ARL13B gene-based structural variation marker applied to Wenchang chicken breeding and detection method of ARL13B gene-based structural variation marker

Abstract

The invention discloses a structural variation marker based on an ARL13B gene and applied to Wenchang chicken breeding and a detection method of the structural variation marker, and relates to agricultural bioengineering, the sequence of the structural variation molecular marker is SEQ ID No: 01, and the structural variation molecular marker is located on a Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus chick; the molecular marker is characterized in that the position of Genbank: GCA040436655.1 is CM080655.1: 108497195-108497244, and the molecular marker with the structural variation is a deletion site; at the same week age, the weight of an individual with the deletion structure variation marker sequence is obviously higher than that of a non-deletion individual, and the molecular marker obtained by the invention can be applied to Wenchang chicken breeding.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, in particular to a method based on ARL13B Gene and structural variation markers and their detection methods used in the breeding of Wenchang chicken. Background Art

[0002] Wenchang chicken generally refers to Hainan Wenchang chicken, which is a broiler breed originating from Hainan Province, China. Compared with other chicken breeds, Wenchang chicken has more outstanding characteristics from appearance to meat quality. Because the meat quality characteristics are popular with consumers, Wenchang chicken has a large market demand. The market has a uniform weight requirement for Wenchang chicken breeds. In order to meet market demand, a method is needed to screen by detecting variations and apply it as a molecular marker in the breeding of Wenchang chicken.

[0003] ARL13B This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase containing N-terminal and C-terminal guanine nucleotide binding motifs. This protein is located in the cilium and plays a role in cilium formation and maintenance. ARL13B It was found to be one of the genes under positive selection in the chicken genome and plays an important role in the regulation of cerebral cortex development and skeletal development.

[0004] The present invention obtains a structural variation marker sequence as a molecular marker for use in Wenchang chicken breeding through detection and screening, and can provide a powerful reference for directional breeding of body weight in actual breeding work. Summary of the invention

[0005] In order to solve the deficiencies of the prior art, the present invention aims to provide a ARL13B The invention discloses a structural variation marker and a detection method thereof for the gene and applied to the breeding of Wenchang chicken. The invention obtains a molecular marker through detection and screening and applied to the directional breeding of Wenchang chicken weight.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A structural variation marker based on the ARL13B gene, the sequence of the structural variation molecular marker is SEQ ID No: 01, the structural variation molecular marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus galluschicken; the position in Genbank: GCA_040436655.1 is CM080655.1: 108497195 - 108497244, and the structural variation molecular marker is a deletion site.

[0007] The aforementioned structural variation marker based on the ARL13B gene, the sequence of the structural variation molecular marker is located at the ARL13B gene on chromosome chr1, and the flanking sequence of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 is: the upstream 50bp is gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc SEQ ID No:04, and the downstream 50bp is catatatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc SEQ ID No:05.

[0008] The aforementioned structural variation marker based on the ARL13B gene, the detection primers of the sequence of the structural variation molecular marker include: Forward primer F is 5'-TCAGGCGATTCAAATAGCA 3' SEQ ID No:02; The reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3' SEQ ID No:03.

[0009] Based on the structural variation marker of the ARL13B gene mentioned above, at the same age, the weight of individuals lacking the structural variation marker sequence in the Wenchang chicken genome is higher than that of individuals without the structural variation marker sequence.

[0010] A structural variation marker based on ARL13B gene and its application in Wenchang chicken breeding. The sequence of the structural variation molecular marker is SEQ ID No: 01. The structural variation molecular marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus chicken; the position of the structural variation molecular marker in Genbank: GCA_040436655.1 is CM080655.1: 108497195 - 108497244, and the structural variation molecular marker is a deletion site. The invention is applied to a Wenchang chicken breeding detection kit.

[0011] The present invention is beneficial in that: The present invention obtains a structural variation marker sequence as a molecular marker for use in Wenchang chicken breeding through detection and screening; At the same age, the body weight of individuals lacking the structural variation marker sequence is significantly higher than that of individuals without the deletion, which can be applied to the directional selection of body weight in Wenchang chickens.

[0012] Technical terms: The flanking sequence refers to a non-translated nucleotide sequence that exists outside the first exon and the last exon of the coding region. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the electrophoresis result of the structural variation marker sequence deletion verification of the present invention; Figure 2 It is the result of the association analysis between the three gene types of 0 / 0 (no deletion), 0 / 1 (heterozygous deletion) and 1 / 1 (homozygous deletion) and the trait (weight) of the present invention. DETAILED DESCRIPTION

[0014] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0015] The samples and their sources are shown in Table 1: Table 1 A total of 354 individuals, including Wenchang chickens from 3 chicken farms.

[0016] Structural variation (SV) detection workflow 1. SV identification by next-generation sequencing Illumina paired-end sequencing data of 354 individuals were obtained, from which SVs were detected using the following algorithms: Read-pair (RP), Split-read (SR), Read depth (RD), and Assembly (AS). We combined multiple SV detection algorithms to maximize sensitivity by using six detection software: Manta, Delly, Wham, Smoove, Dysgu, and GRIDS2, and an ensemble of at least two algorithms from each software. The SVs obtained for each sample were merged using SURVIVOR software with the following parameters: 50 1 1 1 0 50. Then, the merged SVs were filtered using the following parameters: NA 50100000 0 -1. Next, the breakpoints of the SVs were refined according to their highest frequency positions.

[0017] 2. Assembly-based SV identification In addition to the Wenchang chicken gene reference genome ASM4043665v1, published assembled genomes of 30 samples from NCBI were used to detect assembly-based structural variations by constructing a pan-genome variation map. This step was completed using the Pggb software with the parameters -p 95-s 10000 -T 20 --poa-params 1,9,16,2,41,1. Next, the vg toolkit was used in the deconstruct mode with default parameters to identify the SVs of all autosomes and chromosome Z on the Wenchang chicken gene reference genome ASM4043665v1. The generated vcf file contains the SVs of all 31 assembled genomes.

[0018] ARL13B The position of the reference genome ASM4043665v1 (GCA_040436655.1) uploaded in the assembly is CM080655.1: 108497195 - 108497244. The flanking sequences of the structural variation marker sequence are: Upstream 50bp: gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc SEQ IDNo: 4, Downstream 50bp: cataatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc SEQ IDNo: 5.

[0019] 3. Pan-genome map construction The Wenchang chicken gene reference genome ASM4043665v1 was used as the backbone of the pan-genome map. Without removing any alternative alleles, the previously identified SVs based on next-generation sequencing and assembly were merged into the pan-genome variation map using the construct module of the vg toolkit. The resulting pan-genome map was then indexed in XG and GCSA formats using "vg index" and the "-L" parameter was enabled for both formats. SVs are depicted as bubbles in the map, and paths represent the corresponding alleles. These paths include the start and end nodes of the reference sequence, as well as the paths that traverse these nodes.

[0020] 4. Graph-based SV genotyping The pan-genome map was used to genotype 354 samples with high-depth sequencing (>10×). The clean reads of each sample were aligned with the map genome using "vgGiraffe" to obtain the result file in GAM format, excluding alignments with alignment quality <5 or base quality <5. Subsequently, "vg pack" was used to build the index under default parameters. On the constructed pan-genome map, "vg call" was used to generate SV genotyping results for 354 samples with parameters -v --bias-mode --het-bias 2,4.

[0021] 5. SV GWAS GWAS were performed on the SV dataset using linear mixed models using GEMMA96 (v1.0.3) and adjusted for sex, kinship, and population structure as cofactors. Kinship matrices were calculated using all SNPs in GEMMA, and population structure was determined using the first 10 principal components. Genome-wide significance thresholds were determined using a uniform threshold of 0.05 / n, where n represents the effective number of independent SVs and SNPs calculated using the genetic type I error calculator.

[0022] 6. Structural variation marker sequences A structural variation marker sequence was screened and used as a molecular marker for Wenchang chicken breeding, as shown in Table 2. The genotyping results showed that there were three genotypes: 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion). The results of the trait association analysis showed that Figure 2 At the same age, the body weight of individuals with deletion was significantly higher than that of individuals without deletion.

[0023] Table 2 Structural variation marker sequence deletion experimental verification process: 1. The length of the structural variation marker sequence is 50 bp, so primers covering the missing sequence were designed. Primer Premier 6.0 (Primer Premier :: Software for PCR Primer Design | Primer Design Program) software was used to design primers. The target fragment was 134 bp long and specific.

[0024] Forward primer F is 5'-TCAGGCGATTCAAATAGCA 3' SEQ ID No: 02 Reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3' SEQ ID No: 03 2. The DNA samples used for verification were from Beijing Compson Agriculture Co., Ltd., and the PCR reaction system was configured using Vazyme 2×RapidTaq Master Mix: 50ml as shown in Table 3: Table 3 3. PCR reaction conditions: 1. Pre-denaturation at 95°C for 3 minutes; 2. Denaturation at 95°C for 15 seconds; 3. Annealing at 55°C for 15 seconds; 4. Extension at 72°C for 30 seconds (repeat steps 2, 3, and 4 for 35 cycles); 5. Extension at 72°C for 5 minutes 4. Electrophoresis: ① Make 1.0% agarose gel: 0.5g agarose is dissolved in 50ml 1% TAE, and 5.5μl Sparkred fluorescent nucleic acid staining reagent is added. ② Use a pipette to draw 5μl PCR amplification product and add it to the gel wells in sequence, and add 4.5μl DNA Maker (D2000) as a reference. ③ After 120V constant voltage electrophoresis for 30 minutes, observe under ultraviolet light and take photos for record.

[0025] 5. The electrophoresis results are as follows Figure 1 As shown, The presence of a band at 84 bp indicates that there is a missing structural variation marker sequence, while the presence of a band at 134 bp indicates that there is no missing structural variation marker sequence. Heterozygotes have two bands.

[0026] The results of 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion) were compared with the results of trait association analysis. Figure 2 , at the same age, the body weight of individuals with missing phenotypes is significantly higher than that of individuals without missing phenotypes (g). Figure 2 As shown: From the above experiments, we can see that at the same age, the body weight of individuals with missing structural variation marker sequences is significantly higher than that of individuals without missing sequences.

[0027] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A structural variation marker based on the ARL13B gene, characterized in that: The sequence of the structural variation marker is SEQID No: 01, and the structural variation marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus galluschicken; the position in Genbank: GCA_040436655.1 is CM080655.1: 108497195 - 108497244, and the structural variation marker is a deletion site.

2. A structural variation marker based on the ARL13B gene according to claim 1, characterized in that: The sequence of the structural variation marker is located in the ARL13B gene on chromosome chr1, and the flanking sequence of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 is: the upstream 50bp is gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc SEQ ID No:04, and the downstream 50bp is cataatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc SEQ ID No:

05.

3. The structural variation marker based on the ARL13B gene according to claim 1, characterized in that: The detection primers of the sequence of the structural variation marker include: Forward primer F is 5'-TCAGGCGATTCAAATAGCA 3' SEQ ID No:02; The reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3' SEQ ID No:

03.

4. The structural variation marker based on the ARL13B gene according to claim 1, characterized in that: At the same age, the body weight of Wenchang chicken individuals lacking structural variation marker sequences in their genome was higher than that of individuals without structural variation marker sequences.

5. An application of structural variation marker based on ARL13B gene in the breeding of Wenchang chicken, characterized in that: The sequence of the structural variation marker is SEQ ID No: 01, and the structural variation marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus chicken; the position of the structural variation marker in Genbank: GCA_040436655.1 is CM080655.1: 108497195 - 108497244, and the structural variation marker is a deletion site; and is applied to a Wenchang chicken breeding detection kit.

Images