoters. AcMYB22-2 cloned in "H16" showed higher transcriptional activation activity on the AcF3H and AcUFGT promoters, and both positively promoted the accumulation of flavonoids and anthocyanins. The research content enriched the mechanism of MYB transcription factors regulating the biosynthesis pathway of kiwifruit flavonoids, which is of great significance for the nutritional improvement, coloring mechanism research and new variety breeding of kiwifruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0012] Figure 1 The changes in the contents of total phenols, total flavonoids, total anthocyanins and phenolic substances during the fruit development of 'Hongyang' and 'H-16'. Among them, A is the content of total phenols, total flavonoids and total anthocyanins during fruit development. B is the phenolic substances during fruit development. C is the anthocyanin component during fruit development.

[0013] Figure 2 The expression level of AcMYB22 and its correlation analysis during the development of ‘Hongyang’ and ‘H-16’ fruits. A is the expression level of MYB22 at different growth stages of ‘Hongyang’ and ‘H-16’ fruits. B is the correlation between the relative expression of AcMYB22 and the contents of total phenols, total flavonoids, total anthocyanins and anthocyanin components. The left side of the correlation analysis is ‘Hongyang’ and the right side is ‘H-16’.

[0014] Figure 3 The figure shows the alignment of the amino acid sequences of AcMYB22-1 and AcMYB22-2.

[0015] Figure 4Phylogenetic analysis of AcMYB22 and sequence comparison and subcellular localization with other MYB proteins. A is the phylogenetic analysis of AcMYB22 protein and MYB proteins of other species. B is the sequence comparison analysis of AcMYB22 and other SG7 subfamilies. C is a schematic diagram of the subcellular localization vector. D is the subcellular localization result of AcMYB22. Fluorescence excitation signals were observed using a confocal microscope. All scale bars are 10 μm.

[0016] Figure 5 Transient transformation of AcMYB22-1 and AcMYB22-2 in 'Hongyang' fruit. A is the fruit phenotype. B is the relative expression of AcMYB22 in injected fruit detected by quantitative RT-PCR. C is the color value of injected fruit. Total phenols and total flavonoids.

[0017] Figure 6 The overexpression of AcMYB22 in kiwifruit results in the content of phenolic components and anthocyanin components. A is the content of phenolic substances. B is the expression level of genes related to the flavonoid metabolic pathway.

[0018] Figure 7 The stable overexpression of Actinidia chinensis ‘Hongyang’. A is the DNA level of AcMYB22 transgenic line. B is the qRT-PRC of AcMYB22 transgenic line. C is the phenotype of AcMYB22 overexpressing plants. D is the content of total phenols, total flavonoids, total flavanols and total anthocyanins in leaves of AcMYB22-1 and AcMYB22-2 transgenic lines. E is the relative expression of flavonoid biosynthesis structural genes in AcMYB22-1 and AcMYB22-2 transgenic lines. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0025] The plant material of the embodiment of the present invention is the 'Hongyang' kiwifruit and its bud mutation strain "H-6" (published in Journal of Fruit Science, Genetic Diversity Analysis of Kiwifruit Germplasm Based on SRAP and SCoT Markers and Identification of Mutant Materials, 2021, 38(12): 2059-2071). The kiwifruit of "H-6" has a red core and yellow flesh, and the red range is larger than that of "Hongyang", and the rest is more yellow than Hongyang. The experiment found that the kiwifruit flesh of "H-6" contains a higher content of flavonoids, including anthocyanins and flavonoids, indicating that the AcMYB22 gene can improve the biosynthesis of plant flavonoids.

[0026] The embodiment of the present invention provides the use of the AcMYB22 gene or its expression vector in regulating the biosynthesis of flavonoids in plant fruits, wherein the plants include kiwi fruit.

[0027] In some specific embodiments, the AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of the AcMYB22-1 is shown in SEQ ID NO.1; the nucleotide sequence of the AcMYB22-2 is shown in SEQ ID NO.2.

[0028] In some specific embodiments, the flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins, and isoflavones.

[0029] The embodiment of the present invention also provides a method for regulating the biosynthesis of flavonoids in plant fruits, overexpressing the AcMYB22 gene to promote the biosynthesis of flavonoids in plant fruits; silencing or knocking out the AcMYB22 gene to reduce the biosynthesis of flavonoids in plant fruits.

[0030] In some specific embodiments, the AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of the AcMYB22-1 is shown in SEQ ID NO.1; the nucleotide sequence of the AcMYB22-2 is shown in SEQ ID NO.2.

[0031] In some specific embodiments, the plant comprises kiwi fruit.

[0032] In some specific embodiments, the flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins, and isoflavones.

[0033] Example 1

[0034] Analysis of 1AcMYB22 molecular characteristics

[0035] 1.1 Materials

[0036] In this experiment, two varieties of kiwifruit materials were collected, namely 'Hongyang' (Actinidia chinensisvar.chinensiscv.'Hongyang') and its bud mutation material "H-16", which were collected in Mingshan District, Ya'an, Sichuan. The fruits were collected at 20d, 40d, 70d, 100d, and 120d after flowering and stored in an ultra-low temperature refrigerator at -80℃. The in vitro fruits of 'Hongyang' kiwifruit with uniform size, consistent growth, no pests and mechanical damage at the color change period (70d after flowering) were used as materials for instantaneous infection. The sterile tissue culture seedlings of 'Hongyang' stored in the laboratory were used for stable transformation, and the subcellular localization of Nicotiana benthamiana was used. The above materials were cultured in a culture room at 24℃, 16h light / 8h dark, and 80% humidity.

[0037] 1.2 Extraction of RNA from kiwifruit and cloning of AcMYB22

[0038] The pulp of 'Hongyang' and 'H-16' was ground into powder in liquid nitrogen, and the total RNA in kiwifruit tissue was extracted using an RNA extraction kit (tiangen). The RNA concentration and purity of the extracted RNA samples were tested by UV spectrophotometer, and the integrity of the extracted RNA was tested by 1.0% agarose gel electrophoresis. The RNA samples with absorbance test A260 / A280 ratio of 1.8-2.0 and A260 / A230 ratio greater than 2.0 were synthesized into cDNA using a reverse transcription kit.

[0039] Based on the sequencing information and expression level of kiwifruit transcriptome, the gene sequence of AcMYB22 was obtained, and primers were designed using Primer 5.0, with forward primer: 5'ACAATGGGGAGAGCACCTTG, and reverse primer: 3'ACACCAGTATTCCGGCTACTC. After cloning and sequencing, two AcMYB22 sequences were obtained, named AcMYB22-1 and AcMYB22-2.

[0040]

[0041]

[0042] 1.3 Subcellular localization

[0043] Specific primers were designed using Snapgene software, and homologous recombinase was used to connect the target fragment to the subcellular localization vector to obtain the subcellular localization vector containing AcMYB22. The freeze-thaw method was used to transform Agrobacterium competent cells, and the bacterial solution was verified and preserved by PCR. Use an inoculation loop to dip the bacterial solution and streak on YEP solid culture medium containing 50 mg / L Kan and 50 mg / L Rif. Place it in a 28°C constant temperature incubator and culture it for 2-3 days. Pick a single Agrobacterium and culture it in 10 mL of YEP liquid culture medium containing the same antibiotics. Shake and culture it at 200 rpm / min and 28°C for 12 hours. Take 1-2 mL of the bacterial solution and add it to 50 mL of YEP liquid culture medium containing the same antibiotics, and expand the culture under the above conditions. When the bacterial solution is cultured to OD 600 When the OD was ≈0.6, the mixture was centrifuged at 5000 rpm for 1 min at room temperature, and the precipitate was resuspended in infection solution (10 mmol / LMES + 10 mmol / LMgCl2 + 200 μmol / LAS) to an OD of 600 ≈0.6. After standing at room temperature for 30 min, the leaves of Nicotiana benthamiana that had grown normally for 30 days were infected with a syringe, and then cultured in the dark for 48 h. The subcellular localization results were observed using a confocal fluorescence microscopy system.

[0044] 1.4 qRT-PCR analysis of gene expression

[0045] Total RNA from fruit samples of 'Hongyang' kiwifruit and its bud mutation line 'H-6' was extracted using the CTAB method, and cDNA was prepared using the PrimeScriptTMRT kit with gDNA eraser (TaKaRa, Dalian, China). Quantitative PCR was performed on a CFX96 instrument (Bio-Rad, CA, USA) using TB Green Premix from TaqTMII (TaKaRa, Dalian, China). Each reaction included three technical and biological replicates. Actin (Acc08081.1) was used as an internal standard for calculating the reference gene for relative gene expression.

[0046] 1.5 Overexpression vector construction and Agrobacterium-mediated transient transformation of kiwifruit

[0047] AcMYB22 was fused with pBI121 vector to obtain Pbi121-AcMYB22, which was then transferred into GV3101 Agrobacterium. 400 μL of Agrobacterium with an OD value of 0.6 was injected into the fruit along the equator in four directions, and placed in an incubator (relative humidity 80%, light time 16h / d, 24°C) for 5-7 days before being photographed. The pulp of the injected area was cut into small pieces, quickly frozen with liquid nitrogen and stored at -80°C for later use.

[0048] 1.6 Agrobacterium-mediated stable transformation of kiwifruit

[0049] The strains of kiwifruit stably transformed were consistent with those in 1.5, both of which were Pbi121-AcMYB22. The leaves of Hongyang kiwifruit tissue culture seedlings that had been pre-cultured for 3 days were placed in the resuspended Agrobacterium solution for infection for 10 minutes, placed on the regeneration medium containing 100 μmol / L acetosyringone (AS), and cultured in the dark at 28°C for 2 days. The co-cultured leaf explants were rinsed with sterile water 5 times, the residual liquid was absorbed with sterile filter paper, and inoculated on the regeneration medium. After 2 weeks, the medium containing Kan was used for selection culture. After 2 months, DNA and RNA were extracted from the leaves of resistant buds to determine the transgenic plants.

[0050] 1.7 Determination of total phenols, total flavonoids and total flavanols

[0051] The total phenolic content (TPC) was determined using the Folin-Ciocalteu method, the total flavonoid content (TFC) was determined using the Jia method, and the total flavanol content (TFAC) was determined using the p-DMACA method.

[0052] The extract was made of 70 ml methanol, 2 ml formic acid, and 28 ml anhydrous ethanol. Take 0.2 g of leaves and add 2 ml of extract to grind at 0°C, transfer to a centrifuge tube, clean the mortar with the extract, transfer to a centrifuge tube and adjust the volume to 5 ml, shake at 30°C, 250 rpm for 2 hours, centrifuge at 10000g for 10 minutes, aspirate the supernatant, filter with a 0.45 μm filter membrane, and store at 4°C for later use.

[0053] The total phenol determination was carried out using gallic acid as the standard. 100 μl of the extract was added with 1.5 ml of distilled water and 100 μl of foline phenol. After shaking, the mixture was allowed to stand for 1 min. 1.5 mL of 20% saturated Na2CO3 solution was added and mixed. The mixture was reacted for 2 h in the dark. The blank extract was used as a control for zero calibration and the absorbance was measured at 765 nm.

[0054] The total flavonoids were determined using rutin as the standard. Take 200 μl of the extract, add 1.3 ml of methanol, 100 μl of NaNO2 (0.5 M) and 100 μl of AlCl3, mix well and let stand for 5 minutes, add 500 μl of NaOH (1 M), calibrate to zero with a blank extract, and measure the absorbance at 510 nm.

[0055] The total flavanols were determined using catechins as the standard. 100 μl of the extract was added with 0.1% p-DMACA, mixed and allowed to stand for 10 min, calibrated to zero with a blank extract, and the absorbance was measured at 640 nm.

[0056] 1.8 Determination of phenolic substances by HPLC

[0057] Weigh 2g of pulp, extract with 3mL 70% methanol aqueous solution (containing 2% formic acid), mix well, and ultrasonicate at 30℃ for 30min. Centrifuge the mixture at 10000g for 10min, take the supernatant and filter it with a 0.45μm filter membrane, and the filtrate is used for machine detection. The liquid phase conditions are as follows: the DAD detector used is a Comatex C18 column (250mm×4.6mm, 5μm); the mobile phase A is 2% acetic acid aqueous solution, the mobile phase B is 0.5% acetic acid-acetonitrile water (1:1, V / V), and the gradient elution program is shown in Table 2-8; column temperature: 30℃; injection volume: 20μL; flow rate: 1mL·min -1 ; Detection wavelength: 260nm, 280nm, 320nm, 330nm.

[0058] 1.9 Determination of anthocyanin content

[0059] Take 1g of kiwifruit endocarp and chop it, add 5mL of 0.1mol / L hydrochloric acid ethanol solution, and water bath it at 60℃ for 20min, and take the supernatant. Repeat the extraction 3 times and make the volume to 20mL. Then use 0.1mol / L hydrochloric acid ethanol solution as the reference solution, measure the absorbance OD value of the extract at wavelengths of 650nm, 620nm, and 530nm, and then calculate the total anthocyanin content through the formula.

[0060] Anthocyanin components were determined by HPLC. Take 0.5 g of fruit and add 1.5 mL of 1% HCl-methanol. Grind to a homogenate in liquid nitrogen in the dark, and extract for 12 h at 4 °C in the dark. Centrifuge the mixture at 10,000 g for 10 min at 4 °C, and filter the supernatant with a 0.45 μm filter membrane. The liquid phase conditions are shown in Table 2-9: Use a DAD detector and a Comatex C18 column (250 mm × 4.6 mm, 5 μm) for HPLC. Mobile phase A is water, B is acetonitrile, and C is formic acid. The gradient elution program is shown in Table 2-9. The flow rate is 1 mL·min -1 , injection volume 10 μL, column temperature 30 °C, detection wavelength 520 nm.

[0061] 2 Test results

[0062] 2.1 Changes in phenolic substances during fruit development

[0063] In order to study the phenolic substances in kiwifruit, H-16 and "Hongyang" fruits were collected at five stages after flowering, and their components were determined. The total flavonoids and total phenolic contents decreased with fruit development, and the content of "H-16" was significantly higher than that of "Hongyang". 70-120 days after flowering is the main period of anthocyanin accumulation. During these periods, the total anthocyanin content in "H-16" fruit was significantly higher than that in "Hongyang" ( Figure 1 (A).

[0064] During the fruit growth and development period, the protocatechuic acid content of 'Hongyang' and 'H-16' reached the maximum 40 days after flowering, and showed a trend of first increasing and then decreasing from 20 to 70 days after flowering; there was no significant change in its content from 70 to 120 days after flowering. The content of caffeic acid was relatively low throughout the fruit growth cycle, and the overall caffeic acid content showed a fluctuating trend. The caffeic acid content of 'H-16' was significantly higher than that of 'Hongyang' at 20 and 100 days after full flowering, while 'Hongyang' was significantly higher than that of 'H-16' at 40, 70, and 120 days after full flowering. The content of phenolic compounds vanillic acid and quercetin in 'Hongyang' and 'H-16' showed a downward trend overall, and reached the maximum 40 days after full flowering. From 40 to 140 days after full flowering, the vanillic acid content of 'Hongyang' was significantly higher than that of 'H-16' except that it was significantly higher than that of 'H-16' at 120 days after full flowering, and was significantly lower than that of 'H-16' in the rest of the period. The quercetin content of 'Hongyang' and 'H-16' reached the maximum 40 days and 20 days after full flowering, respectively, and decreased by 76% and 77% respectively at the fruit maturity stage compared with 20 days after full flowering, and the overall content showed a downward trend. Epicatechin is the phenolic substance with the highest content in 'Hongyang' and 'H-16', reaching the highest content 20 days after full flowering, and then showing a downward trend, and reaching the lowest content 100 days after full flowering. The epicatechin content of 'H-16' was significantly higher than that of 'Hongyang' at all stages. The content of chlorogenic acid was low in the early stage, and began to rise sharply 70 days after full flowering, and reached the maximum 100 days after full flowering ( Figure 1 (middle B).

[0065] Cyanidin 3-O-xylose-galactoside (Cy.xyl.gal.) and cyanidin 3-galactoside (Cy.gal.) are the two main components of anthocyanins in 'Hongyang' and 'H-16' kiwifruit. The change trend of the two is similar to that of total anthocyanins, which generally shows a trend of first decreasing and then increasing ( Figure 1 Middle C).

[0066] 2.2 Screening of MYB22 gene and analysis of its correlation with flavonoid metabolic structural genes

[0067] Based on the inventor's previous analysis of the transcriptome data of the fruit of 'Hongyang' and its bud mutation strain "H-16", the transcription factor AcMYB22 related to flavonoid synthesis was screened out. The expression of AcMYB22 was studied using 'Hongyang' and "H-16" kiwifruit during the fruit development period. The expression level of AcMYB22 at 0d after flowering was the highest among the five periods. As the fruit developed, the expression level of AcMYB22 gradually decreased. The relative expression level of AcMYB22 in "H-16" was 1.78 times that of AcMYB22 in 'Hongyang' ( Figure 2 ).

[0068] The relative expression of AcMYB22 was correlated with total phenols, total flavonoids, total anthocyanins, and anthocyanin components cyanidin 3-O-xylose-galactoside (Cy.xyl.gal.) and cyanidin 3-galactoside (Cy.gal.). The results showed that the expression of AcMYB22 in 'Hongyang' was significantly correlated with the accumulation of total phenols, but there was no strong correlation with other components. In "H-16", the expression of AcMYB22 was significantly correlated with total flavonoids, total phenols, and Cy.xyl.gal. The results showed that AcMYB22 may be positively correlated with flavonoid biosynthesis.

[0069] 2.3 Cloning, sequence analysis and subcellular localization of AcMYB22

[0070] The gene was cloned from 'Hongyang' and 'H-16' respectively. Two allele sequences were obtained by sequencing analysis and named AcMYB22-1 and AcMYB22-2 respectively. AcMYB22-1 was isolated from 'Hongyang' kiwifruit, and AcMYB22-1 and AcMYB22-2 were isolated from the bud mutation of 'H-16'. The open reading frames of the two alleles are 1032bp and encode 343 amino acids. There are 9 nucleotide differences between AcMYB22-1 and AcMYB22-2, resulting in 5 different amino acids ( Figure 3 ).

[0071] Phylogenetic analysis showed that AcMYB22 was clustered with apple MdMYB22, Arabidopsis AtMYB11, AtMYB12, and AtMYB111 ( Figure 4 A). Amino acid sequence alignment analysis showed that AcMYB22 contained R2 and R3 conserved domains and the characteristic domains of R2R3-MYB transcription factor subfamily 7 (SG7) SG7 ([K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K) motif and SG7-2 motif ([W / x][L / x]LS) ( Figure 4B), indicating that AcMYB22 belongs to subgroup 7. It is speculated that AcMYB22 may also be involved in flavonoid biosynthesis. Therefore, the tissue location of AcMYB22 was determined, and the subcellular results showed that AcMYB22 was localized in the cell nucleus ( Figure 4 (C, D).

[0072] 2.4 Transient overexpression of AcMYB22 improves flavonoid synthesis in kiwifruit

[0073] Transient overexpression in kiwifruit was used to investigate the effects of AcMYB22-1 and AcMYB22-2 on the flavonoid biosynthesis pathway in kiwifruit. Seven days after injection, the flesh of kiwifruit injected with 35S::AcMYB22 turned yellow ( Figure 5 The quantitative results showed that the expression level of AcMYB22 in the fruit injected with 35S::AcMYB22 was significantly higher than that in the control, which was 8.14 times and 19.61 times higher than that in the control group, respectively ( Figure 5 The color difference values ​​were measured and the results showed that the a* (red-green color) and b* (yellow-blue color) values ​​of kiwifruit treated with AcMYB22 overexpression were significantly higher than those of the control ( Figure 5 C). The total phenolic, flavonoid, flavanol and anthocyanin contents of the fruit were determined. The results showed that the total phenolic, flavonoid and flavanol contents of the overexpressed fruit were significantly higher than those of the fruit injected with no expression, indicating that AcMYB22 has the function of positively regulating the synthesis of flavonoids. It is worth mentioning that the total phenolic, flavonoid and anthocyanin contents of the fruit injected with 35S::MYB22-2 were significantly higher than those of the fruit injected with 35S::MYB22-1, while the total flavanol content of the fruit injected with 35S::MYB22-2 was significantly lower than that of the fruit injected with 35S::MYB22-1 ( Figure 5 (middle D).

[0074] 2.5Transient overexpression of AcMYB22 increases the content of phenolic components in kiwifruit

[0075] The phenolic substances in the transiently expressed kiwifruit pulp were determined by liquid phase. The results showed that the contents of vanillic acid, caffeic acid, epicatechin, chlorogenic acid, and p-hydroxybenzoic acid in the pulp injected with AcMYB22 were significantly higher than those in the pulp injected with no load. In addition, the quercetin content in the kiwifruit pulp injected with AcMYB22-1 was higher than that in the control, while the quercetin content in the pulp injected with AcMYB22-2 did not change significantly. The content of protocatechuic acid was significantly upregulated in the fruits infected with AcMYB22-2, but there was no difference in the fruits injected with AcMYB22-1. Liquid chromatography was used to determine the main components of anthocyanins in the treated fruits. The results showed that the contents of cyanidin 3-galactoside and cyanidin 3-O-xylose-galactoside were significantly increased in the treated fruits, and the anthocyanin components in the fruits injected with 35S::AcMYB22-2 were significantly higher than those in the fruits injected with 35S::AcMYB22-1 ( Figure 6 (A).

[0076] The structural genes for flavonoid synthesis were quantitatively detected in the pulp of fruits injected with 35S::AcMYB22-1 and 35S::AcMYB22-2 Agrobacterium liquid. The results showed that the expression levels of flavonoid synthesis structural genes in the treated fruits were significantly higher than those in the fruits injected with no vector. Except for F3'H, the expression levels of flavonoid synthesis structural genes in the pulp of fruits injected with 35S::AcMYB22-2 were significantly higher than those in the pulp of fruits injected with 35S::AcMYB22-1 ( Figure 6 (middle B).

[0077] 2.6 Stable overexpression of AcMYB22 improves the accumulation of flavonoids in kiwifruit leaves

[0078] AcMYB22 was stably overexpressed in Hongyang kiwifruit, and the obtained overexpression lines were named OEMYB22-1.1, OEMYB22-2.1, OEMYB22-2, OEMYB22-3 ( Figure 7 The leaf phenotypes of the stable overexpressing plants were different from those of the control plants. The leaves of the overexpressing plants showed red color at the leaf edges and between the leaves compared with the control plants, and the overall color of the leaves was yellow compared with the control plants ( Figure 7 Middle C).

[0079] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Use of the AcMYB22 gene or its expression vector in regulating the biosynthesis of flavonoids in plant fruits, characterized in that: The plants include kiwi fruit.

2. The use according to claim 1, characterized in that: The AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of the AcMYB22-1 is shown in SEQ ID NO.1; the nucleotide sequence of the AcMYB22-2 is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins and isoflavones.

4. A method for regulating flavonoid biosynthesis in plant fruits, characterized in that: Overexpression of the AcMYB22 gene promotes the biosynthesis of flavonoids in plant fruits; silencing or knocking out the AcMYB22 gene reduces the biosynthesis of flavonoids in plant fruits.

5. The method according to claim 4, characterized in that The AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of the AcMYB22-1 is shown in SEQ ID NO.1; the nucleotide sequence of the AcMYB22-2 is shown in SEQ ID NO.

2.

6. The method according to claim 4, characterized in that The plants include kiwi fruit.

7. The method according to claim 4, characterized in that The flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins and isoflavones.

Images