Preparation method of high-yield high-temperature-resistant homologous triploid chlamys hiraii

Abstract

The application provides a preparation method of high-yield high-temperature-resistant homologous triploid Argopecten irradias, and the Argopecten irradias parent shellfish with high-temperature-resistant characteristics is screened through a molecular marker assisted breeding technology; after the parent shellfish is induced to spawn, the fertilized eggs are treated by using cytochalasin B to induce the generation of homologous triploidy, and the cleavage rate, the hatching rate, the metamorphosis rate and the triploid larva rate are comprehensively considered, so that the high-efficiency induction of the homologous triploid of the hermaphrodite shellfish is realized. The SNP site most significantly related to the high-temperature-resistant performance of the Argopecten irradias is identified through whole genome association analysis, a high-temperature-resistant molecular marker is developed, and the individual with the high-temperature-resistant genotype is screened for spawning and fertilization. The triploid larva obtained through the method has a faster growth and development speed than the common diploid larva, and the artificial breeding cost can be greatly reduced.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic breeding of shellfish in marine agriculture, and particularly relates to a preparation method of high-yield and high-temperature-resistant homologous triploid Arctica islandica. BACKGROUND

[0002] Arctica islandica is the highest-yield scallop species in China, with an annual output of 800,000 tons, and is one of the important economic shellfish. However, in recent years, the Arctica islandica aquaculture industry has faced many industry problems, such as small individual size and large-scale death caused by high temperature in summer, which poses a serious challenge to the sustainable and healthy development of the industry. Therefore, breeding high-yield and high-temperature-resistant Arctica islandica breeds has become an important means to solve the above industry problems.

[0003] In aquatic shellfish, polyploid individuals usually exhibit significant growth advantages compared to diploids. Therefore, polyploid induction technology has become an important method for genetic improvement of aquatic shellfish, which regulates chromosome ploidy through physical and chemical methods to improve target traits. However, in current polyploid breeding practices of shellfish, trait improvement is mainly focused on growth performance, and less attention is paid to heat tolerance and other stress resistance traits. For example, polyploid oysters and other shellfish also have large-scale death in summer, which has become an important bottleneck restricting the development of the industry. Therefore, how to improve the growth traits of polyploid breeding technology while enhancing the stress resistance of shellfish has become an important issue that needs to be solved by breeders.

[0004] Molecular marker breeding (MAS) can significantly improve breeding efficiency and shorten breeding cycles by screening individuals with excellent traits and corresponding genotypes through specific molecular markers. For complex traits such as stress resistance that cannot be directly measured, MAS is an efficient breeding method. Through techniques such as genome-wide association analysis (GWAS), key genetic loci related to target traits are screened and identified, and corresponding molecular markers such as microsatellites (SSR), insertions or deletions (Indel), and single nucleotide polymorphisms (SNP) are developed. The rapid development of MAS provides an efficient solution for aquaculture, especially for trait improvement.

[0005] As a hermaphroditic economic shellfish, Chlamys varia has not yet had an efficient polyploid induction technology system. Therefore, it is of great significance to establish and improve the polyploid induction technology of Chlamys varia for its industry development. In the early stage, the subject group identified a SNP site significantly related to the high-temperature tolerance trait of Chlamys varia through GWAS technology, which provided a reliable molecular marker for MAS breeding of high-temperature-tolerant Chlamys varia. The present application further combines MAS technology with polyploid induction technology to successfully prepare high-yield, high-temperature-tolerant homologous triploid Chlamys varia. The specific method is as follows: Chlamys varia parent individuals with high-temperature-tolerant genotypes are screened by MAS for spawning and fertilization, and cytochalasin B is used to inhibit the second polar body discharge of fertilized eggs, so as to efficiently obtain homologous triploids. The method has the advantages of simplicity, high efficiency, low price, green environmental protection and the like, and provides certain technical support and innovative path for the sustainable and healthy development of Chlamys varia industry in China. SUMMARY

[0006] The present application provides a preparation method of high-yield, high-temperature-tolerant homologous triploid Chlamys varia, which combines molecular marker assisted breeding (MAS) technology with polyploid induction technology to prepare high-yield, high-temperature-tolerant homologous triploid Chlamys varia. In the induction process, the cleavage rate, hatching rate, metamorphosis rate and triploid larva rate are comprehensively considered, and the existing chemical induction method of triploid shellfish is optimized, thereby providing an innovative solution for efficient seed production of fast-growing, stress-resistant Chlamys varia.

[0007] The present application first provides a SNP site related to the high-temperature tolerance trait of Chlamys varia, which is located at position 234 of the nucleotide fragment of SEQ ID NO: 1, and the base is T / C;

[0008] TGAAACTTGTCATCACGCAATGTGAATATAATATTATTATATATTCTGTGTGTCAATTGCATCACCTTTATCGGAGATAAATATGAGTTTATCACAAGCATTTGTTTGTAATTACGTCCTAGACAAATGTATCTGCATAAACTGCCAAAGAAACATCGATAAAGGTTGTTTTCGTTTAGGCCTGGTCAGAGGTCAAGGTTCAGAGGTCACTCGACATGACTGGTATCACCCGATATGCTTCTGGGAAAAGTGTCCATACAAACAGCATGTTCGTGGGACGAACATTGACCGCCTGACATTCGTAGAGCTGTTTCACGGGTTTGAAAGTATAGCAGCTTCAGATAGGATGAAATTGGAACAAGAAGCTTACAAGCCTCCTGCTAAACTAAAACGAAATCATCGCCATTCCGGATTGGTTGCCAATGGTAACGATGACGTCAGTCTTGATGGTGGTGACTATGAACTCGATGAGAATACGTATGATTTGTCGAACTTGATTTGTATACATGTGTTCAGGTATAAACTTGATGTGTATGTAAGCATCCGGGAGTATTTCAAAGCCGTGAATGCAACGATTGCCAAGGCTACTCAAGTCGGCATCGCTTTGAAGTCAAGCCAATGGCATGCAGTTTGTCGGAAACGATTCGGAATAGACTGTGCTCTTAAAGAAATAGGTGACAGCAAGGCAAAAATAAAATCTAAAGGAAACGACAAAATCGAAAATGATAAAGATGAGGATGAAGAAGATGGTAAGAACGACTATTATTATCACATTACCGTAAATCAATTTAGTATAATAGCTTATGGCTTCTATTGTTCTACTTTACCTGTACTTGAAGCATTTTCTCGACTATTTCCTGTCTCTTAAAATATGTGAAACCTTATTGCAATCGGATAAGTAGGCTAACAGTGT (SEQ ID NO: 1).

[0009] The present invention also provides a method for screening bay scallop individuals for high temperature resistance traits, wherein the method comprises detecting the genotype of the above-mentioned SNP site in the bay scallop individuals to be screened, and screening individuals with the TT / TC genotype;

[0010] Furthermore, the method is to use a live sampling method to extract DNA from the gill filaments of the bay scallop to be tested, amplify the DNA using PCR primers, and sequence the amplified products to determine the genotype;

[0011] As a specific record of the embodiment, the specific sequence information of the PCR primer pair is as follows:

[0012] Upstream primer (SEQ ID NO: 2): 5′-TGAAACTTGTCATCACGCAAT-3′;

[0013] Downstream primer: 5′-ACACTGTTAGCCTACTTATCCGA-3′.

[0014] The present invention also provides a method for inducing and cultivating autotriploid bay scallops, which uses the bay scallop individuals with high temperature resistance selected by the above method as parents to induce and cultivate autotriploid bay scallops;

[0015] The induction cultivation method comprises the following steps:

[0016] 1) Remove the broodstock from the 20°C seawater, dry them in the shade at room temperature, and then transfer them to warmed seawater for spawning induction;

[0017] 2) After the parent shellfish ovulates, record the time of ovulation as the time of fertilization and observe samples under a microscope. When 30% of the fertilized eggs show the first polar body, add cytochalasin B mother solution for treatment;

[0018] 3) After the treatment is completed, the fertilized eggs are collected by filtration and rinsed with 24° C. seawater to remove residual cytochalasin B (CB), and the collected fertilized eggs are cultured for embryonic development.

[0019] Furthermore, the broodstock is a bay scallop having high temperature resistance, obtained by screening using the above-mentioned method for screening bay scallops with high temperature resistance.

[0020] Preferably, the treatment concentration of cytochalasin B is 0.5 mg / L, and the treatment time is 15 minutes.

[0021] The present invention is different from the traditional chemical induction method of autotriploid shellfish and has the following innovations:

[0022] 1) Innovation in the Triploid Induction Method for Hermaphroditic Bay Scallops: This invention establishes a highly efficient autologous triploid induction technology for hermaphroditic bay scallops, which is significantly innovative in terms of induction parameters and provides a new solution for triploid research in hermaphroditic shellfish.

[0023] 2) Innovation in polyploid induction efficiency evaluation indicators: The efficiency evaluation of traditional chemical induction methods is often based on only a single indicator, the triploid larvae rate. The present invention has made innovations in the evaluation system, comprehensively considering multiple key characteristics of embryonic development, including cleavage rate, hatching rate, metamorphosis rate and triploid larvae rate, and established a new, more comprehensive and reliable induction efficiency evaluation method.

[0024] 3) Innovation in Shellfish Combined Breeding Technology: Traditional breeding techniques typically utilize molecular marker-assisted breeding and polyploid induction separately. This invention, however, innovatively combines molecular marker-assisted breeding with triploid induction, successfully breeding triploid bay scallops with high yield and high-temperature tolerance. This innovative combination of technologies provides a path for the sustainable and healthy development of my country's bay scallop industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : Diagram of the orthogonal design experiment for inducing homologous triploid bay scallops by CB concentration and treatment time, including (A) the cleavage rate of triploid larval embryos under different conditions; (B) the triploid rate of D-shaped larvae under different conditions; (C) the hatching rate of triploid embryos under different conditions; (D) the metamorphosis rate of triploid larvae under different conditions; (E) the flow cytometric ploidy detection results of diploid larvae; (F) the flow cytometric ploidy detection results of D-shaped larvae using the reported conditions (0.1 mg / L CB treatment for 20 minutes); (G) the flow cytometric ploidy detection results of D-shaped larvae using the optimized induction conditions of the present invention (0.5 mg / L CB treatment for 15 minutes).

[0026] Figure 2 : Chromosome analysis diagrams of the trochophore larvae of the control group (diploid) and the induced group (triploid), including (A) chromosome observation of the diploid trochophore larvae; (B) chromosome number statistics of the trochophore larvae in the control group; (C) chromosome observation of the homologous triploid trochophore larvae; (D) chromosome number statistics of the trochophore larvae in the experimental group.

[0027] Figure 3 : Growth and development characteristics of bay scallop embryos / larvae in the control group (diploid) and the induced group (triploid), where (A) the time taken for diploid and triploid bay scallop embryos to develop to various stages before hatching; (B) the changes in shell length growth of diploid and triploid bay scallop shell top larvae after hatching, and the arrows indicate the time of cultchnical placement.

[0028] Figure 4 : Appearance, ploidy and growth characteristics of adult bay scallops in the control group (diploid) and induced group (triploid), including (A) appearance of adult diploid bay scallops; (B) appearance of adult triploid bay scallops; (C) ploidy detection results of gill filaments of diploid bay scallops by flow cytometry; (D) ploidy detection results of gill filaments of triploid bay scallops by flow cytometry; (E) growth trait statistics of 8-month-old diploid and triploid bay scallops; (F) dynamic changes in adductor muscle re-growth of diploid and triploid bay scallops.

[0029] Figure 5 : ABT difference diagram of the temperature tolerance index of bay scallops in the control group (diploid), traditional group (triploids prepared by randomly selecting broodstock for spawning and induction) and experimental group (triploids prepared by spawning and induction of high-temperature resistant broodstock). DETAILED DESCRIPTION

[0030] The present invention first uses molecular marker-assisted breeding technology to screen out bay scallop parents with high-temperature resistance based on the results of genome-wide association analysis (GWAS), providing an excellent germplasm foundation for subsequent polyploid induction. GWAS also identified the SNP site that is most significantly associated with the bay scallop's high-temperature resistance indicator, Arrhenius break temperature (ABT), and based on this, developed SNP molecular markers associated with the heat-resistance trait (Table 1). The screened SNP site is located at position 234 of the following sequence (Arg0230340.1, SEQ ID NO: 1), and its base is T / C;

[0031] Table 1: SNP marker information most significantly associated with the heat tolerance trait ABT in bay scallops

[0032]

[0033] In vivo sampling was performed by using forceps to pick up 1 to 2 gill filaments of the selected broodstock, and DNA of the scallop gill filaments was extracted. Upstream and downstream primers of the SNP markers were designed (Table 2) for PCR amplification, and individuals with high-temperature-resistant genotypes were screened as broodstock by Sanger sequencing.

[0034] Table 2: Sequence list of primers used for SNP detection and Sanger sequencing

[0035]

[0036] The selected high-temperature resistant broodstock are subjected to a temperature-accumulated ripening treatment. The water temperature is raised by 1°C per day on the basis of the natural water temperature until the water temperature reaches 20°C and the temperature is kept constant until the broodstock are ready for spawning. The accumulated temperature of the broodstock reaches 180-200°C per day.

[0037] And design orthogonal experiment, research different concentration (0.1mg / L, 0.3mg / L, 0.5mg / L and 0.7mg / L) and processing time (10, 15, 20 and 25 minutes) cell relaxation B (CB) on the induction effect of bay scallop fertilized eggs, explore the induction efficiency of homologous triploid under different conditions, determine the best treatment scheme:

[0038] 1) Induce spawning by air-drying and temperature raising: The parent scallops that were induced to mature in 20℃ seawater were taken out and air-dried at room temperature (23-24℃) for 40 minutes, then transferred to a beaker containing 2000mL of 24℃ seawater for spawning induction. Each parent scallop was placed in a separate beaker.

[0039] 2) Record the fertilization time and control the sperm-egg ratio: After the parent scallops laid eggs, the time of egg laying was recorded as the fertilization time, and the sperm-egg ratio was controlled to be 3:1 to 5:1 under a microscope. The fertilization process of the fertilized eggs was monitored in real time, and when 30% of the fertilized eggs appeared the first polar body, the pre-configured 1mg / mL cytochalasin B stock solution was added to achieve the target treatment concentration.

[0040] 3) Collect fertilized eggs and embryo hatching after CB treatment: After chemical treatment, the fertilized eggs were collected using filter gauze and rinsed 3 times with 24℃ seawater to remove residual CB. Then, the collected fertilized eggs were transferred to a 100L culture tank and started aeration culture, with the water temperature maintained at 24±1℃ to ensure stable embryo development.

[0041] Considering the cleavage rate, hatching rate, metamorphosis rate, and triploid rate, the optimal induction conditions for homologous triploid bay scallops were obtained. During cultivation, the cleavage rate, hatching rate, and metamorphosis rate of embryos / larvae were observed and calculated, and samples were collected for flow cytometry ploidy detection when the embryos developed to D-shaped larvae. The calculation formulas for each index are as follows:

[0042]

[0043] The comprehensive evaluation of different cytochalasin B treatment conditions was based on the cleavage rate, hatching rate, metamorphosis rate, and triploid rate, with the formula as follows:

[0044]

[0045] The comprehensive evaluation index of different conditions is shown in Table 3. The optimal condition for inducing homologous triploid bay scallops was 0.5mg / L CB treatment for 15 minutes, with a comprehensive evaluation index of 31.26%, which was significantly higher than the traditional method (0.1mg / L CB treatment for 20 minutes, with a comprehensive evaluation index of 14.97%).

[0046] Table 3: Comprehensive evaluation index table for different conditions

[0047]

[0048] The steps for measuring the specific growth performance in the specific embodiment of the present invention are as follows:

[0049] 1) Larval culture stage: Before larvae developed to the blastula stage, larvae in the control and induced groups were sampled and examined under a microscope at 10-minute intervals for developmental status, and the time taken for larvae to reach each stage was recorded. Between the blastula stage and the D-larva stage, larval developmental time was recorded by microscopic examination every hour. After hatching, the shell length of the larvae at the top of the shell was examined daily. The developmental speed of larvae in the induced and control groups and the shell length growth rate of the larvae at the top of the shell were compared to evaluate the growth performance of the two groups of larvae.

[0050] 2) Marine aquaculture: From June to November, individuals were randomly selected from the induced and control (diploid) groups each month, and gill filaments were harvested. Flow cytometry was used to determine ploidy. Growth traits, including shell height, length, width, live weight, and adductor muscle weight, were measured for triploid and diploid individuals with confirmed ploidy. Growth performance was then compared between the two groups.

[0051] The heat resistance test steps in the specific embodiment of the present invention are as follows:

[0052] During the offshore aquaculture phase from June to November, along with growth performance measurements, triploid and diploid individuals with confirmed ploidy were tested for their thermal tolerance. The scallops were placed in aerated seawater, and the water temperature was increased from 20°C to 38°C at a rate of 1°C / minute, with each 2°C increase being a temperature measurement point. Heart rate data was collected using an infrared photoelectric sensor, and waveform analysis was performed on a computer to calculate the thermal tolerance index (ABT). This was calculated as the intersection of the linear fit formula of the scatter plot of temperature and heart rate during the rising phase and the linear fit formula during the falling phase.

[0053] The present invention will be described below with reference to the embodiments and accompanying drawings.

[0054] Example 1

[0055] In early March 2024, the inventors began preparing high-yield, heat-resistant autotriploid bay scallops at Yantai Haiyi Seedlings Co., Ltd. in Shandong Province. The specific process includes the following steps: screening heat-resistant bay scallop parents using MAS technology, accelerating the ripening of bay scallop parents through accumulated temperature, optimizing cytochalasin B treatment conditions, testing the induction effect, and measuring growth and temperature tolerance.

[0056] 1. MAS technology to screen high temperature resistant bay scallop parents

[0057] 120 individuals of similar size (approximately 6 cm in shell height) were randomly selected from a common bay scallop population. One to two gill filaments were removed from each individual using forceps for DNA extraction. PCR amplification was performed using upstream and downstream primers designed based on the heat-resistance SNP marker (Table 2). Sanger sequencing results were used to identify heat-resistant individuals with a genotype of TT / TC at position 234. A total of 38 individuals with this heat-resistant genotype were selected and used as experimental broodstock. The remaining 82 individuals were divided into a conventional group (n = 41) and a control group (n = 41) as broodstock.

[0058] 2. Accumulated temperature to promote ripening of bay scallop broodstock

[0059] Each group of broodstock was placed in the same environment for ripening treatment until the gonads were well developed (the distal male area of ​​the gonad was milky white and the proximal female area was orange-red), and temporarily cultured in seawater at a temperature of 20°C and a salinity of 30‰. Subsequently, each group of broodstock was shade-dried for 40 minutes at room temperature of 24°C. After the shade drying was completed, 20 broodstock were randomly selected from each group and placed in a 2000mL beaker. 24°C seawater was added to the cup to promote spermatogenesis and ovulation of the bay scallops. The seawater temperature was measured regularly throughout the process, and the seawater was replaced regularly to maintain the temperature within the range of 24±1°C.

[0060] 3. Optimize cytochalasin B treatment conditions

[0061] After ovulation (mixed sperm and egg ovulation) in both the experimental and conventional groups, the seawater was stirred promptly to ensure adequate fertilization of the eggs. The time of ovulation was recorded as the time of fertilization, and samples were immediately taken for observation. The sperm-egg ratio was checked under a microscope to ensure a sperm:egg ratio of 5:1. Subsequently, samples were taken every minute for microscopic observation of the development of the fertilized eggs.

[0062] Experimental Group: When 30% of the fertilized eggs had developed the first polar body under a microscope, CB stock solution was added to the seawater containing the fertilized eggs to a final CB concentration of 0.5 mg / L. After 15 minutes of treatment, the fertilized eggs were collected using a 500-mesh sieve and rinsed with 24°C seawater to remove any residual cytochalasin B.

[0063] Traditional group: According to the reported method, CB mother solution was added to the fertilized eggs seawater to make the concentration reach 0.1 mg / L. After treatment for 20 minutes, the fertilized eggs were collected with a 500-mesh sieve and rinsed with 24°C seawater.

[0064] Control group: No cytochalasin B was added, and the fertilized eggs were directly transferred to the breeding tank for subsequent incubation

[0065] The fertilized eggs of each group were transferred to a 100L breeding barrel (each group of breeding barrels was marked). The breeding conditions were a water temperature of 24°C and a salinity of 30‰. During the first 10 hours of incubation, the breeding barrel was gently stirred every 0.5 hours to prevent the embryos from settling. After 1 hour of development: the cleavage rate of each group was counted; during the hatching stage: the hatching rate of each group of embryos was recorded; during the metamorphosis stage: 3 days after the attachment base was placed, the metamorphosis rate of each group was counted. The cleavage rate and hatching rate of the experimental group and the traditional group were similar, with no significant difference ( Figure 1 A&B); the triploid rate (75.75±6.51%) and the abnormal rate (78.14±7.02%) of the experimental group were significantly (P<0.05) higher than those of the traditional group (triploid rate 40.35±6.11%, abnormal rate 59.61±3.84%) ( Figure 1 C&D).

[0066] 4. Induction effect detection

[0067] 1) Detection of larval ploidy by flow cytometry. After 18–24 hours of hatching, select the D-shaped larvae. After selection, use a 300-mesh sieve to enrich the D-shaped larvae (N>500) and perform flow cytometry to detect embryonic ploidy ( Figure 1 The specific procedure was as follows: larvae collected through a 300-mesh silk sieve were placed in 1 mL of 4× PBS buffer; collagenase (working concentration 1×) was added and lysed at room temperature for 10 minutes; the cell suspension was collected by filtration using a cell strainer; cells were counted under a microscope using a hemocytometer to ensure a cell concentration of at least 1000 cells / μL; 20 μL of 1× propidium iodide (PI) was added to the cell suspension and gently mixed; the sample was stained in the dark for 30 minutes before being placed on a flow cytometer to measure cellular DNA content. Based on the flow cytometric results, the ploidy distribution of embryos was analyzed, and the proportion of triploid larvae was calculated. The triploid rate of the improved experimental group (0.5 mg / L CB treatment for 15 minutes) was significantly higher (P < 0.05) than that of the traditional group (40.35 ± 6.11%).

[0068] 2) Cell chromosome observation analysis of trochophore larvae. When the larvae develop to the trochophore stage, the trochophore larvae (N > 500) are enriched using a 500-mesh screen gauze, and cell chromosome observation is performed by the following steps: the enriched trochophore larvae are transferred to a 2-mL centrifuge tube; 0.01% colchicine solution prepared with sterilized seawater is added, and the treatment time is 1.5 hours; centrifugation is performed at 240 g for 5 minutes, and the supernatant is discarded; a hypotonic solution with a concentration of 0.075 M KCl is added to the larval sample, and the treatment time is 20 minutes; centrifugation is performed at 240 g for 5 minutes, and the supernatant is discarded again; -20°C pre-cooled Carnoy's fixative (ethanol:acetic acid = 3:1) is added, and the fixation treatment time is 15 minutes; the fixative is replaced, and the fixation step is repeated 3 times; during the entire fixation process, the centrifuge tube is kept horizontal to avoid cell compression or deformation. The fixed larval sample is transferred to a 1.5-mL centrifuge tube; centrifugation is performed at 3500 g for 10 minutes, and the supernatant is discarded; 50% acetic acid solution is added to dissociate the cells, and the time is 2 minutes; the cell suspension is dropped on a pre-warmed glass slide at 56°C, and naturally dried; 30 μL of 4',6-diamidino-2-phenylindole (DAPI) is added to the dried glass slide, and the staining is performed at room temperature in the dark for 10 minutes; the excess dye is washed with PBS or deionized water; glycerol-gelatin mounting medium is used for sealing; the stained sample is observed under a fluorescence microscope Figure 2 ), and the chromosome morphology and structure information are recorded and analyzed. Microscopic observation shows that most of the diploid trochophore larval cells have typical 32-chromosome division phases, accounting for 76.06% of the total observed cells Figure 2 B); in contrast, most of the triploid trochophore larval cells present 48-chromosome division phases, accounting for 52.54% of the total observed cells Figure 2 D).

[0069] 5. Growth performance determination

[0070] 1) Growth performance determination at the embryonic development stage

[0071] Before the larvae develop to the blastula stage, the development of the larvae in the control and experimental groups is sampled and observed under a microscope every 10 minutes, and the time for the larvae to develop to each stage is recorded; between the blastula stage and the D-shaped larval stage, the larvae are sampled and observed under a microscope every 1 hour, and the development time is recorded. The specific operation is as follows: 1 mL of the embryonic system is sucked into a disposable pipette and transferred to an embryo dish, and observed under an optical microscope; if 80% of the embryos in the field of view are at the same development stage, it is considered that the embryos in this group have developed to this stage. After hatching, the top shell larvae are sucked into an embryo dish (N > 30) every day, and the shell length of the top shell larvae is observed and counted under an optical microscope.

[0072] The results showed that from the fertilized egg to the middle stage of the shell top larvae (shell length 150mm), the larvae in the experimental group developed slower than those in the control group. In the late stage of the shell top larvae, the larvae in the experimental group showed a significant growth advantage over the control group, and the time of eye spot appearance was 2 days earlier, and the time of attachment base placement was 2 days earlier ( Figure 3 ).

[0073] 2) Determination of growth performance in the adult stage

[0074] Individuals from the experimental group (N>50), traditional group (N>50), and control group (N>50) cultured in the same batch were collected, and gill filaments were taken for flow cytometry ploidy determination. The specific steps were as follows: gill filaments were placed in 1 mL of 4× PBS buffer, collagenase (working concentration 1×) was added, and lysed at room temperature for 10 minutes. Subsequently, the cell suspension was filtered through a cell strainer and the cells were counted under a microscope using a hemocytometer to ensure that the cell number was greater than 1000 / μL. Next, 20 μL of 1× PI was added to the cell solution, and the cells were stained in the dark for 30 minutes before flow cytometric analysis. After determining the ploidy, triploid (N=12) and diploid (N=12) individuals were selected from the experimental and control groups, respectively, and their growth traits, including shell height, shell length, shell width, live weight, and adductor muscle weight, were measured.

[0075] The results showed that triploids had significant (P<0.05) growth advantages over diploids in terms of shell height, shell length, shell width, live weight, and adductor muscle weight. Figure 4 E), and the adductor muscle weight of triploids increases faster than that of diploids ( Figure 4 F). On the first seedling separation (May 16, 2024), the number of individuals in the experimental group, the number of individuals in the traditional group, and the number of individuals in the control group were approximately 4,000. By October 2024, the number of individuals in the experimental group (survival rate 87.5%), the number of individuals in the traditional group (survival rate 66.7%), and the number of individuals in the control group were approximately 4,200 (survival rate 84.0%). The survival rate of the experimental group was higher than that of the traditional and control groups in the same batch.

[0076] 6. Temperature resistance test

[0077] Bay scallops were randomly selected from the experimental group (N=12), the traditional group (N=12) and the control group (N=12), and their cardiac performance was measured to evaluate the temperature tolerance of the triploid individuals in the experimental group. The specific operations were as follows: an infrared photoelectric sensor was attached to the scallop shell near the heart, the collected signal was processed through a signal amplifier and a filter, and the cardiac waveform was analyzed using a computer. During the experiment, the seawater was continuously ventilated, the initial water temperature was set at 20°C, and the temperature was gradually increased to 38°C at a rate of 1°C / minute. During the experiment, each increase of 2°C was set as a temperature detection point. At each temperature point, cardiac waveform data was collected after the water temperature stabilized for 5 minutes and was recorded continuously for 5 minutes. The calculation method of Arrhenius breakthrough temperature (ABT) is as follows: During the cardiac performance measurement process, the scattered data formed by the heart rate rising and falling with the temperature were linearly fitted to obtain two linear fitting formulas. The horizontal coordinate of the intersection of the two formulas is the ABT. Through the above experimental process, the pattern of individual heart rate changes with temperature in each group was obtained, and the corresponding ABT value was calculated. The results are as follows Figure 5 As shown in the data, the ABT of the triploid bay scallops in the experimental group (33.76±1.76℃) was higher than that in the traditional group (31.23±1.24℃) and the control group (31.94±0.94℃), showing good temperature tolerance.

[0078] The present invention uses MAS technology to screen high-temperature resistant bay scallop parents, combines it with optimized cytochalasin B to treat bay scallop fertilized eggs, and successfully prepares high-yield, high-temperature resistant triploid bay scallops. The experimental process covers parent screening, accumulated temperature to promote ripening, cytochalasin B optimization treatment, induction effect detection, and growth and temperature resistance performance measurement. The present invention comprehensively considers multiple key characteristics of embryonic development and establishes a more comprehensive and reliable new induction efficiency evaluation method. The triploid individuals obtained by the present invention are superior to diploids in both growth performance and temperature resistance, providing innovative methods and technical support for the cultivation of fast-growing and stress-resistant bay scallop varieties.

Claims

1. A method for inducing and cultivating autotriploid bay scallops, characterized in that: The induction breeding method is to use the method of screening bay scallop individuals with high temperature resistant traits to screen as parents to induce the breeding of autologous triploid bay scallops; The method for screening bay scallop individuals with high temperature resistance traits is to detect the genotype of the SNP site in the bay scallop individuals to be screened, and screen individuals with the TT / TC genotype; the SNP site is located at the 234th position of the nucleotide fragment with the sequence of SEQ ID NO: 1, and its base is T / C; The induction cultivation method comprises the following steps: 1) The broodstock are removed from the seawater and dried in the shade at room temperature before being transferred to warmed seawater for spawning induction. 2) After the parent shellfish ovulates, record the time of ovulation as the time of fertilization and observe the eggs under a microscope. When 30% of the fertilized eggs have the first polar body, add cytochalasin B mother solution for treatment. The treatment concentration of cytochalasin B is 0.5 mg / L and the treatment lasts for 15 minutes. 3) After the treatment is completed, the fertilized eggs are collected by filtration and rinsed with seawater to remove residual cytochalasin B. The collected fertilized eggs are then cultured for embryonic development.

2. The induction cultivation method according to claim 1, wherein The method for screening bay scallop individuals with high-temperature resistance traits is to use a live sampling method to extract DNA from the gill filaments of the bay scallop to be tested, amplify the DNA using a PCR primer pair, and then sequence the amplified product to determine the genotype of the SNP site; the sequence of the upstream primer of the primer pair is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO:

3.

3. The induction cultivation method according to claim 1, wherein In the method, step 1) uses heated seawater at 24°C.

Images