RNAi recombinant vector resistant to both bemisia tabaci and tomato yellow leaf curl virus as well as construction method and application of RNAi recombinant vector

Abstract

The invention discloses an RNAi recombinant vector resistant to both bemisia tabaci and tomato yellow leaf curl virus as well as a construction method and application of the RNAi recombinant vector resistant to both bemisia tabaci and tomato yellow leaf curl virus, a DNA beta promoter accompanied by geminivirus expressed in phloem is constructed to an RNAi vector pCambia 1391 vector, and a 1391:: DNA beta pro vector skeleton is obtained; an RT-PCR (reverse transcription-polymerase chain reaction) method is used for amplifying part of fragments of key genes BtACTB of bemisia tabaci, key segments (including a gene spacer region with virus replication initiation, part of coat protein and replication-related protein) of TYLCV and inverted repeat sequences of the key segments to construct a gene which is driven by a phloem promoter and is capable of expressing the bemisia tabaci gene BtACTB. The recombinant vector is of a reverse hairpin structure and simultaneously targets key sequences of bemisia tabaci and tomato yellow leaf curl virus. The constructed recombinant vector is introduced into tomatoes through an agrobacterium transformation method, and tomato plants capable of reducing the survival rate of bemisia tabaci and inhibiting TYLCV infection are obtained through screening.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an RNAi recombinant vector simultaneously targeting whitefly and tomato yellow leaf curl virus transmitted by the whitefly, a construction method and application in insect and disease resistance of tomatoes. Background Art

[0002] Bemisia whitefly is a piercing-sucking insect, known as a "super pest". It is widely distributed, reproduces quickly, and has a wide host range. It is one of the most important pests in the world's subtropical and tropical agricultural and greenhouse production systems. Bemisia whitefly can not only directly feed on plant phloem sap to cause harm, but also widely spread plant viruses, causing double harm to plant production. Recent studies have found that tomato yellow leaf curl virus (TYLCV) spread by Bemisia whitefly is the most widely distributed and most harmful plant virus in my country and even in the world. TYLCV belongs to the genus Begomovirus of the family Geminiviridae. After infecting tomatoes, it causes symptoms such as yellowing and curling of new leaves, slow growth, and obvious shrinkage of leaves. It causes significant losses to the production of many crops around the world, especially tomatoes. When the damage is serious, the yield loss can reach 100%. TYLCV is spread by Bemisia whitefly in a persistent cycle, and its prevalence is closely related to the population of Bemisia whitefly. Therefore, effective prevention and control of Bemisia whitefly is the most important means to control geminiviruses. At present, the prevention and control of whiteflies mainly relies on chemical control, but the irregular use of insecticides has led to the resistance of whiteflies to insecticides, which has brought great difficulties to the prevention and control of whiteflies. Therefore, developing a strategy to effectively control whiteflies and block the spread of TYLCV is a major demand in agricultural production.

[0003] RNA silencing is a highly conserved gene expression regulation mechanism based on sequence specificity in eukaryotes and is a key way for plants to cope with various viral infections. Based on the high conservation and sequence specificity of RNA silencing, RNA silencing is widely used in the field of genetic engineering to regulate the expression of target sequences. The present invention targets the key genes and sequences of whiteflies and TYLCV, and constructs a phloem promoter-driven recombinant vector that simultaneously targets whiteflies and TYLCV, based on the characteristics of whiteflies and TYLCV being confined to the phloem of plants. Transgenic tomatoes with dual resistance to whiteflies and TYLCV are obtained, providing an important strategy for effectively controlling whiteflies and viral diseases transmitted by them. Summary of the invention

[0004] The purpose of the present invention is to provide an RNAi recombinant vector and construction method and application that is resistant to both whitefly and tomato yellow leaf curl virus. The present invention constructs a phloem-specifically expressed Geminivirus DNA β promoter on an RNAi vector pCambia1391 vector to drive the expression of a hairpin structure that simultaneously targets a key gene of whitefly and a key region of TYLCV, transforms the recombinant vector into tomatoes, and obtains transgenic tomatoes that are resistant to both whitefly and TYLCV through screening.

[0005] Specifically, the technical solution adopted by the present invention is as follows:

[0006] A method for constructing an RNAi recombinant vector that is resistant to both whitefly and tomato yellow leaf curl virus, driven by a DNA β promoter from a geminivirus specifically expressed in phloem, and inserting a key gene for growth and development of whitefly at the multiple cloning site

[0007] The key sequences of BtACTB and TYLCV are prepared; wherein the sequence of the DNAβ promoter is shown in SEQ ID NO: 1, and the key sequences of BtACTB and TYLCV of Bemisia tabaci are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0008] The specific steps include:

[0009] (1) The RNAi vector pCambia1391 was double-digested with HindⅢ and EcoRⅠ, and the DNA fragment was purified and recovered;

[0010] (2) using primer pair DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, and using TYLCCNV beta satellite infectious clone as a template, amplifying the DNAβ promoter, and purifying and recovering the DNA fragment;

[0011] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0012] DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA

[0013] (3) Connecting the DNAβ fragment to the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro;

[0014] (4) Digesting the target vector 1391::DNAβpro with SmaI and purifying and recovering the DNA fragment;

[0015] (5) using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NOs: 6-7, to amplify the BtACTB gene of Bemisia tabaci, using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NOs: 8-9, to amplify the key sequence of TYLCV, and purify and recover the DNA fragments;

[0016] BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT

[0017] BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC

[0018] TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT

[0019] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0020] (6) The key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction;

[0021] (7) Digest the target vector 1391::DNAβpro-BtACT-TYLCV with MluI and SalI, and purify and recover the DNA fragment;

[0022] (8) using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NOs: 10-11, amplifying the key sequences of the reverse fusion of BtACT and TYLCV, and purifying and recovering the DNA fragments;

[0023] BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT

[0024] BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0025] (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with the reverse insertion of the target fragment.

[0026] The RNAi recombinant vector constructed by the invention can be used for transgenic tomato cultivation and resistance analysis, reducing the survival rate of whiteflies and inhibiting the pathogenicity of tomato yellow leaf curl virus.

[0027] The present invention also provides a method for cultivating transgenic tomatoes that inhibit whitefly and tomato yellow leaf curl virus transmitted by whitefly. The recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV is introduced into tomatoes through Agrobacterium transformation, and transgenic tomatoes that inhibit whitefly and tomato yellow leaf curl virus at the same time are obtained through screening.

[0028] The specific steps include:

[0029] (1) 1 μg of the recombinant plasmid was mixed with 100 μL of Agrobacterium competent medium, and the Agrobacterium was transformed by freeze-thaw method. After 2 hours of recovery culture, the plasmid was spread on the corresponding resistance medium. After 48 hours of culture at 28°C, the Agrobacterium carrying the 1391::DNAβpro-hpBtACTB-TYLCV recombinant plasmid was screened.

[0030] (2) Infecting tomato leaves with Agrobacterium carrying the recombinant plasmid, obtaining callus tissue through differentiation culture, and then obtaining T0 generation seedlings through rooting culture, which are then transferred for further culture;

[0031] (3) After the seedlings continue to grow stably, the DNA in the plant leaves is extracted using the CTAB method; the primer pair DNAβ-F and TYLCV-R, as shown in SEQ ID NO:4 and SEQ ID NO:9, is used to perform PCR amplification with the extracted DNA as a template to confirm that the recombinant plasmid has been transferred into the plant; and the offspring seeds of the above positive transgenic plants are collected.

[0032] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0033] TYLCV-R: AATAATTATTTCCTTAACCCCGGGGCCCTTACAACAGATATAAGA

[0034] Compared with the prior art, the outstanding effects of the present invention are:

[0035] (1) The present invention constructs a DNAβ promoter associated with a geminivirus expressed in the phloem into an RNAi vector pCambia1391 vector to obtain a 1391::DNAβpro vector skeleton, and uses the RT-PCR method to amplify a partial fragment of the key gene BtACTB of the whitefly, a key segment of TYLCV (including the gene spacer region for the initiation of viral replication, part of the coat protein and replication-related protein) and its reverse repeat sequence, and constructs a recombinant vector with a reverse hairpin structure that is driven by a phloem promoter and simultaneously targets the key sequences of whiteflies and tomato yellow leaf curl virus. The constructed recombinant vector is introduced into tomatoes by the Agrobacterium transformation method, and tomato plants that reduce the survival rate of whiteflies and inhibit TYLCV infection are obtained by screening. The present invention provides a highly efficient insect-resistant and disease-resistant material, which provides an important technical means for preventing and controlling whiteflies and the viruses they spread.

[0036] (2) The plasmid provided by the present invention can successfully transform the natural host of whitefly and TYLCV, namely tomato, to produce transgenic plants with excellent traits that can be inherited.

[0037] (3) The expression vector provided by the present invention has multiple restriction sites, a wide range of applications, and simple operation.

[0038] The RNAi recombinant vector resistant to Bemisia tabaci and tomato yellow leaf curl virus, its construction method and application of the present invention are further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the recombinant expression vector driven by the DNAβ promoter.

[0040] Figure 2 Analysis of the resistance of transgenic tomatoes transformed with recombinant vectors to whiteflies. (A) Whitefly feeding picture, scale is 2 cm. (B) Whitefly mortality statistics, wild-type tomatoes are negative controls. The results show that the mortality of whiteflies feeding on transgenic tomatoes transformed with recombinant vectors is significantly higher than that of the control group.

[0041] Figure 3 Resistance analysis of transgenic tomatoes transformed with recombinant vectors to TYLCV. (A) Phenotype of infected whiteflies 28 days after feeding and inoculation, scale bar is 4 cm; (B) Disease index statistics; (C) qPCR detection of TYLCV accumulation level; (D) Western blot detection of TYLCV CP protein accumulation. The results showed that transgenic tomatoes transformed with recombinant vectors can significantly inhibit TYLCV infection. DETAILED DESCRIPTION

[0042] Example 1 Construction of dual resistance recombinant vector

[0043] Through gene recombination, partial segments of the actin gene required for the growth and development of whitefly and the key regions of tomato yellow leaf curl virus were simultaneously constructed into the efficient RNAi expression vector pCambia1391, which can simultaneously target whitefly and TYLCV transmitted by it.

[0044] (1) Extraction of total RNA from Bemisia tabaci

[0045] Use the micro total RNA extraction kit (Cat. No. TR150-50) from Tianmo Company. Put about 30 to 50 whiteflies into the grinding sample tube, add 600 μL RNA lysis solution, 60 Hz, 45-60s, repeat once. After sufficient lysis, centrifuge at 4℃ 12000g for 1min, transfer the supernatant to another clean 1.5mL centrifuge tube, add an equal volume (95-100%) of anhydrous ethanol, mix well, add the mixture dropwise to the No. 1 C purification column on the collection tube, centrifuge for 1min, and remove the filtrate. Add 400 μL RNA pre-wash solution to the No. 1 C purification column and centrifuge for 1min. Remove the filtrate. Repeat once, then add 400 μL RNA washing solution to the No. 1 C purification column and centrifuge for 2min. Remove the filtrate. Finally, centrifuge empty for 2min to remove the residue, elute with 15 μL DNase / RNase-free water, and store in a -80℃ refrigerator.

[0046] 2. Amplify the target fragment and connect the vector

[0047] Using the infectious clone of DNAβ accompanied by TYLCCNV as a template, the DNAβ promoter sequence was amplified with primer pair DNAβ-F and DNAβ-R; the whitefly RNA was reverse transcribed into cDNA, and the conserved segment of the whitefly actin gene was amplified with primer pair BtACT-F and BtACT-R; the TYLCV conserved interval was amplified with primer pair TYLCV-F and TYLCV-R using the DNA of diseased leaves infected with TYLCV as a template.

[0048] Among them, RNA was reverse transcribed into cDNA using TaKaRa reverse transcription kit PrimeScript TM RT reagent Kitwith gDNA Eraser (Cat. No. RR047A).

[0049] The PCR amplification system was: 32 μL ddH2O, 10 μL 5×TransStart FastPfu Buffer, 4 μL 2.5 mM dNTPs, 1 μL each of upstream and downstream primers (10 μM), 1 μL cDNA template, 1 μL TransStart FastPfu DNA Polymerase, and the total reaction system was 50 μL; the reaction conditions for each fragment were: 95°C for 1 min; 95°C for 20 s, 55°C for 20 s, 72°C for 1.5 min, 40 cycles; 72°C for 5 min.

[0050] The single enzyme digestion and double enzyme digestion systems of the vector both use a 40μL system, where the single enzyme digestion is 10×FastDigestGreen Buffer 4μL, FastDigest SmaI 2μL, and vector plasmid 34μL; the double enzyme digestion is 10×FastDigestGreen Buffer 4μL, FastDigest MluI and XbaI 2μL each, and vector plasmid 32μL.

[0051] The homologous recombination reaction used a 20 μL reaction system, including 4 μL of 5×CEⅡBuffer, about 150 ng of SmaI single-enzyme digested vector or MluI and XbaI double-enzyme digested linearized cloning vector, about 80 ng of fusion fragment, 2 μL of ExnaseⅡ, and ddH2O to adjust the system to 20 μL.

[0052] After the amplified PCR product is purified, it is constructed into the vector after corresponding enzyme digestion through homologous recombination to obtain the target vector ( Figure 1 ).

[0053] The specific steps are:

[0054] (1) The RNAi vector pCambia1391 was double-digested with HindⅢ and EcoRⅠ, and the DNA fragment was purified and recovered;

[0055] (2) using primer pair DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, and using TYLCCNV beta satellite infectious clone as a template, amplifying the DNAβ promoter, and purifying and recovering the DNA fragment;

[0056] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0057] DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA

[0058] (3) Connecting the DNAβ fragment to the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro;

[0059] (4) Digesting the target vector 1391::DNAβpro with SmaI and purifying and recovering the DNA fragment;

[0060] (5) using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NOs: 6-7, to amplify the BtACTB gene of Bemisia tabaci, using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NOs: 8-9, to amplify the key sequence of TYLCV, and purify and recover the DNA fragments;

[0061] BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT

[0062] BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC

[0063] TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT

[0064] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0065] (6) The key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction;

[0066] (7) Digest the target vector 1391::DNAβpro-BtACT-TYLCV with MluI and SalI, and purify and recover the DNA fragment;

[0067] (8) using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NOs: 10-11, amplifying the key sequences of the reverse fusion of BtACT and TYLCV, and purifying and recovering the DNA fragments;

[0068] BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT

[0069] BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0070] (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with the reverse insertion of the target fragment.

[0071] Example 2 Cultivation of transgenic tomatoes transformed with recombinant vectors

[0072] (1) 1 μg of recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV was mixed with 100 μL of competent Agrobacterium, and transformed into Agrobacterium by freeze-thaw method. After 2 hours of recovery culture, the culture was spread on the corresponding resistance culture medium, and Agrobacterium carrying the 1391::DNAβpro-hpBtACT-TYLCV recombinant plasmid was screened at 28°C for 48 hours.

[0073] (2) Infecting tomato leaves with Agrobacterium carrying the recombinant plasmid, obtaining callus tissue through differentiation culture, and then obtaining T0 generation seedlings through rooting culture, which are then transferred for further culture;

[0074] (3) After the seedlings continue to grow stably, the DNA in the plant leaves is extracted using the CTAB method; the primer pair DNAβ-F and TYLCV-R, as shown in SEQ ID NO:4 and SEQ ID NO:9, is used to perform PCR amplification with the extracted DNA as a template to confirm that the recombinant plasmid has been transferred into the plant; the offspring seeds of the above positive transgenic plants are collected. The primer sequences used are:

[0075] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0076] TYLCV-R: AATAATTATTTCCTTAACCCCGGGGCCCTTACAACAGATATAAGA

[0077] Example 3 Detection of the effect of transgenic tomatoes transformed with recombinant vectors on Bemisia tabaci and TYLCV transmitted

[0078] Whiteflies that emerged at the same time and carried TYLCV virus particles were released on transgenic tomatoes and wild-type plants, with 100 insects per tomato plant. After 3-7 days of feeding, it was observed that the mortality rate of whiteflies feeding on transgenic tomatoes was significantly higher than that of the control group ( Figure 2). After 28 days, it was observed that compared with the control, the number of whiteflies on the transgenic plants was extremely small and the symptoms were milder. Primers TYLCV-qF and TYLCV-qR were designed, as shown in SEQ ID NO:12-SEQ ID NO:13; primers 25S rRNA-qF and 25S RNA-qR were designed to amplify the internal reference gene, as shown in SEQ ID NO:14-SEQ ID NO:15, and qPCR detection was performed, and combined with western blot analysis, it was found that the amount of virus accumulation was less ( Figure 3 ).

[0079] TYLCV-qF:GCTGCTGTCCCCATTGTCCAA

[0080] TYLCV-qR:CCAGATCCACGAGTAACATCACT

[0081] 25S rRNA-qF:ATAACCGCATCAGGTCTCCA

[0082] 25S RNA-qR:CCGAAGTTACGGATCCATTT

[0083] The above results show that the transgenic tomatoes transformed by the recombinant vector constructed by the present invention and driven by the DNA β promoter and targeting both whitefly and TYLCV can effectively resist the damage of whitefly and TYLCV transmitted by it.

[0084] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an RNAi recombinant vector that is resistant to both Bemisia tabaci and Tomato yellow leaf curl virus, characterized in that: The method is driven by a DNA β promoter from a geminivirus specifically expressed in the phloem, and the key sequences of BtACTB and TYLCV, key genes for growth and development of the whitefly, are inserted into the multiple cloning site; wherein the sequence of the DNA β promoter is shown in SEQ ID NO: 1, and the key sequences of BtACTB and TYLCV of the whitefly are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

2. The method for constructing the RNAi recombinant vector resistant to both Bemisia tabaci and Tomato yellow leaf curl virus according to claim 1, characterized in that: The following steps are involved: (1) The RNAi vector pCambia1391 was double-digested with HindⅢ and EcoRⅠ, and the DNA fragment was purified and recovered; (2) using primer pair DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, and using TYLCCNV beta satellite infectious clone as a template, amplifying the DNAβ promoter, and purifying and recovering the DNA fragment; DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA (3) Connecting the DNAβ fragment to the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro; (4) Digesting the target vector 1391::DNAβpro with SmaI and purifying and recovering the DNA fragment; (5) using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NOs: 6-7, to amplify the BtACTB gene of Bemisia tabaci, using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NOs: 8-9, to amplify the key sequence of TYLCV, and purify and recover the DNA fragments; BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT TYLCV-R: AATAATTATTTCCTTAACCCCGGGGCCCTTACAACAGATATAAGA (6) The key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction; (7) Digest the target vector 1391::DNAβpro-BtACT-TYLCV with MluI and SalI, and purify and recover the DNA fragment; (8) using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NOs: 10-11, amplifying the key sequences of the reverse fusion of BtACT and TYLCV, and purifying and recovering the DNA fragments; BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with the reverse insertion of the target fragment.

3. The RNAi recombinant vector resistant to both Bemisia tabaci and Tomato yellow leaf curl virus obtained by the construction method according to claim 1 or 2.

4. Use of the RNAi recombinant vector according to claim 3 in transgenic tomato cultivation and resistance analysis, reducing the survival rate of whiteflies and inhibiting the pathogenicity of tomato yellow leaf curl virus.

5. A method for cultivating transgenic tomatoes that inhibit whitefly and the tomato yellow leaf curl virus transmitted by whitefly, characterized in that: The RNAi recombinant vector according to claim 3, i.e., the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV, is introduced into tomatoes by Agrobacterium transformation, and transgenic tomatoes that simultaneously inhibit whiteflies and tomato yellow leaf curl virus are obtained by screening.

6. The method for cultivating transgenic tomatoes according to claim 5, characterized in that: The following steps are involved: (1) 1 μg of the recombinant plasmid was mixed with 100 μL of Agrobacterium competent medium, and the Agrobacterium was transformed by freeze-thaw method. After 2 hours of recovery culture, the plasmid was spread on the corresponding resistance medium. After 48 hours of culture at 28°C, the Agrobacterium carrying the 1391::DNAβpro-hpBtACTB-TYLCV recombinant plasmid was screened. (2) Infecting tomato leaves with Agrobacterium carrying the recombinant plasmid, obtaining callus tissue through differentiation culture, and then obtaining T0 generation seedlings through rooting culture, which are then transferred for further culture; (3) After the seedlings continue to grow stably, the DNA in the plant leaves is extracted using the CTAB method; the primer pair DNAβ-F and TYLCV-R, as shown in SEQ ID NO:4 and SEQ ID NO:9, is used to perform PCR amplification with the extracted DNA as a template to confirm that the recombinant plasmid has been transferred into the plant; and the offspring seeds of the above positive transgenic plants are collected.

Images