Cotton GhCAR4 gene and application thereof in drought resistance

Abstract

The invention discloses a cotton GhCAR4 gene and application thereof in drought resistance, and belongs to the field of gene engineering. The coding amino acid sequence of the GhCAR4 gene is as shown in SEQ ID NO. 1, and the nucleotide sequence of the GhCAR4 gene is as shown in SEQ ID NO. 2. The invention finds that the GhCAR4 responds to drought induction, compared with a wild plant, overexpression of the GhCAR4 can enhance the growth vigor, drought tolerance and antioxidant enzyme activity of arabidopsis thaliana seedlings, and virus-mediated GhCAR4 silencing reduces the drought tolerance and T-AOC activity of cotton, which indicates that the GhCAR4 positively participates in drought response and is an excellent candidate gene for drought resistance genetic improvement of cotton.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to a cotton GhCAR4 gene and an application thereof in drought resistance. Background Art

[0002] Cotton (Gossypium hirsutum L.) is a global fiber and oil crop. With global warming and the shortage of fresh water resources, cotton is increasingly suffering from drought stress, which has become an important factor limiting the improvement of cotton yield and quality. C2 domain ABA-associated (CAR) proteins are a family of small proteins with specific lipid-binding C2 domains in plants. The expression patterns of most genes in this family are induced by abiotic stress and hormones, and they play a vital role in regulating the signal transduction of abiotic stress.

[0003] Therefore, exploring the function of drought stress-related CAR genes in cotton is of great significance for revealing the molecular mechanism of cotton drought resistance, improving cotton drought resistance, and studying drought-resistant transgenic plants. Summary of the invention

[0004] The purpose of the present invention is to provide a cotton GhCAR4 gene and its application in drought resistance. The gene is positively involved in responding to drought stress and can improve the drought resistance of plants.

[0005] To achieve the above object, the present invention adopts the following technical scheme: the cotton GhCAR4 gene, the amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0006] A gene expression frame, an expression vector and a recombinant bacterium containing the GhCAR4 gene.

[0007] The GhCAR4 gene of the present invention can be directly synthesized, or produced by an organism after obtaining the encoding gene using molecular biological technology methods.

[0008] The present invention also provides the application of the cotton GhCAR4 gene in plant drought resistance; the plants at least include: cotton and Arabidopsis thaliana.

[0009] Furthermore, by up-regulating the expression level of the GhCAR4 gene in the plant, the drought resistance of the plant is improved.

[0010] The present invention also provides a gene expression frame, an expression vector and a recombinant bacterium containing the GhCAR4 gene for use in plant drought resistance.

[0011] The present invention also provides the use of the cotton GhCAR4 gene in plant drought resistance breeding, wherein the plants at least include: cotton and Arabidopsis thaliana.

[0012] Compared with the existing technology, the present invention has the following beneficial effects: the present invention experiments found that compared with wild-type plants, overexpression of GhCAR4 can enhance the growth potential, drought resistance and antioxidant enzyme activity of Arabidopsis seedlings, while virus-mediated silencing of GhCAR4 reduces drought resistance and T-AOC activity of cotton, indicating that GhCAR4 is positively involved in drought response. The present invention can provide excellent candidate genes for genetic improvement of drought resistance of cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The expression pattern of GhCAR4 under PEG treatment; 4-week-old cotton seedlings were treated with 20% PEG6000; cotton housekeeping gene GhUBQ7 was used as an internal reference, and samples from different treatments were collected at designated time points for RT-qPCR analysis; the calculated values ​​are the mean ± standard deviation of biological replicates (n = 3);

[0014] Figure 2 The growth status of transgenic Arabidopsis and WT Arabidopsis under mannitol treatment; A. RT-qPCR with Arabidopsis Actin as internal reference to detect the gene expression level of transgenic Arabidopsis GhCAR4; B. Root length phenotype of transgenic Arabidopsis and WT Arabidopsis under mannitol treatment; C. Root length analysis of transgenic Arabidopsis and WT Arabidopsis under mannitol treatment; Error bars represent the standard deviation of three independent replicates; Asterisks represent Student's t-test in significant statistical analysis: *P<0.05; **P<0.01;

[0015] Figure 3 The phenotypes of transgenic Arabidopsis and WT Arabidopsis before and after 15 days of natural drought treatment;

[0016] Figure 4 Antioxidant enzyme activities of transgenic Arabidopsis and WT Arabidopsis before and after 15 days of natural drought treatment; A. SOD activity; B. POD activity; C. CAT activity; error bars represent the standard deviation of three independent replicates; asterisks represent Student's t-test in significant statistical analysis: *P<0.05; **P<0.01;

[0017] Figure 5Figure 1 shows the experimental results of studying the effect of silencing GhCAR4 in cotton on tolerance to drought stress; A. Cotton was injected with Agrobacterium containing TRV2-GhCLA1 and TRV2-00 plasmids, and different phenotypes were observed after 2 weeks; B. Quantitative RT-qPCR analysis of GhCAR4 expression in VIGS plants TRV2-1 and TRV2-2; C. Phenotypic comparison of negative control plants (TRV2-00) and VIGS plants (TRV2-1 and TRV2-2) under drought stress; D. Water loss in detached leaves of drought-treated TRV2-00 plants and VIGS plants; ET-AOC content; F. H2O2 activity; Error bars represent the standard deviation of data from three independent biological replicates; Asterisks indicate Student's t-test in statistical analysis of significant differences between TRV2-00 plants and VIGS plants: *P<0.05 significant difference; **P<0.01 extremely significant difference. DETAILED DESCRIPTION

[0018] Example 1: GhCAR4 sequence analysis and GhCAR4 expression pattern analysis

[0019] Using ProtParam and ProtScale, GhCAR4 was found to encode 176 amino acids, with a molecular weight of 19.77 kDa and an isoelectric point of 4.67, and is a hydrophilic protein. Using ProSITE, it was predicted that GhCAR4 contained a typical C2 structure at amino acids 1-106. In the GhCAR4 promoter region, the present invention identified many cis-elements related to biotic and abiotic stress responses, including MYB and MYC elements induced by drought response, and elements related to hormone response.

[0020] To analyze the possible role of GhCAR4 in cotton drought resistance, RT-qPCR technology was used to analyze the gene expression level of GhCAR4 in upland cotton under natural drought treatment simulated by PEG6000.

[0021] (1) Cotton seedlings were irrigated with 20% PEG6000 solution, and samples were collected at 0, 1, 3, 6, 12 and 24 h, immediately frozen in liquid nitrogen for 10 min, and then stored at -80°C.

[0022] (2) Total leaf RNA was extracted using a plant RNA extraction kit (Vazyme, Nanjing, China). Reverse transcription was performed using PrimeScript RT Kit (TransGen, Beijing, China). Gene-specific primers were designed using primer5.0, as shown in SEQ ID NO. 3-4 (5′-3′).

[0023] GhCAR4-qF (SEQ ID NO.3): ATCCTGGGGAGCCAATCAAG;

[0024] GhCAR4-qR (SEQ ID NO. 4): TGCCTGTACGAATGCCACTAT.

[0025] RT-qPCR was performed on a LightCycler 480II instrument (Roche Biochemicals, Indianapolis, IN, USA).

[0026] The PCR reaction system was: 5 μl SYBR Green I Master Mix reagent, 0.4 μl 10 mM gene-specific primer, 2 μl 10-fold diluted cDNA sample and 3.6 μl RNase-free water, with a final volume of 10 μl (three technical replicates).

[0027] The PCR reaction program was: 94°C for 30 sec, 94°C for 5 sec, 60°C for 15 sec, 72°C for 10 sec, for 40 cycles.

[0028] The qRT-PCR reactions were performed using three independent biological replicates. The cotton housekeeping gene GhUBQ7 was used as an internal reference for normalization. -ΔΔCT The relative expression level of GhCAR4 was calculated according to the method of (Livak and Schmittgen 2001).

[0029] The results are as follows Figure 1 As shown in the figure, under 20% PEG6000 stress, the expression level of GhCAR4 first increased and then decreased, and reached the highest level within 6 hours of drought treatment, then dropped sharply and gradually returned to normal levels. When GhCAR4 was expressed at the highest level, the difference was statistically significant compared with the control group, and GhCAR4 expression was upregulated by about 2.81 times. This indicates that the expression of GhCAR4 in cotton leaves is induced by drought stress, and GhCAR4 may be involved in the response of cotton to drought stress.

[0030] Example 2: Construction of overexpression vector and genetic transformation of Arabidopsis thaliana

[0031] Experimental materials: Arabidopsis thaliana (Col-0) seeds were sterilized and sown on 1 / 2MS solid culture medium for germination and transplanted one week later.

[0032] The CDS sequence of GhCAR4 was amplified using primers with GhCAR4-KpnI and GhCAR4-BamHI restriction sites, and connected to the plant expression vector pCAMBIA2300 with CaMV 35S promoter according to the corresponding restriction sites. The primer sequences are shown in SEQ ID NO.5-6 (5′-3′).

[0033] GhCAR4-F (SEQ ID NO.5): GGGGTACCATGACAAGCATGGACGAGTTGA;

[0034] GhCAR4-R (SEQ ID NO. 6): CGGGATCCTTATGCAGTTGGTGTTGGTGTTG.

[0035] The constructed vector was transformed into Agrobacterium tumefaciens GV3101 recipient cells by freeze-thaw method.

[0036] After that, Arabidopsis was transformed by the drop flower method (Zhang et al. 2006), and the harvested seeds were screened by kanamycin to obtain overexpression transgenic lines until they were cultured to the T3 generation homozygous. According to kanamycin resistance screening and PCR technology to identify transgenic positive lines, T3 generation transgenic lines (OE1, OE2 and OE3) were selected, and the screened Arabidopsis positive seedlings were transferred to pots with a nutrient soil and vermiculite ratio of 3:1. After 2 weeks, Arabidopsis total RNA was extracted and reverse transcribed into cDNA. Arabidopsis Actin was used as an internal reference gene, and the gene expression level of the overexpression plant was detected by RT-qPCR technology. The primers are shown in SEQ ID NO.7-8 (5′-3′), and 3 biological replicates were set, using 2 -ΔΔCT The relative expression data were obtained by the method, and the Arabidopsis WT plants were used as the experimental control for calculation. Figure 2 In (A), the expression levels of GhCAR4 gene were significantly increased in the three strains.

[0037] GhActin-qF (SEQ ID NO.7): GCTCCTCTTAACCCAAAGGC;

[0038] GhActin-qR (SEQ ID NO. 8): CACACATACACCAGAATCCAGC.

[0039] Example 3: Mannitol treatment of GhCAR4 transgenic Arabidopsis

[0040] Wild WT and transgenic Arabidopsis were sown on MS medium containing 0, 75mM, and 150mM mannitol, respectively, and the root growth status of WT and GhCAR4 overexpressing Arabidopsis was observed and recorded. The results showed that after one week of growth in 75mM and 150mM mannitol 1 / 2MS medium, the growth of transgenic Arabidopsis was better than that of WT Arabidopsis. In addition, Figure 2 As shown in (B) to (C) in the figure, the roots of the transgenic plants were significantly longer than those of the WT, 1.43 times that of the WT under the 75 mM mannitol treatment and 1.74 times that of the WT under the 150 mM mannitol treatment.

[0041] Example 4: Drought treatment and antioxidant enzyme activity assay of GhCAR4 transgenic Arabidopsis

[0042] (1) Using WT Arabidopsis as the control, the transgenic GhCAR4 Arabidopsis plants with the same growth potential were subjected to natural drought treatment for 15 days, and then the phenotypes were observed and samples were taken. Figure 3 As shown in the figure, under the condition of natural drought for 15 days, the leaves of WT plants withered and turned yellow severely, while only the old leaves of transgenic Arabidopsis plants showed slight wilting and yellowing.

[0043] (2) Determination of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) activities

[0044] The activities of SOD, POD, and CAT in Arabidopsis plants before and after drought treatment were measured. Figure 4 As shown in (A) to (C), there was no significant difference under normal growth conditions, but after 15 days of natural drought, the SOD, POD and CAT activities of Arabidopsis transgenic plants were significantly higher than those of WT plants, which were 1.23, 1.23 and 1.3 times that of WT plants, respectively.

[0045] Example 5: Cotton GhCAR4 Silencing

[0046] Experimental materials: Select standard TM-1 seeds of upland cotton with full and undamaged grains, culture them in a temperature environment of 28°C until the seeds germinate, and then transfer them to pots containing 70% moisture nutrient soil: vermiculite = 3:1, and keep the planting depth at 1.5 cm. Then, place them in a constant temperature box at 22 / 25°C (night / day) with 8 hours of light at night and 16 hours of light every day. After 13 days, select cotton seedlings with better growth and consistent growth.

[0047] (1) The GhCAR4 coding sequence was analyzed on the SGN-VIGS website (https: / / vigs.solgenomics.net). The 300 bp optimal interference sequence was selected and cloned into the pTRV2 vector to obtain the recombinant plasmid pTRV2-GhCAR4.

[0048] The primers used to construct the VIGS vector are shown in SEQ ID NO.9-10 (5′-3′):

[0049] GhCAR4-F (SEQ ID NO.9): CGGGATCCGGACGAGTTGATGGGTCTGT;

[0050] GhCAR4-R (SEQ ID NO. 10): GGGGTACCCTCTGCATCTCCCATTTCGT.

[0051] (2) Grow Agrobacterium containing pTRV1, pTRV2-00, pTRV2-GhCLA1 and pTRV2-GhCAR4 overnight until OD 600 The pH was 1.5-2.0 and resuspended with an equal volume of resuspension solution (10 mM MgCl2, 10 mM MES and 0.2 mM AS).

[0052] (3) The pTRV1 resuspension was mixed with the pTRV2-00, pTRV2-GhCLA1 and pTRV2-GhCAR4 resuspensions in a ratio of 1:1 and injected evenly into two fully expanded cotyledons of cotton plants.

[0053] (4) After culturing the plants in the dark for 24 h, return to normal light conditions (25°C, 16 h light / 8 h dark) for cultivation.

[0054] (5) When the plants injected with pTRV2-GhCLA1 showed an albino phenotype, the third true leaf of the cotton plants injected with pTRV2-00 and pTRV2-GhCAR4 was selected, and total RNA was extracted and reverse transcribed into cDNA. The expression level of the GhCAR4 gene in the samples was detected by RT-qPCR using the housekeeping gene UBQ7 of upland cotton as the internal reference gene. The primers were shown in SEQ ID NO.11-12 (5′-3′). The experiment was repeated 3 times, using 2 -ΔΔCT The relative expression data were calculated using the cotton TRV2-00 plant as the experimental control.

[0055] GhUBQ7-qF (SEQ ID NO. 11): AGAGGTCGAGTCTTGGGACA;

[0056] GhUBQ7-qR (SEQ ID NO. 12): GCTTGATTCTTCTTGGGCTTG.

[0057] like Figure 5As shown in (A), compared with normal plants, the leaves of the positive control plants (TRV2-GhCLA1) showed the expected photobleaching symptoms, indicating that the virus had a toxic effect on the plants. RT-qPCR analysis showed that there was no statistically significant difference in the expression of GhCAR4 between the negative control plants (TRV2-00) and WT plants. Figure 5 As shown in (B), the relative expression level of the GhCAR4 gene in VIGS plants (TRV2-1, TRV2-2) was significantly lower than that in WT plants, only 25% of that in WT plants.

[0058] Example 6: Drought treatment of cotton GhCAR4 silenced plants

[0059] Using cotton plants injected with pTRV2-00 as controls, 4-week-old cotton plants with significantly reduced GhCAR4 expression levels as shown by RT-qPCR were subjected to water shortage treatment for 15 days, and phenotypic changes were observed and samples were taken. Figure 5 As shown in (C), there was no significant change in VIGS plants and TRV2-00 plants after 7 days of water shortage treatment; after 15 days of water shortage treatment, the leaves of VIGS plants showed severe drooping and wilting characteristics, while TRV2-00 plants showed slight wilting.

[0060] Example 7: Determination of physiological indicators after drought treatment

[0061] (1) Determination of water loss rate

[0062] The water loss percentage of detached leaves of cotton control plants and VIGS plants was recorded at 8 different time points. Figure 5 (D) shows that the water loss rate of detached leaves of VIGS plants after drought treatment was significantly higher than that of control plants. Compared with control plants, GhCAR4-silenced plants showed more obvious leaf wilting phenotype after drought treatment.

[0063] (2) ROS level: hydrogen peroxide (H2O2) content and total antioxidant capacity (T-AOC) determination

[0064] The hydrogen peroxide content assay kit and total antioxidant capacity assay kit (Solebro, China) were used to detect the H2O2 content and T-AOC activity in cotton leaves.

[0065] like Figure 5 In (E) to (F), the H2O2 content of VIGS plants increased significantly under drought stress, which was 1.3 times that of TRV2-00 plants, while the T-AOC activity decreased significantly, which was only 0.67 times that of TRV2-00 plants. This indicates that the ROS scavenging ability of GhCAR4-silenced cotton plants is severely weakened.

[0066] In summary, the present invention detected the expression level of GhCAR4 under natural drought stress simulated by PEG, and found that GhCAR4 responded to drought induction. Using mannitol treatment, it was found that the transgenic Arabidopsis thaliana with heterologous overexpression of GhCAR4 grew better than WT Arabidopsis; natural drought stress was carried out for 15 days, and it was found that the transgenic Arabidopsis thaliana with heterologous overexpression of GhCAR4 had a better phenotypic state and higher SOD, CAT and POD activities than WT Arabidopsis, which showed that the overexpression of GhCAR4 enhanced the tolerance of Arabidopsis plants to drought.

[0067] VIGS technology was further used to obtain GhCAR4-silenced plants of upland cotton. The study found that compared with the control plants, the GhCAR4-silenced plants of upland cotton showed more obvious leaf wilting phenotype, higher water loss rate, high H2O2 content and significantly reduced T-AOC after 15 days of drought treatment, indicating that silencing of GhCAR4 reduced the drought resistance of cotton plants.

[0068] All of the above verify that GhCAR4 plays a positive role in plant drought resistance and can provide an excellent candidate gene for the genetic improvement of cotton drought resistance.

Claims

1. An application of cotton GhCAR4 gene in plant drought resistance, characterized in that: The amino acid sequence of the GhCAR4 gene is shown in SEQ ID NO.1; The plants at least include: cotton and Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the GhCAR4 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: By up-regulating the expression level of the GhCAR4 gene in the plant, the drought resistance of the plant is improved.

4. Use of a gene expression cassette, an expression vector and a recombinant bacterium containing the GhCAR4 gene according to claim 1 in plant drought resistance.

Images