Capped RNA, method for producing same, device for producing protein, and method for producing protein

Abstract

The present invention is a capped RNA which has a translation region starting from an initiation codon and encoding a protein, and an upstream region on the upstream side of the initiation codon, and which comprises a branch having a cap structure. It is preferable that the branch section has at least one of the following structures (a) to (c). (a) a capped probe having a sequence complementary to some or all of the sequences of the untranslated region and having a cap structure hybridizes to the untranslated region; (b) a branch that branches from the midway of the main chain constituting the RNA is provided in a part of the untranslated region, and a cap structure is provided in the branch; (c) The 5'end of the main chain of the untranslated region has a branch structure divided into two or more branches, and each branch is provided with a cap structure.

Description

Technical Field

[0001] The present invention relates to a capped RNA having a cap structure and a method for producing the same, as well as a protein production device and a protein production method. Background Art

[0002] In eukaryotic mRNA, it is known that there is a 5' cap structure in which 7-methylguanylate is 5'-5' bound to the 5' end of RNA via a triphosphate bond. The cap structure is known to promote the translation of mRNA, and the cap structure can be artificially introduced into mRNA through a protein expression system to efficiently synthesize the target protein.

[0003] The inventors of the present invention have developed a method for producing capped RNA, which is RNA with a cap modification at the 5' end. In this production method, an activated capping compound is reacted with a monophosphate RNA with a monophosphorylated 5' end (for example, see Patent Document 1). By this method, a cap structure can be introduced at the 5' end of RNA by a chemical method. A conventional RNA having a cap structure at the 5' end of the RNA main chain is represented as Figure 1 (a).

[0004] On the other hand, the inventors of the present invention have developed a circular RNA encoding a protein, the total length of which is a multiple of 3 of 102 or more bases, has at least one start codon, does not have a stop codon (stop codon) in the same reading frame as the start codon, and does not contain an IRES (see, for example, Patent Document 2 and Non-Patent Document 1). This circular RNA does not have a cap structure, but can perform rolling circle protein translation with high efficiency.

[0005] As mentioned above, RNA exists in straight chain and circular RNA, and in the case of straight chain RNA, it is usually provided with a cap structure at the 5' end of the main chain, and circular RNA with a cap structure is not known in circular RNA. Generally speaking, in the case of straight chain RNA, it is known that by introducing a cap structure at the 5' end, a translation reaction is started from the start codon immediately thereafter. On the other hand, in circular mRNA without 5' end, a cap structure cannot be introduced, and therefore an IRES sequence is usually introduced in order to start a translation reaction. In addition, in the case of encoding 2 proteins in straight chain mRNA, it is also known that there is a method (for example, with reference to non-patent literature 2) for introducing an IRES sequence in order to start a translation reaction in the second translation region. In this document, IRES is inserted in eToehold, and eToehold is designed to be inactive until activated by interacting with the sense and antisense of specific trRNA.

[0006] Prior art literature

[0007] Patent Literature

[0008] Patent Document 1: International Publication No. 2021 / 172204 (Abstract, Claim 1, etc.)

[0009] Patent Document 2: International Publication No. 2013 / 118878 (Abstract, Claim 1, Paragraph 0004, etc.)

[0010] Non-patent literature

[0011] Non-patent document 1: "Successful synthesis of large amounts of proteins in human cultured cells - Achievement of an infinite rolling circle protein synthesis reaction using circular mRNA" (Successful synthesis of large amounts of proteins in human cultured cells - Achievement of an infinite rolling circle protein synthesis reaction using circular mRNA)", National Research and Development Agency, press release, November 10, 2015, Science and Technology Agency (JST), Nagoya University, RIKEN (co-published), <ULR: https: / / www.jst.go.jp / pr / announce / 20151110 / index.html#ZU1>

[0012] Non-patent document 2: “RNA-responsive elements for eukaryotic translational control”, Evan M. Zhao et al., Nature Biotechnology, October 28, 2021, <URL: https: / / doi.org / 10.1038 / s41587-021-01068-2> Summary of the invention

[0013] Technical problem to be solved by the invention

[0014] In a linear RNA such as that in Patent Document 1, a cap structure can be chemically introduced at the 5' end, but further improvement is required to enhance translation activity.

[0015] In addition, circular RNAs without a cap structure such as Patent Document 2 have a slow rate of binding of the translation initiation factor constituting the ribosome to the RNA, and there is still room for further improvement in translation activity.

[0016] The present invention aims to provide capped RNAs having various types of structures and high translational activity, which have never been available before, and methods for producing the same. Another object of the present invention is to provide a protein production apparatus and a protein production method capable of synthesizing proteins using such capped RNAs.

[0017] Technical solutions for solving technical problems

[0018] [1] A capped RNA, characterized in that:

[0019] The capped RNA comprises a translation region starting from a start codon and encoding a protein, and an upstream region on the upstream side of the start codon, wherein the capped RNA includes a branch having a cap structure in the upstream region.

[0020] [2] A capped RNA, characterized in that:

[0021] The branch portion has at least one of the following structures (a) to (c):

[0022] (a) a capping probe having a sequence complementary to a part or all of the sequence of the upstream region and having a cap structure hybridizes with the upstream region;

[0023] (b) a branched chain branching from the middle of the main chain constituting the RNA is provided in a part of the upstream region, and the cap structure is provided on the branched chain;

[0024] (c) The RNA is a linear RNA, and the 5' end of the main chain of the upstream region has a branched structure having two or more branches, and the cap structure is provided on each branch.

[0025] [3] The capped RNA according to [2] above, characterized in that:

[0026] In the above (a), the RNA is a circular RNA, and a capping probe having a sequence complementary to a part or all of the sequence of the upstream region of the circular RNA and having a cap structure hybridizes to the upstream region of the circular RNA.

[0027] [4] The capped RNA according to [2] above, characterized in that:

[0028] In the above (a), the RNA is a linear RNA, and the capping probe having a sequence complementary to a part or all of the sequence of the upstream region of the linear RNA and having a cap structure hybridizes with the upstream region of the linear RNA.

[0029] [5] The capped RNA according to [2] above, characterized in that:

[0030] In the above (b), the RNA is a circular RNA, a branched chain branching from a main chain constituting the RNA is provided in a part of the upstream region of the circular RNA, and the cap structure is provided on the branched chain.

[0031] [6] The capped RNA according to [2] above, characterized in that:

[0032] In the above (b), the RNA is a linear RNA, a branched chain branching from a main chain constituting the RNA is provided in a part of the upstream region of the linear RNA, and the cap structure is provided on the branched chain.

[0033] [7] The capped RNA according to [2] above, characterized in that:

[0034] In the above (b), it has a structure represented by the following formula (3).

[0035] [Chemistry 1]

[0036]

[0037] (Among them, m 7 G represents a cap, and p represents a phosphate group. Nuc represents a polynucleotide formed by linking one or more natural or non-natural nucleotides. m represents an integer from 1 to 5, and multiple m's may be the same or different. RNA1 and RNA2 represent RNAs constituting the main chain, RNA1 is linked to a portion of a branched structure at the 3' end, and RNA2 is linked to a portion of a branched structure at the 5' end. The RNA of formula (3) may be a circular RNA in which the 5' end of RNA1 is linked to the 3' end of RNA2 to form a circular structure, or may be a straight-chain RNA in which the 5' end of RNA1 is not linked to the 3' end of RNA2. )

[0038] [8] The capped RNA according to [2] above, characterized in that:

[0039] In the above (c), it has a structure represented by the following formula (1) or (2).

[0040] [Chemistry 2]

[0041]

[0042] [Chemistry 3]

[0043]

[0044] (Among them, m 7 G represents a cap, p represents a phosphate group, Gm represents a structure in which the 2'-hydroxyl group of the guanine nucleotide is methylated, m represents an integer from 1 to 5, and multiple m's may be the same or different from each other, and n represents an integer from 1 to 5, and multiple n's may be the same or different from each other.)

[0045] [9] The capped RNA according to [8] above, characterized in that:

[0046] The above formula (1) has a structure represented by the following formula (1-1), and the above formula (2) has a structure represented by the following formula (2-1).

[0047] [Chemistry 4]

[0048]

[0049] [Chemistry 5]

[0050]

[0051]

[10] The capped RNA according to [1] above, characterized in that:

[0052] The above RNA has multiple translation regions.

[0053]

[11] The method for producing capped RNA according to [1], characterized in that it comprises at least one of the following steps (a) to (c):

[0054] (a) hybridizing a capped probe having a sequence complementary to a part or all of the sequence of the upstream region and having a cap structure to the upstream region; or

[0055] (b) synthesizing the RNA having a branched chain branching from the main chain constituting the RNA in a part of the upstream region, and binding the cap structure to the branched chain;

[0056] (c) After synthesizing the RNA as a linear RNA and having a branched structure in which the 5' end of the main chain of the upstream region is divided into two or more branches, the cap structure is bound to each branch.

[0057]

[12] A protein production device, characterized in that it comprises: the capped RNA described in [1] above; and a eukaryotic cell expression system capable of expressing the protein encoded by the translation region using the capped RNA as a template.

[0058]

[13] A method for producing a protein, characterized in that: the capped RNA described in [1] above is added to an expression system of eukaryotic cells that can express the protein encoded by the translation region using the capped RNA as a template, thereby expressing the protein.

[0059]

[14] A detection device for a target RNA having a cap structure at the 5' end of the RNA, characterized in that it comprises:

[0060] A detection probe composed of a circular RNA, wherein the circular RNA has a translation region starting from a start codon and encoding a marker protein, and an upstream region on the upstream side of the start codon, wherein the upstream region has a sequence complementary to a part or all of a sequence of the target RNA to be detected;

[0061] adding the circular RNA to a sample containing the target RNA, allowing the target RNA to hybridize with the upstream region of the circular RNA to generate a capped RNA unit;

[0062] An expression system of eukaryotic cells capable of expressing the above-mentioned marker protein by adding the above-mentioned capped RNA; and

[0063] The unit of the above-mentioned marker protein expressed by the above-mentioned expression system is detected.

[0064]

[15] A method for detecting a target RNA having a cap structure at the 5' end of the RNA, comprising:

[0065] A step of preparing a detection probe composed of a circular RNA, wherein the circular RNA has a translation region starting from a start codon and encoding a marker protein, and an upstream region on the upstream side of the start codon, wherein the upstream region has a sequence complementary to a part or all of a sequence of the target RNA to be detected;

[0066] A step of adding the circular RNA to a sample containing the target RNA, and allowing the upstream region of the circular RNA to hybridize with the target RNA to generate capped RNA;

[0067] A step of adding the capped RNA to an expression system of eukaryotic cells capable of expressing the marker protein to express the marker protein; and

[0068] A step of detecting the marker protein expressed by the expression system.

[0069] [1(Pre)] A capped RNA, characterized in that:

[0070] This is a capped RNA having a cap structure in the non-translated region of RNA having a translation region starting from a start codon and encoding a protein and a non-translated region on the upstream side of the start codon,

[0071] The capped RNA has at least one of the following structures (a) to (c):

[0072] (a) a capping probe having a sequence complementary to a part or all of the sequence of the untranslated region and having a cap structure hybridizes with the untranslated region;

[0073] (b) a branched chain branching from the middle of the main chain constituting the RNA is provided in a part of the untranslated region, and the cap structure is provided on the branched chain;

[0074] (c) The 5' end of the main chain of the untranslated region has a branched structure divided into two or more branches, and the cap structure is provided on each branch.

[0075] [9(Pre)] A method for producing a capped RNA according to the capped RNA described in [1(Pre)], comprising:

[0076] At least one of the following steps (a) to (c):

[0077] (a) hybridizing a capping probe having a sequence complementary to a part or all of the sequence of the untranslated region and having a cap structure to the untranslated region; or

[0078] (b) after synthesizing the RNA in which a part of the untranslated region has a branched chain branching from the main chain constituting the RNA, binding the cap structure to the branched chain;

[0079] (c) After synthesizing RNA having a branched structure in which the 5' end of the main chain of the untranslated region is divided into two or more branches, the cap structure is bound to each branch.

[0080] [12(Pre)] A detection device for a target RNA having a cap structure at the 5' end of the RNA, comprising:

[0081] A probe composed of a circular RNA, wherein the circular RNA has a translation region starting from a start codon and encoding a marker protein, and an untranslated region upstream of the start codon, wherein the untranslated region has a sequence complementary to a part or all of a sequence of the target RNA to be detected;

[0082] adding the circular RNA to a sample containing the target RNA, allowing the target RNA to hybridize with the untranslated region of the circular RNA to generate a capped RNA unit;

[0083] An expression system of eukaryotic cells capable of expressing the above-mentioned marker protein by adding the above-mentioned capped RNA; and

[0084] A unit for detecting the above-mentioned marker protein expressed by the above-mentioned expression system.

[0085] [13(Pre)] A method for detecting a target RNA having a cap structure at the 5' end of the RNA, comprising:

[0086] A step of preparing a probe composed of a circular RNA, wherein the circular RNA has a translated region starting from a start codon and encoding a marker protein, and an untranslated region on the upstream side of the start codon, wherein the untranslated region has a sequence complementary to a part or all of a sequence of the target RNA to be detected;

[0087] A step of adding the circular RNA to a sample containing the target RNA, allowing the target RNA to hybridize with the untranslated region of the circular RNA to generate capped RNA;

[0088] A step of adding the capped RNA to an expression system of eukaryotic cells capable of expressing the marker protein to express the marker protein; and

[0089] A step of detecting the marker protein expressed by the expression system.

[0090] Effects of the Invention

[0091] According to the present invention, it is possible to provide capped RNAs having various types of structures and high translational activity, which have never been available before, and methods for producing the same. In addition, another object of the present invention is to provide a protein production apparatus and a protein production method that can synthesize proteins using such capped RNAs. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 This is a diagram showing the outline of the capped RNA (hybrid type) of the present invention.

[0093] Figure 2 This is a diagram showing the outline of the capped RNA (branched type) of the present invention.

[0094] Figure 3 This is a diagram showing the base sequences of circular RNA and capping probes used in the present experiment in Examples.

[0095] Figure 4 It is a diagram showing the sequences of the template DNA and the transcribed RNA in the Examples.

[0096] Figure 5 It is a figure which shows the result of the synthesis experiment of the capped probe in Example.

[0097] Figure 6 This is a diagram showing the results of the linear RNA synthesis experiment in the Examples.

[0098] Figure 7 This is a diagram showing the results of the linear RNA circularization experiment in the Examples.

[0099] Figure 8 This is a graph showing the results of relative evaluation of translation activity in Examples.

[0100] Fig. 9 This is a diagram showing the evaluation results of translation activity when various probes described in Examples were used.

[0101] Fig.10This is a diagram showing the evaluation results of the translation activity due to the presence or absence of the Poly A sequence in the Examples.

[0102] Fig.11 This is a graph showing the results of evaluating the translation activity by changing the ratio of the probe RNA in the Examples.

[0103] Fig.12 This is a schematic diagram showing the synthesis route of the RNA oligonucleotide containing a capped branch in the Examples.

[0104] Fig.13 It is a figure which shows the chemical capping reaction of the branched chain in Example.

[0105] Fig.14 It is a diagram showing the synthesis reaction of circular RNA in the Examples.

[0106] Fig.15 This is a diagram showing the evaluation of the translation activity of human-derived cultured cells (HeLa) containing capped branched circular mRNA in the Examples.

[0107] Fig.16 This is a diagram showing the structure of a 107-base-long RNA including a branched structure synthesized in the Examples.

[0108] Fig.17 This is a diagram showing the evaluation results of the translation activity of the 107-base-long protein containing a branch structure / multiple cap structures synthesized in the Example in HeLa cells.

[0109] Fig.18 This is a graph showing the results of HPLC analysis of RNA synthesized in Examples.

[0110] Fig.19 It is a graph showing the results of absorbance measurement of deprotected RNA and the results of electrophoresis of capped RNA in Examples.

[0111] Fig. 20 This is a graph showing the results of absorbance measurement of capped RNA in Examples.

[0112] Fig.21 It is a diagram showing the sequence of RNA after annealing in the Example.

[0113] Fig. 22 It is a diagram showing the structure of bicistronic mRNA in the Example and the results of evaluating the translation activity.

[0114] Fig.23 This is a diagram showing the overall structure of Multi uORF-mRNA and the sequence of the probe RNA in the Examples.

[0115] Fig.24It is a diagram showing the overall structure and sequence of Multi uORF-mRNA in the Examples.

[0116] Fig.25 This is a diagram showing the results of HPLC analysis of Multi uORF-mRNA in Examples.

[0117] Fig.26 This is a diagram showing the results of HPLC analysis of Multi uORF-mRNA in Examples.

[0118] Fig. 27 It is a photograph showing the denaturing PAGE of Multi uORF-mRNA in the Example and a graph showing the capping efficiency.

[0119] Fig.28 This is a diagram showing the evaluation results of the translation activity of Multi uORF-mRNA in the Examples.

[0120] Fig.29 It is a diagram showing the sequence of the plasmid fragment containing IRES in the Examples.

[0121] Fig.30 This is a diagram showing the evaluation results of the translation activities of capped circular RNA and IRES in the Examples.

[0122] Fig.31 This is a diagram showing experimental results showing that the translation activity of circular mRNA having a cap structure introduced into its branch chain is significantly improved compared to the translation activity of circular mRNA having no cap structure.

[0123] Fig.32 This is a diagram showing the results of an experiment showing the relationship between the branch length and translation activity of circular mRNA having a cap structure introduced into the branch (the branch length is variable).

[0124] Fig.33 This is a diagram showing experimental results showing that the translation activity of circular mRNA having a cap structure in its branched chain is higher than that of mRNA containing an IRES sequence derived from EMCV.

[0125] Fig.34 This is a diagram showing the results of synthesis of ATF4-Renilla mRNA by in vitro transcription.

[0126] Fig.35 This is a diagram showing the results of chemical synthesis of RNA.

[0127] Fig.36 It is a diagram showing the results of chemical capping of RNA.

[0128] Fig.37This is a diagram showing the results of synthesizing circular NanoLuc mRNA by in vitro transcription.

[0129] Fig.38 It is a diagram showing the results of the circularization reaction of circular NanoLuc mRNA.

[0130] Fig.39 It is a graph showing the results of csRNA against circular Nluc mRNA.

[0131] Fig.40 This is a diagram showing the results of chemical synthesis of RNA.

[0132] Fig.41 It is a diagram showing the results of chemical capping of RNA.

[0133] Fig.42 It is a diagram showing the results of chemical capping of RNA.

[0134] Fig.43 It is a diagram showing the sequence and secondary structure of ATF4-Renilla mRNA and ATF4-csRNA.

[0135] Fig.44 This is a diagram showing the translation response of ATF4-Renilla mRNA and ATF4-csRNA5 to 8 in HeLa cells.

[0136] Fig.45 The graph shows the experimental results of the translation reaction of chemically modified csRNA introduced into HeLa cell extract.

[0137] Fig.46 This is a diagram showing the results of the translation reaction of csRNA and circular mRNA modified with LNA in HeLa cells. DETAILED DESCRIPTION

[0138] The capped RNA of the present invention has a translation region that starts from a start codon (e.g., AUG) and encodes a protein, and an upstream region on the upstream side (5' end side) of the start codon. The upstream region can be a non-translated region (5'UTR) or in the reading frame of other open reading frames (ORFs). Moreover, the capped RNA includes a branch having a cap structure in the upstream region. Among them, the "branch having a cap structure" includes all forms of the cap structure branching from the RNA of the main chain. It includes, for example, forms in which molecules such as nucleic acids (DNA, RNA, etc.) having a cap structure hybridize with the RNA of the main chain, forms in which the nucleotides constituting the main chain are branched, and forms in which the nucleotides constituting the main chain are covalently bound to the nucleotides constituting the main chain. In addition, in the case of circular RNA, 3'UTR and polyA are also included in the upstream region, but the branch is preferably located in the 5'UTR or uORF close to the start codon.

[0139] Specifically, the capped RNA has at least one of the following structures (a) to (c).

[0140] (a) A capped probe having a sequence complementary to a part or all of the sequence of the upstream region and having a cap structure hybridizes with the upstream region (hereinafter referred to as "hybridization type").

[0141] (b) A structure in which a branched chain branching from the middle of the main chain constituting RNA is provided in a part of the upstream region, and a cap structure is provided on the branched chain (hereinafter referred to as "branched type").

[0142] (c) A structure in which the 5′ end of the main chain of the upstream region has a branched structure divided into two or more branches, and the cap structure is provided on each branch (hereinafter referred to as “multi-cap type”).

[0143] In addition, the capped RNA of the present invention includes not only natural RNA (i.e., a polynucleotide formed by linking nucleotides composed of ATP, GTP, CTP, and UTP), but also non-natural nucleic acid chains (modified nucleic acid chains) into which mC4 linkers, 2'OMe, LNA, etc. are introduced into RNA nucleotides. Each type of capped RNA is described below.

[0144] 1. Hybrid

[0145] Hereinafter, hybrid-type capped RNA will be described. Figure 1 (B) shows the structure of the hybrid capped RNA in the linear RNA as described in the Examples. Figure 1(C) shows a hybrid capping RNA in circular RNA with a structure described in the Examples. In any of linear RNA and circular RNA, the capping probe, which is RNA having a cap structure, hybridizes with an upstream region (e.g., untranslated region (5'UTR)) of RNA encoding a protein to be translated (hereinafter referred to as "coding RNA").

[0146] The coding RNA has a translation region (the region of "Nano Luc" in the figure) that starts from the start codon and encodes the protein, and an upstream region (e.g., a non-translated region (the region of "5'UTR") upstream (5' end side) of the start codon. In the present embodiment, there is a stop codon at the 3' end of the translation region, and sometimes there is a non-translated region (3'UTR) downstream (3' end side) of the stop codon. In addition, a Poly A sequence is included in the 3'UTR. The coding RNA is a straight-chain RNA in the case of a linear RNA, and a circular structure formed by linking the 5' end of the linear RNA to the 3' end in the case of a circular RNA. In addition, in the present embodiment, an embodiment in which the coding RNA includes a stop codon is represented, but it is not limited thereto, and for example, it may not have a stop codon as in patent document 2 or non-patent document 1. In the case that does not contain a stop codon, as disclosed in these prior arts, if a circular coding RNA with a total length base number set to a multiple of 3 of more than 102 is used as a circular RNA, the target protein can be generated with a high translation efficiency by rolling circle protein translation.

[0147] The coding RNA can be any one of only one translation region or more than two translation regions. When the translation region is more than two, there is an upstream region in the upstream of each translation region, and the capping probe can use a probe hybridized with any upstream region. In this case, the translation activity of the protein in the translation region starting from the start codon just below the upstream region is improved. In addition, the 5' end of the main chain of the coding RNA can also have a common cap structure. In the case of having a common cap structure at the 5' end, by using the cap structure of the capping probe, the translation efficiency of the capped RNA is further improved.

[0148] The capping probe is composed of an RNA that is shorter than the coding RNA chain and has a base sequence that is complementary to a portion or all of the 5'UTR sequence of the coding RNA. The position of the capping probe hybridization in the 5'UTR of the coding RNA is not particularly limited. In the case of a Kozak sequence, it is preferably on the upstream side. The length of the capping probe is not particularly limited, and is preferably about 10 to 50 bases (nt). In addition, the capping probe can be bound to a cap at the 5' end or at the 3' end. In addition, the capping probe can have a Poly A sequence on the 3' end side. The length (number of bases) of the Poly A sequence is not particularly limited, and is preferably about 10 to 50 bases. The capping probe can have a Locked Nucleic Acid (LNA) formed by cross-linking the 2' carbon and 4' carbon of ribose, a C4 linker, and the like.

[0149] In the capped RNA, the capped probe hybridizes with the 5'UTR of the coding RNA. Here, "hybridization" refers to hybridization under stringent conditions. The "stringent conditions" refer to conditions under which specific hybridization is formed and non-specific hybridization is basically not formed. In addition, as RNA that "hybridizes under stringent conditions", RNA having a certain degree of homology to a sequence that is completely complementary to a sequence within a specified range of the 5'UTR of the coding RNA can be listed. As the homology in this case, for example, in the BLAST algorithm, it is usually 60% or more, preferably 80% or more, more preferably 90% or more, particularly preferably 95% or more, and most preferably 100%.

[0150] Next, the method for producing hybrid capped RNA is described. The coding RNA constituting the capped RNA can be produced by using a DNA having a complementary sequence to the RNA of the target sequence and transcribing it with an RNA polymerase. Alternatively, the coding RNA can also be chemically synthesized using a DNA synthesizer or the like. Circular coding RNA can be produced by ligating the ends to each other and circularizing them using T4 RNA ligase 2 or the like after producing a linear coding RNA.

[0151] The probe RNA can be prepared by the following method. First, an RNA substrate without capping is prepared by RNA solid phase synthesis using phosphoramidite, phosphorylation reagent, 2'-OMe RNA phosphoramidite, LNA phosphoramidite, C4 linker phosphoramidite, CPG column, etc. Then, m 7 GDP, 2-nitroimidazole, etc. react with the RNA to cap the phosphorylated RNA. The details of this reaction can be found in Patent Document 1.

[0152] Capped RNA can be prepared by annealing the coding RNA and the probe RNA. From the perspective of translation activity, the ratio (molar ratio) of the coding RNA to the probe RNA during annealing is preferably in the range of 1:1 to 1:20, more preferably in the range of 1:5 to 1:15. The annealing temperature can be set to 80°C or more, preferably 90°C or more, and the reaction time can be set to 1 to 30 minutes, preferably about 3 to 10 minutes.

[0153] The hybrid capped RNA can add a cap structure at any position of the 5'UTR regardless of whether the coding RNA is linear or circular. In the case of RNA with a cap structure, the speed at which the translation initiation factor constituting the ribosome binds to the coding RNA is increased compared to RNA without a cap structure, and as a result, the translation activity is increased. Alternatively, in the case of hybrid capped RNA, in circular RNA or linear RNA, by presenting a cap using hybridization of a probe, translation can be enhanced or translation can be induced from any position.

[0154] Furthermore, in linear RNA, by using a capping probe, a translation reaction can be induced from a start codon that is not originally a reading frame for protein synthesis, for example, from position 2 and later. Thus, translation can be induced from any position of RNA by using a capping probe.

[0155] In addition, regarding circular RNA, it is not known that there is a circular RNA with a cap structure, but in the case of the hybrid capped RNA of the present invention, a cap structure can also be introduced into the circular RNA. Thus, the translation activity can be greatly improved compared to circular RNA without a cap structure.

[0156] 2. Branched chain

[0157] Next, branched capped RNA will be described. Figure 2 (a) shows the structure of branched capped RNA in linear RNA as described in the examples, Figure 2 (b) shows a branched capped RNA in circular RNA with a structure described in the Examples. In both linear RNA and circular RNA, the upstream region of the coding RNA has a branched chain branching from the main chain constituting the coding RNA, and a cap structure is provided on the branched chain.

[0158] The overall structure of the coding RNA is as described in the above-mentioned "1. hybrid type". In the branched type, a part of the 5'UTR of the coding RNA has a branched chain branching from the main chain, and a cap structure is provided at the 5' end of the branched chain. The 5' end of the main chain of the coding RNA is phosphorylated in the straight-chain RNA. In addition, the coding RNA can be any one of only one translation region or more than two translation regions. When the coding RNA is straight-chain, a common cap structure can be provided at the 5' end.

[0159] Examples of branched RNA include the following formula (3).

[0160] [Chemistry 6]

[0161]

[0162] (Among them, m 7 G represents a cap, and p represents a phosphate group. Nuc represents a polynucleotide formed by linking one or more natural or non-natural nucleotides. m represents an integer from 1 to 5, and multiple m's may be the same or different. RNA1 and RNA2 represent RNAs constituting the main chain, RNA1 is linked to a portion of a branched structure at the 3' end, and RNA2 is linked to a portion of a branched structure at the 5' end. The RNA of formula (3) may be a circular RNA in which the 5' end of RNA1 is linked to the 3' end of RNA2 to form a circular structure, or may be a straight-chain RNA in which the 5' end of RNA1 is not linked to the 3' end of RNA2. )

[0163] Next, a method for producing branched capped RNA is described. Coding RNA having a branch in the 5'UTR can be synthesized using a nucleic acid automatic synthesizer using a common phosphoramidite reagent used for RNA synthesis, a phosphoramidite reagent having a branch, and a chemical phosphorylation reagent. Examples of branched phosphoramidites include 1-[5-(4,4'-dimethoxytrityloxy)pentylamide]-3-[5-levulinyloxypentylamide]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite used in the examples described below. In addition, examples of chemical phosphorylation reagents include compound 1 (the following formula (3)) in the examples described below.

[0164] [Chemistry 7]

[0165]

[0166] Using a common phosphoramidite reagent and apparatus, the sequence encoding the 5'UTR of the RNA is synthesized from the upstream side. By using a phosphoramidite reagent having a branch at the position where the branch is to be introduced, the branch can be introduced at the desired position. The 5' end of the branch of the RNA encoding the hydrophobic protective group is introduced by a chemical phosphorylation reagent, so the hydrophobic protective group is decomposed by light irradiation, etc., and the 5' end of the branch is converted into a phosphate group. Then, 7-methylguanosine 5'-diphosphate imidazolium salt (Im-m 7 The 5' end of the branched chain is capped by adding a heteroaromatic compound such as GDP and 2-nitroimidazole. Finally, the 5' end of the main chain of the coding RNA is phosphorylated using T4 polynucleotide kinase or the like. Thus, a linear capped RNA is obtained. Circular coding RNA can be prepared by ligating the ends to each other using T4 RNA ligase 2 or the like after obtaining a linear capped RNA.

[0167] Branched capped RNA is similar to hybrid capped RNA, and no matter the coding RNA is linear or circular, a cap structure can be added to any position of the 5'UTR. In the case where the coding RNA has more than two translation regions, the translation activity of the translation region can be improved by introducing a branched cap into the 5'UTR upstream of the target translation region. Thus, for example, a translation reaction can be induced from a start codon that is not used as a reading frame for protein synthesis. In addition, in branched capped RNA, a cap structure can also be introduced into a circular RNA that did not have a cap structure in the past. Thus, compared with a circular RNA that does not have a cap structure, the translation activity can be greatly improved.

[0168] As shown in the Examples described below, circular capped RNAs have higher translation activity and tend to have lower immunogenicity than linear capped RNAs.

[0169] There is a tendency that the closer the position of the cap in the upstream region is to the start codon, the higher the translation activity. The position of the branch in the upstream region (i.e., the position of the structure between RNA1 and RNA2 in formula (3)) is not particularly limited. Since a cap structure is provided at the end of the branch, there is a tendency that the closer the position of the branch is to the start codon, the higher the translation activity. The position of the branch is preferably within the range of 1 to 50 nt on the 5' side, more preferably within the range of 1 to 30 nt, and particularly preferably within the range of 1 to 15 nt, based on the start codon.

[0170] In addition, the chain length of the branch part of the branch (i.e., the length of the polynucleotide of Nuc in formula (3)) is not particularly limited, but whether it is too long or too short, there is a tendency for the translation activity to decrease. Here, the chain length of the branch is defined as the distance from the branch site to the 5' cap. The chain length of the branch is preferably in the range of 1 to 20 nt, more preferably in the range of 3 to 10 nt, and particularly preferably in the range of 5 to 8 nt. If the chain length is too short, the distance between the position of the cap structure and the branch part becomes shorter, and the formation of the translation initiation factor complex or the binding of the ribosome is easily hindered due to the structure of the branch part. It can be considered that compared with ordinary RNA, the translation activity of branched RNA is lower.

[0171] 3. Multi-cap type

[0172] The polycapped capped RNA is described below. The polycapped capped RNA has a branched structure in which the 5' end of the 5' UTR of a linear coding RNA is divided into two or more branches, and a cap structure is provided on each branch.

[0173] Examples of polycapped capped RNA include a two-branched structure represented by the following formula (1) or a three-branched structure represented by the following formula (2).

[0174]

[0175] [Chemistry 9]

[0176]

[0177] (Among them, m 7 G represents a cap, p represents a phosphate group, Gm represents a structure in which the 2'-hydroxyl group of the guanine nucleotide is methylated, m represents an integer from 1 to 5, and multiple m's may be the same or different from each other, and n represents an integer from 1 to 5, and multiple n's may be the same or different from each other.)

[0178] In this case, it is preferred that the above formula (1) has a structure represented by the following formula (1-1), and the above formula (2) has a structure represented by the following formula (2-1).

[0179] [Chemistry 10]

[0180]

[0181] [Chemistry 11]

[0182]

[0183] Next, a method for producing a polycapped capped RNA is described. RNA before capping can be synthesized using a common phosphoramidite reagent used in RNA synthesis, a branched phosphoramidite reagent, and a chemical phosphorylation reagent using a nucleic acid automatic synthesizer. Examples of branched phosphoramidites include 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamide]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (2-branched type) and tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (3-branched type) used in the examples described later. In addition, as a chemical phosphorylation reagent, compound 1 (Formula (3)) in the examples described later can be cited.

[0184] By using a phosphoramidite reagent with a branched chain, a branched structure is formed at the 5' end. The sequence of the 5'UTR of the coding RNA is synthesized from the upstream side using a common phosphoramidite reagent and apparatus, thereby synthesizing a coding RNA with multiple branches at the 5' end. The 5' end of each branch of the coding RNA is preliminarily introduced with a hydrophobic protective group by a chemical phosphorylation reagent, and the hydrophobic protective group is decomposed by light irradiation, etc., and the 5' end of the branch is converted into a phosphate group. Then, 7-methylguanosine 5'-diphosphate imidazolium salt (Im-m 7 A cap is added to the 5' end of each branch of the branched structure by using a heteroaromatic compound such as GDP or 2-nitroimidazole. Thus, a linear capped RNA is obtained in which a cap is bound to each branch.

[0185] Since polycapped capped RNA has multiple caps at the 5' end of the main chain, the translation initiation factor constituting the ribosome is more likely to bind to the cap than a normal capped RNA having a single cap, and the translation activity can be significantly enhanced due to the multi-ligand effect.

[0186] 4. Protein production device and production method

[0187] The protein manufacturing device of the present invention has the above-mentioned capped RNA and an expression system of eukaryotic cells that can express the protein encoded by the translation region using the capped RNA as a template. In the method for manufacturing the protein of the present invention, the capped RNA is added to the expression system of the eukaryotic cell to express the protein. As eukaryotic cells, fungi such as yeast or filamentous fungi, plant cells, insect cells, animal cells such as humans, etc. can be listed. Specifically, examples such as mouse L-cells, Ehrlich ascites carcinoma cells, HeLa cells, CHO cells, budding yeast, etc. can be exemplified. The expression system of eukaryotic cells can be any system of a cell expression system or a cell-free expression system. The introduction of capped RNA into the cell expression system can be carried out by methods such as calcium phosphate method, DEAE dextran method, liposome transfection method, electroporation method, etc. In the cell expression system, after the capped RNA is introduced into the cell, the cell is cultured under conditions such as appropriate temperature, the cell is lysed after culture, and then the target protein is separated and purified. In the cell-free expression system, the lysate of eukaryotic cells can be used.

[0188] 5. Target RNA detection device and detection method

[0189] As described above, since circular RNA does not have a cap structure, it is not translated alone, but by hybridizing with RNA having a cap structure, the protein encoded by the circular RNA can be translated. This property can be used to detect the target RNA using circular RNA as a detection probe. As the target RNA, RNA from eukaryotic organisms or viruses can be cited. Below, the detection device and detection method of the target RNA of the present invention are described.

[0190] The target RNA detection device of the present invention is a device for detecting a target RNA having a cap structure at the 5' end of the RNA. The detection device comprises: a detection probe composed of circular RNA, a unit for generating capped RNA, an expression system of eukaryotic cells, and a unit for detecting a marker protein.

[0191] The detection probe has the translation region and the upstream region of the upstream side of the start codon that start and encode the marker protein.The upstream region has a sequence that is complementary to a part or all of the sequence of the target RNA as the detection object.As marker protein, the enzyme-labeled protein of the fluorescent marker protein, horseradish peroxidase (HRP) or alkaline phosphatase (AP) etc. of the luciferase or green fluorescent protein (GFP) etc. used in the aftermentioned embodiment can be enumerated.

[0192] The unit for generating capped RNA is a unit for hybridizing the above-mentioned detection probe (circular RNA) with the target RNA. At this time, a common reagent or device for annealing RNA can be used. As such a reagent, a buffer such as Tri-HCl can be listed. In addition, as a device, a heating block or a thermal cycler that heats the reagent to above 80°C and then cools it to room temperature can be listed.

[0193] The eukaryotic cell expression system is a system capable of expressing the marker protein encoded by the translation region using the capped RNA generated as a template, and examples thereof include the above-mentioned HeLa cells.

[0194] As a unit for detecting the labeled protein, various devices can be used depending on the type of the labeled protein. As such a unit, when the labeled protein is a fluorescent labeled protein, a fluorescence measuring device can be listed, and when the labeled protein is an enzyme labeled protein, a luminescent substrate, a fluorescence measuring device, etc. can be listed.

[0195] The target RNA detection method of the present invention can be implemented using the above-mentioned detection device. First, a detection probe containing the above-mentioned circular RNA is prepared and added to a sample containing the target RNA to generate capped RNA. Next, the capped RNA is added to the expression system of eukaryotic cells capable of expressing the marker protein to express the marker protein, and then the expressed marker protein is detected. By such a method, the target RNA can be effectively detected.

[0196] Example

[0197] Hereinafter, the present invention will be specifically described based on Examples, but the purpose of the present invention is not limited thereto. In the following Examples, "%" refers to the mass basis (mass percentage) unless otherwise specified.

[0198] 1. Capped RNA (hybrid type)

[0199] The following is an experiment related to hybrid capped RNA. Figure 3 It is a diagram showing the base sequences of the circular RNA and capping probe used in this experiment. The diagram on the upper left side of the figure shows the structure of the capped RNA. As a circular RNA (coding RNA), the upstream region on the 5' side (the untranslated region (denoted as "5'UTR") in the figure) has a Kozak sequence (denoted as "Kozak") on its downstream side, a region encoding Nano Luc luciferase ("Nano Luc"), a stop codon ("stop"), a 3' untranslated region ("3'UTR"), a polyA sequence ("polyA 30 ”). In addition, the capped probe in the figure has a cap structure at the 5' end (m 7G), has a sequence complementary to a part of the 5'UTR of the circular RNA, and has polyA30 at the 3' end. In addition, in the capped RNA, the capping probe hybridizes with the 5'UTR of the circular RNA.

[0200] The upper right side of the figure shows the sequence of the capping probe used in this example. Three types of capping probes are used, namely, "5' cap probe" having a cap structure at the 5' end, "3' cap probe" having a cap structure at the 3' end, and "5' cap probe with polyA" having a cap structure at the 5' end and Poly A at the 3' end. The lower part of the figure shows the sequence of circular RNA. The bold area shown by "ggcg...cgc" is the part where the capping probe hybridizes.

[0201] (1) Probe RNA synthesis

[0202] RNA synthesis was performed at a 0.2 μmol scale using NTS M-2-MX DNA / RNA synthesizer or NRs-4A10R7 DNA / RNA synthesizer from Japan Techno Service Co., Ltd. The phosphoramidites used in RNA solid phase synthesis were rA (5'-DMT-2'-TOM-ribo-Adenosine (n-acetyl) OP), rC (5'-DMT-2'-TOM-ribo-Cytidine (n-acetyl) OP), rG (5'-DMT-2'-TOM-ribo-Guanosine (n-acetyl) OP), and U (5'-DMT-2'-TOM-ribo-Uridine OP) (ChemGenes). The phosphorylation reagent used was 5'phosphate-ON Reagent (ChemGenes). 2'-OMe RNA phosphoramidites used were 2'-OMe-C-CE-phosphoramidite and 2'-OMe-G(iBu)-CE-phosphoramidite (ChemGenes). LNA phosphoramidites used were MBN-Ganosine(N,N-DMF)-phosphoramidite (ChemGenes) and MBN-5'-Methyl-Cytidine(N-bz)-phosphoramidite (ChemGenes). C4 linker phosphoramidites used were synthesized according to a previous report (Angew. Chem. Int. Ed. 2011, 50, 8922-8926). CPG used was 3'-TOM-riboCytidine(n-acetyl)2'-lcaa CPG 3'-TOM-ribo Adenosine(n-acetyl)2'-lcaa CPG (ChemGenes), 3'-phosphate ON lcaa CPG 1000A.

[0203] After RNA synthesis, CPG was transferred to a 1.5 mL Sarstedt tube, 1.0 mL of 40% methylamine aqueous solution (aq.methylamine) / 28% ammonia aqueous solution (aq.ammonia) (1:1) was added, and incubated at 65°C for 20 minutes. Filtered using a Millex LH 0.45 μm filter, washed with sterile water (500 μL), and dried and solidified using a centrifugal evaporator. 1.0 mL of 1M TBAF THF solution was added to dissolve it and allowed to stand at room temperature overnight. 1.0 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. Desalting was performed using a NAP-25 column (GE Healthcare). RNA was purified by reverse phase HPLC.

[0204] HPLC (HITACHI) conditions; chromatographic column: hydrosphere C18 column (4.6x250mm; YMC); mobile phase: A) 50mM TEAA buffer (pH7.0), 5% acetonitrile; B) acetonitrile, gradient: 0-20min B concentration 0% to 20%, flow rate: 1.0mL / min

[0205] The synthesized RNA was analyzed by 15% denaturing polyacrylamide gel electrophoresis (PAGE) (acrylamide: bisacrylamide = 19: 1 (wt / wt), 7.5 M urea). PAGE used TBE buffer (89 mM Tris-borate, 2 mM EDTA, pH 8.3). Analyzed by LC / MS. LC / MS (agilent) conditions; ACQUITY UPLC BEH C18 column, 0.3 mL / min, A; 8.6 mM TEA / 100 mM HFIP solution, B; MeOH, 0-30% / 20 min

[0206] The information such as the sequence and molecular weight of the synthesized RNA is shown in the following table (RNAs 1 to 12 correspond to sequence numbers 1 to 12, respectively).

[0207] [Table 1]

[0208]

[0209] C4; C4 linker, m_; 2′OMe, underline; LNA

[0210] (2) Phosphorylated RNA capping reaction

[0211] In a 1.5 mL tube, add RNA at a final concentration of 20 μM, CaCl at 10 mM, and 2 The mixture was mixed, dried and solidified by freeze drying, and then dissolved in DMSO. Im (m 7 GDP)·Na (Hongene Biotech) was added at a final concentration of 10 mM, and 2-nitroimidazole was added at a final concentration of 10 mM. The reaction solution was incubated at 55°C for 3 hours. The reaction solution was diluted 2 times with sterile water and precipitated with isopropanol. HPLC purification was performed and analyzed by LC / MS.

[0212] HPLC conditions; chromatographic column: hydrosphere C18 column (4.6x250mm; YMC); mobile phase: A) 50mM TEAA buffer (pH7.0), 5% acetonitrile; B) acetonitrile; gradient: 0-20min B concentration 0% to 20%; flow rate: 1.0mL / min

[0213] LC / MS (agilent) conditions: ACQUITY UPLC BEH C18 column, 0.3 mL / min, A: 8.6 mM TEA / 100 mM HFIP solution, B: MeOH, 0-30% / 20 min

[0214] HPLC-purified capped RNA was precipitated using isopropanol and sodium acetate (pH 5.2).

[0215] The information such as the sequence and molecular weight of the synthesized capped RNA is shown in the following table (capped RNAs 1 to 12 correspond to SEQ ID NOs. 13 to 24, respectively).

[0216] [Table 2]

[0217]

[0218] C4; C4 linker, m_; 2′OMe, underline; LNA

[0219] Figure 5 The figure shows the results of the capping probe synthesis experiment. Figure (A) shows the synthesis route of the capping probe. Chemically synthesized monophosphorylated RNA was freeze-dried with calcium chloride. Im (m 7GDP)·Na (chemical capping reagent) and 2-nitroimidazole were reacted in DMSO solution. Figure (B) shows the result of capping probe, and the RNA of capping reaction was analyzed by PAGE and stained with SYBR Green II. During the capping reaction, due to the addition of methylguanine, the band shifted upward by an amount equivalent to one base. According to the results of PAGE analysis, the capping reaction was carried out with an efficiency of 80% to 90%.

[0220] (3) Synthesis of linear RNA through transcription reaction

[0221] Linear RNA is transcribed and synthesized using T7 RNA polymerase using double-stranded DNA as a template. Figure 4 The upper part of the figure shows the sequence of the template DNA used for transcription synthesis of RNA (sequence number 32), and the lower part shows the sequence of the transcribed RNA (sequence number 31). The double-stranded DNA of the template was obtained by amplifying pNL-TK1.1 (Promega) by PCR reaction using PrimeSTAR HSDNA polymerase (Takara Bio) (2.5 ng / μL DNA vector, 1× PrimeSTAR buffer, 0.2 mM dNTPs, 0.5 μM primers, 0.025 units / μL polymerase).

[0222] Prepare the transcription reaction solution (template DNA 2.5 ng / μL, 1× T7 RNA polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2 , 2mM spermidine), 2.5U / μL T7 RNA polymerase (Takara), 5mM DTT, 2mM ATP, 2mM UTP, 2mM, CTP, 0.4mM GTP, 2mM GMP), and incubated at 37°C for 2 hours. Recombinant DNase (Takara) was added to the reaction solution to make 0.1U / μL, and incubated at 37°C for 30 minutes to degrade the template DNA.

[0223] After the reaction, phenol-chloroform extraction was performed, followed by ultrafiltration using Amicon Ultra 10K (Millipore) and ethanol precipitation.

[0224] Figure 6The figure shows the results of the linear RNA synthesis experiment. Figure A) shows the results of the synthesis of double-stranded DNA that becomes the linear RNA template through PCR reaction, and after the PCR reaction, it is analyzed by agarose gel and the photo of the gel after staining with Gel Red. Figure B) shows the results of the transcription synthesis of the linear RNA, and after the transcription reaction, it is analyzed by PAGE and the photo of the gel after staining with SYBR Green.

[0225] (4) Circularization reaction using T4 RNA ligase2

[0226] The transcribed linear RNA was circularized using T4 RNA ligase 2 (New England Biolabs) and 20-nt DNA (guide DNA). 0.5 μM linear RNA and 1.0 μM guide DNA were mixed in T4 RNA ligase 2 buffer (50 mM Tris-HCl (pH 7.5), 2 mM MgCl 2 After annealing in 1% 10% 4% dTT and 0.4% ATP, 0.1 U / μL T4 RNA ligase 2 and 10% PEG8000 were added and incubated at 37°C for 1 hour. The circular RNA of the ligation product and the linear RNA of the starting material were separated by 5% denaturing PAGE.

[0227] (5) Confirmation of cyclization using RNase R

[0228] RNA (0.18 μg / μL) was dissolved in RNase R (1 unit / μL; Epicenter) and 20 mM Tris-HCl (pH 8.0) 0.1 M KCl, 0.1 mM MgCl 2 The reaction mixture was incubated at 37°C for 10 minutes and analyzed by 5% denaturing PAGE.

[0229] Figure 7 It is a diagram showing the results of a linear RNA cyclization experiment. Figure A) shows the synthesis route of circular RNA. The linear RNA synthesized by transcription is annealed with the guide DNA, and circular RNA is synthesized using T4 RNA ligase 2. Figure B) shows the confirmation result of the cyclized body, and RNase R is added to the RNA obtained by the cyclization reaction and incubated. PAGE is used for analysis and SYBR GreenII is used for staining. The linear RNA synthesized by transcription is cyclized using 4 RNA ligase 2. The identification of the cyclized body is carried out by allowing the linear RNA to act on a selectively decomposing enzyme (RNase R) and using PAGE analysis. The efficiency of cyclization is about 60%. The cyclized body and the linear RNA of the raw material are cut out from the gel and separated and purified.

[0230] (6) Annealing

[0231] 0.2 μM capped probe and 0.1 μM linear or 0.1 μM circular RNA were annealed (90° C., 3 minutes) in a buffer (10 mM Tris-HCl (pH 7.5), 50 mM NaCl).

[0232] (7) Evaluation of translation activity in cells

[0233] HeLa cells (RIKEN Cell Bank) were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) (37°C, 5% CO 2 One day before transfection, HeLa cells were seeded in 96-well plates (1.0×10 4 cell / well). The next day, the culture medium was removed and replaced with 100 μL / well Opti-MEM (registered trademark) (Thermo Fisher SCIENTIFIC). 0.15 μL Lipofectamine (registered trademark) MessengerMAX (registered trademark) and 20 ng mRNA were diluted with 10 μL Opti-MEM (registered trademark) and introduced into the cells. After incubation at 37°C for 5 hours, 20 μL / well 1× cell lysis buffer (CellLysis Buffer, Promega) was added to lyse the cells. Luminescence was measured using Nano-Glo (registered trademark) luciferase assay (registered trademark) (Promega).

[0234] Figure 8 It is a figure showing the results of relative evaluation of translation activity. Figure A) shows the results of translation activity of linear RNA, and Figure B) shows the results of translation activity of circular RNA. "Capped RNA8" was used as a capped RNA probe, and "RNA8" was used as an uncapped RNA probe. The translation activity of the sample without hybridization of the RNA probe was relatively evaluated as "1". In the case of any RNA, the capped RNA was annealed and transfected into HeLa cells. After 5 hours, the cells were lysed and the luminescence of nanoluciferase was measured. From these results, it can be seen that if both linear RNA and circular RNA are hybridized with capped RNA, an effect of promoting translation activity by about 40 times can be observed compared with the case of RNA monomers. No effect of promoting translation activity was observed for mRNA hybridized with phosphorylated RNA without added cap structure. This shows that the translation start stage is promoted in a cap-dependent manner.

[0235] Fig. 9 It is a graph showing the evaluation results of translation activity when various probes are used. Figure A) shows the results of translation activity of linear RNA, and Figure B) shows the results of translation activity of circular RNA. In any RNA, the capped RNA was annealed and transfected into HeLa cells. After 5 hours, the cells were lysed and the luminescence of nanoluciferase was measured. From these results, it can be seen that if both linear RNA and circular RNA hybridize with capped RNA, the translation activity is promoted (capped RNA1-4, 6-12). In the capped RNA with a sequence that is not complementary to mRNA, no translation promotion effect was observed (capped RNA5), indicating that the capped RNA hybridizes with mRNA to promote translation. In addition, when the C4 linker and Poly A sequence are introduced into the cap structure, the promotion effect is increased (capped RNA8-10).

[0236] Fig.10 It is a diagram showing the evaluation results of translation activity when there is or is not a Poly A sequence. The upper section (Linear, straight chain) in the figure represents the results of using linear RNA, and the lower section (Circular, ring) represents the results of using circular RNA. "cap probe" represents the result of annealing the cap probe, and "p probe" represents the result of annealing the probe of the phosphate end without capping. It can be seen from these charts that in any case of linear RNA and circular RNA, by annealing the cap probe, the translation activity is improved compared with the case without capping. It can also be seen that when Poly A is added, the translation activity is slightly improved compared with the case without adding Poly A.

[0237] The evaluation of translation activity in cells was performed in the same manner as in the above-mentioned "(6) Evaluation of translation activity in cells", except that the concentration of the capping probe was set to two types (0.2 μM and 1 μM). The results are shown in Fig.11 . Fig.11 This is a graph showing the results of evaluating translation activity by changing the ratio of probe RNA. It can be seen from this graph that the translation activity is higher when the ratio of mRNA:probe=1:10 than when the ratio of mRNA:probe=1:2.

[0238] 2. Capped circular RNA (branched type)

[0239] (1) Chemical synthesis, purification, and chemical capping of RNA

[0240] Fig.12 : is a schematic diagram showing a synthetic route of an RNA oligonucleotide containing a capped branch. Next, based on this synthetic route, an RNA oligonucleotide containing a capped branch was synthesized.

[0241] (a) RNA chemical synthesis

[0242] Oligoribonucleotides having a main chain of 54 bases and containing a branched chain phosphorylated at the 5' end were synthesized using compound 1 (formula (3) above: refer to Japanese Patent Application No. 2021-111420), commercially available phosphoramidite reagents [phosphoramidites for RNA synthesis used products from ChemGenes (ANP-3201, ANP-3202, ANP-3203, ANP-3205), and Asymmetric Doubler (Lev) Phosphoramidite (10-1981) purchased from Glen Research for branch introduction] and a solid support (3'-TOM-ribo Uridine CPG 1000A, ChemGenes) according to conventional methods using a nucleic acid automatic synthesizer (NR-2A7MX, Japan Techno Service). In order to synthesize circular RNA without branches, a 54-base-long RNA sequence consisting only of a main chain was synthesized, and its 5' end was phosphorylated using compound 1.

[0243] After RNA synthesis is completed, add 1 mL of an equal mixture of 40% methylamine aqueous solution and concentrated ammonia water to the solid phase carrier and heat at 65°C for 20 minutes. After filtering the supernatant with a Millex LH filter (0.45 μm, Merck), dry it under reduced pressure using a centrifugal evaporator. Then add 1 M tetrabutylammonium fluoride / THF solution to the residue and incubate it overnight at room temperature. After desalting using a NAP-25 gel filtration column (Merck), the RNA contained in the eluate is recovered by ethanol precipitation. It was redissolved in ultrapure water, and the target product was separated and purified by reverse phase HPLC [system: Hitachi Chromaster (pump 5110, etc., Hitachi High-Tech); chromatographic column: YMC Triart Bio C4 (250 mm×10 mm ID, YMC); solvent A (Solvent A): 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B (Solvent B): acetonitrile; linear gradient 0-20% solvent B (0-20 minutes); flow rate: 3 mL / minute; detection wavelength: 260 nm; column temperature: 50°C].

[0244] The protective group on the phosphate group of the obtained target was removed by irradiation with 365-nm light. The light irradiation was performed using a MAX-305 light source device (Asahi Spectroscopy). RNA solution (74 μM RNA, 1 mM Tris-HCl (pH 7.5), 0.1 mM EDTA) was added to each well of a transparent 96-well multiwell plate at 50 μL per well and the irradiation was performed at 4 mW / cm 2The RNA was irradiated with 365 nm light for 10 minutes at an amount of light. After irradiation, the RNA was recovered and separated and purified by ethanol precipitation. The RNA before and after phosphate deprotection was analyzed by LC / MS system (Agilent), and the target product was confirmed [theoretical molecular weight of phosphate protected body 20,110.4; observed value 20,114.1 (+3.7): theoretical molecular weight of phosphate deprotected body 19,919.2; observed value 19,921.7 (+2.5)].

[0245] (b) Capping reaction to the 5' end of the branched chain

[0246] 7-methylguanosine 5'-diphosphoimidazole sodium salt (Im-m 7 GDP) reacts with the phosphate group at the 5' end of the branch to obtain a capped body (refer to Japanese Patent Application No. 2021-111420). Add 5μL of 200mM calcium chloride aqueous solution to 2nmol (26μL) of the raw RNA containing a phosphate group at the 5' end of the branch, freeze it with liquid nitrogen, and then freeze-dry it. After 3 hours, add 45μL of dimethyl sulfoxide (DMSO) to the mixture of dried and solidified RNA and calcium chloride to dissolve it, and add 50μL of Im-m 7 GDP / DMSO solution and 5 μL of 200 mM 2-nitroimidazole / DMSO solution were heated at 55°C for 3 hours. 122 μL of 0.541 M sodium acetate (pH 5.2) aqueous solution was added, and a portion was taken to evaluate the efficiency of the capping reaction. 5 pmol of the raw material and the RNA after the reaction were analyzed by 10% denaturing PAGE containing 7.5 M urea as a denaturant to confirm the band shift of the capped body.

[0247] Fig.13 It is a diagram showing a chemical capping reaction of a branched chain. Figure (a) shows a schematic diagram of the reaction (sequence number 33). Figure (b) shows the analysis results of RNA before and after the reaction by 10% denaturing PAGE (containing 7.5M urea as a denaturant). The raw RNA before the capping reaction and the same molar amount of RNA from the reaction solution (5pmol) were analyzed. The gel after electrophoresis was stained with the nucleic acid staining reagent SYBR Green II to visualize the bands. The product of the capping reaction was observed at a higher electrophoresis position than the raw material, and the reaction yield calculated from the band intensity ratio was 78%.

[0248] 220 μL of 2-propanol was added to the solution after adding the sodium acetate aqueous solution, cooled at -30°C overnight, and centrifuged (20,000 g, 25 minutes) to obtain a pellet. The pellet was redissolved in ultrapure water, and the target product was separated and purified by reverse phase HPLC [system: Hitachi LaChrom Elite (pump L-2130, etc., Hitachi High-Technologies); column: YMC Hydrosphere C18 (250 mm × 4.6 mm ID, YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B: acetonitrile; linear gradient 0-20% solvent B (0-20 minutes); flow rate: 1 mL / min; detection wavelength: 260 nm; column temperature: 50°C].

[0249] The target product was recovered from the eluate by ethanol precipitation to obtain 1.185 nmol of capped RNA (isolation yield 59%). The capped RNA was analyzed by LC / MS system (Agilent) to confirm the presence of the target product [theoretical molecular weight 20,360.4; observed value 20,361.2 (+0.8)].

[0250] (c) Phosphorylation of the 5' end of the backbone using T4 polynucleotide kinase

[0251] The 5' end of the main chain was enzymatically phosphorylated under the same conditions for two types of RNA, one with a cap structure added to the phosphate group of the side chain and one without a cap structure added. The composition of the phosphorylation reaction is shown below: 8μM RNA, 1mM ATP, 50mM Tris-HCl (pH8.0), 10mM magnesium chloride, 5mM dithiothreitol, 0.2U / μL T4 polynucleotide kinase (TakaraBio).

[0252] After incubating 50 μL of the reaction solution at 37°C for 1 hour, the protein was removed using a mixture of equal amounts of TE-saturated phenol and chloroform, and RNA was recovered by ethanol precipitation. The phosphorylated RNA was analyzed by LC / MS system (Agilent), and the target product was confirmed to be obtained [theoretical molecular weight of uncapped RNA 19,993.3; observed value 20,002.3 (+9.0): theoretical molecular weight of capped RNA 20,434.4; observed value 20,441.4 (+7.0)].

[0253] (2) Synthesis of transcribed RNA

[0254] The commercially available plasmid DNA pNL1.1.TK (Promega) containing the coding sequence of NanoLuc luciferase was used as a template and two synthetic oligo DNAs (5'-CCCGGATCCTAATACGACTCACTATAGGTCTTCACACTCGAAGATT

[0255] The PCR reaction product obtained by using primers TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGAATTACGCCAGAAT GCG-3' (SEQ ID NO: 26)) was used as a transcription template. The composition of the PCR solution is as follows: 1 ng / μL pNL1.1.TK, 0.3 μM primer, 0.2 mM dNTPs, 1.5 mM MgSO 4 , 1× PCR buffer for KOD-Plus-Neo, 0.02U / μL KOD-Plus-Neo (Toyobo). Using T100 thermal cycler (Bio-Rad), the reaction solution was placed under the following thermal cycling conditions: 94°C, 2 minutes → [98°C, 10 seconds → 55°C, 30 seconds → 72°C, 70 seconds] × 25 cycles.

[0257] The reaction solutions (50 μL × 8) were combined, and 0.4 mL of a mixture of equal amounts of TE-saturated phenol and chloroform was added thereto, mixed vigorously, and centrifuged (20,000 × g, 1 minute) to separate the aqueous layer. Further, 0.4 mL of chloroform was added, mixed vigorously, and centrifuged (20,000 × g, 1 minute) to separate the aqueous layer. 40 μL of a 3M sodium acetate aqueous solution (pH 5.2) and 440 μL of 2-propanol were added thereto, and after cooling at -30°C overnight, the mixture was centrifuged (20,000 × g, 20 minutes) to obtain the target DNA as a precipitate. The precipitate was redissolved in 200 μL of ultrapure water, and the absorbance of the solution at 260 nm (A) was measured using a NanoDrop 2000 spectrometer. 260 ), calculate the DNA concentration of the solution (A 260 5.632; DNA concentration 281.6 ng / μL).

[0258] Using the DNA obtained above as a template, T7 RNA polymerase was used to prepare a 550-base RNA transcript with a phosphorylated 5' end. The composition of the reaction solution is as follows: 15 ng / μL template DNA, 2 mM ATP, 2 mM UTP, 2 mM CTP, 0.5 mM GTP, 2 mM GMP, 40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2, 2mM spermidine, 5mM DTT, 0.001U / μL pyrophosphatase (New England Biolabs, M2403), 2.34ng / μL T7 RNA polymerase. After incubating 1mL of the reaction solution at 37°C for 2 hours, 10μL of DNase I (5U / μL, Takara Bio) was added and incubated at 37°C for 20 minutes.

[0259] The reaction solution was extracted with an equal amount of a saturated phenol:chloroform mixture and chloroform to remove proteins, and then 100 μL of a 3M sodium acetate aqueous solution (pH 5.2) and 1.1 mL of 2-propanol were added to the aqueous layer and centrifuged to obtain a crude RNA product as a precipitate. In order to remove nucleotides and the like contained in the obtained crude RNA product, the RNA was further separated and purified by reverse phase HPLC [system: Hitachi LaChrom Elite (pump L-2130, etc., Hitachi High-Technologies); column: YMC Hydrosphere C18 (250 mm×4.6 mm ID, YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B: acetonitrile; linear gradient 5-15% solvent B (0-20 minutes); flow rate: 1 mL / min; detection wavelength: 260 nm; column temperature: 50°C], and finally 420 μg of RNA transcripts were obtained.

[0260] (3) Circular RNA synthesis (ligation and separation)

[0261] A chemically synthesized RNA fragment having a main chain of 54 bases and a transcribed synthetic RNA of 550 bases were annealed in the presence of two template DNAs, and linked and circularized using the enzyme T4 RNA ligase 2. The sequences of the two template DNAs consisting of 30 bases were as follows.

[0262] Splint_1, 5'-ACCTTAATATGCGCCTTTTTTTTTTTTTTT-3' (SEQ ID NO: 27); Splint_2, 5'-TCGAGTGTGAAGACCATGGTGGCTTTACCC-3' (SEQ ID NO: 28).

[0263] The composition of the enzyme reaction solution is shown below.

[0264] 1μM chemically synthesized RNA, 0.5μM transcribed synthetic RNA, 2μM Splint DNA_1, 2μM Splint DNA_2, 20(w / v)% PEG6000, 0.05μg / μL T4 RNA ligase 2.

[0265] Before adding PEG6000 and T4 RNA ligase 2 at a stock concentration of 60 (w / v)%, the mixture was heated at 90°C for 3 minutes and slowly cooled to room temperature over about 20 minutes. Then, PEG6000 and ligase were added to the final concentrations shown above, and the mixture was incubated at 37°C for 1 hour. 0.4 mL of a mixture of equal amounts of TE-saturated phenol and chloroform was added to 320 μL of the reaction solution, mixed vigorously, and centrifuged (20,000 × g, 1 minute) to separate the aqueous layer. 0.4 mL of chloroform was further added, mixed vigorously, and centrifuged (20,000 × g, 1 minute) to separate the aqueous layer. 40 μL of a 3M sodium acetate aqueous solution (pH 5.2) and 440 μL of 2-propanol were added thereto, and after cooling at -30°C overnight, centrifuged (20,000 × g, 20 minutes).

[0266] The obtained precipitate was dissolved in 10 μL of ultrapure water and separated by denaturing polyacrylamide gel electrophoresis (PAGE) [using TBE buffer (89 mM Tris-boric acid, 2 mM EDTA) to prepare 6% polyacrylamide (acrylamide / N,N'-methylenebisacrylamide, 19 / 1) containing 7.5 M urea and 25 (v / v)% formamide as a denaturant]. The gel portion containing the target circularized RNA was cut out, crushed, and extracted by adding ultrapure water. The RNA contained in the gel extract was recovered by ethanol precipitation and redissolved in ultrapure water. The RNA concentration was calculated based on the absorbance at 260 nm. The isolation yield of circular RNA calculated based on the amount of transcribed RNA used was 5-6%. The purity of the purified circular RNA was confirmed by denaturing PAGE analysis.

[0267] Fig.14 This is a diagram showing the synthesis reaction of circular RNA. A) of the figure shows a schematic diagram of the reaction. The circled P represents the phosphate group at the 5' end of the RNA chain. B) of the figure shows the analysis results of the ligase ligation reaction product by 6% denaturing PAGE (containing 7.5M urea and 25 (v / v)% formamide as denaturants). The gel after electrophoresis was stained with the nucleic acid staining reagent SYBRGreen II to visualize the bands.

[0268] (4) Translation reaction in HeLa cells

[0269] The day before, 1 × 10 4HeLa cells (Riken Cell Bank) were prepared, and 10 ng of RNA was introduced into each well of the HeLa cells based on the recommended conditions of the transfection reagent (Lipofectamine MessengerMAX, Thermo). Three hours after transfection, the supernatant was replaced with Dulbecco's Modified Eagle Medium (Wako) containing 10 (w / w)% fetal bovine serum (Hyclone), and the cells were incubated at 37°C and 5% CO 2 After culturing for 24 hours under the conditions, the cells were lysed and the amount of NanoLuc luciferase contained in the lysate was measured using the Nano-Glo (registered trademark) Luciferase Assay System (Promega) and Mithras LB 940 microplate reader (Berthold).

[0270] Fig.15 : is a diagram showing the evaluation of translation activity of circular mRNA containing capped branches in human cultured cells (HeLa). : is a diagram showing the results of translation reactions using circular RNA. (a) of the figure is a schematic diagram showing the structures of three types of synthesized circular mRNA (604 bases long).

[0271] Figure (b) is a graph showing the results of comparing the translation activities of three types of RNA encoding NanoLuc luciferase (unbranched, branched and uncapped, and branched and capped) in HeLa cells. 4 HeLa cells were transfected with 10 ng of RNA per well using a transfection reagent (Lipofectamine MessengerMAX, 0.15 μL per well). The cells were cultured for 24 hours and then lysed, and the amount of NanoLuc luciferase contained in the lysate was evaluated using the Nano-Glo (registered trademark) luciferase assay system (Promega).

[0272] Figure (c) is a photograph showing the results of denaturing polyacrylamide electrophoresis analysis of circular RNA used in the translation activity assay. 50 ng of RNA was heat-denatured in a sample solution containing formamide, and then electrophoresed using a 5% polyacrylamide gel containing 7.5 M urea as a denaturant. The gel after electrophoresis was stained with a nucleic acid staining reagent SYBR Green II to visualize the RNA bands.

[0273] As can be seen from these figures, the translation activity of the capped circular RNA (Branch(+)Cap(+)) is extremely high, at least 2,000 times higher than that of the unbranched and capped circular RNA (Branch(-)).

[0274] 3. Polycapped RNA

[0275] (1) Synthesis of polycapped RNA

[0276] The RNA chain and the non-nucleotide chain introduction site were synthesized using a nucleic acid automatic synthesizer using a commercially available RNA phosphoramidite (TOM protection) reagent and Trebler Phosphoramidite, SymmetricDoubler Phosphoramidite, and Spacer Phosphoroamidite 9 (all manufactured by Glen Research). At this time, the 5' end was phosphorylated on the synthesizer using a chemical phosphorylation reagent Nb-CPR (Compound 1: Formula (3)). For the deprotected and purified RNA, a chemical capping reagent (Im-m 7 GDP) reacts with it, thereby introducing the cap structure of mRNA.

[0277] Fig.16 This is a diagram showing the structure of a 107-base RNA containing a synthetic branched structure. The sequence is shown below. The "p" at the 5' end indicates phosphorylation, and "Gm" indicates that the 2'-hydroxyl group of the G nucleotide is methylated. "X" indicates three types of non-nucleotide linker structures. The structures of the different parts near the 5' end are shown in the diagram.

[0278] 5'_p_G m _X_G m _AGCCACCAUGGACUACAAGGACGACGACGA UAAGAUCAUCGACUAUAAAGACGACGACGAUAAACACCACCA CCACCACCACUGAAAAAAAAAAAAAAAAAA_3'

[0279] (2) Evaluation of translation activity

[0280] Fig.17 The figure shows the evaluation results of the translation activity of a 107-base-long protein containing a synthetic branch structure / multiple cap structures in HeLa cells. 5RNA was introduced into HeLa cells seeded in 12-well plates by lipofectamine MessengerMAX reagent, and lysed after 6 hours of culture. The amount of expressed peptide contained in the lysate was quantified by ELISA (anti-His tag antibody was used as the immobilized antibody, anti-FLAG antibody HRP complex was used as the detection antibody, and the immobilized anti-FLAG antibody HRP complex was used). As a result, in RNA containing three cap structures, an increase in translation activity of about 1.4 times was confirmed compared with the unmodified control sequence.

[0281] 4. Bicistronic mRNA (linear type: Fluc-Nluc system)

[0282] (1) Preparation of Fluc-Nluc plasmid DNA using HiFi DNA Assembly

[0283] PCR was performed using the plasmid DNA and primers shown below, and then the template plasmid was digested with DpnI to synthesize Fluc (Firefly luciferase) DNA, Nanoluc (Nanoluciferase: Nluc) DNA and vector DNA with a homologous sequence of 20 bases at the end. Prepare 20 μL of reaction solution (100 ng / μL Fluc DNA, 100 ng / μL Nluc DNA, 100 ng / μL vector DNA, 1×NEBuiler (registered trademark) HiFi DNA Assembly Master Mix (NEWENGLAND BioLabs), fixed to volume with MQ water), incubate at 50°C for 1 hour, and cool on ice. 2 μL of the reaction solution was transformed into Escherichia coli competent cells (ECOS (registered trademark) Competent E. coli JM109 (Nippon Gene)) and spread on LB agar medium (containing 100 μg / mL ampicillin sodium). After culturing at 37°C overnight, colonies were picked and added to 5 mL of LB liquid medium (containing 50 μg / mL ampicillin sodium), cultured at 37°C and 160 rpm overnight, and the next day, plasmids were extracted using Wizard (registered trademark) Plus SV Minipreps DNA Purification Systems (Promega) to obtain target plasmid DNA.

[0284] (2) Preparation of 3×FLAG-Fluc-Nluc plasmid DNA using HiFi DNA Assembly

[0285] PCR was performed using the plasmid DNA and primers shown below to synthesize 3×FLAG DNA and pGEM-Fluc-Nluc vector having a homologous sequence of about 20 bases at the end. The PCR product was analyzed by 0.8% agarose gel electrophoresis. The target band was cut out and purified by gel extraction using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega). 10 μL of the reaction solution (20 nM 3×FLAG DNA, 4 nM pGEM-Fluc-Nluc vector, 1×NE Builder (registered trademark) HiFi DNA Assembly Master Mix, fixed to volume with MQ water) was prepared, incubated at 50°C for 1 hour, and then cooled on ice. 5 μL of the reaction solution was transformed into Escherichia coli competent cells (ECOS (registered trademark) Competent E. coli JM109 (Nippon Gene)) and spread on LB agar medium (containing 100 μg / mL ampicillin sodium). After culturing at 37°C overnight, colonies were picked and added to 5 mL of LB liquid medium (containing 50 μg / mL ampicillin sodium), cultured at 37°C and 180 rpm overnight, and the next day, plasmids were extracted using Wizard (registered trademark) Plus SV Minipreps DNA Purification Systems (Promega) to obtain target plasmid DNA.

[0286] (3) Synthesis of 3×FLAG-Fluc-Nluc mRNA transcription template DNA using PCR

[0287] Prepare 50 μL of PCR reaction solution (0.3 μM forward primer, 0.3 μM reverse primer, 1 ng / μL 3×FLAG-Fluc-Nluc plasmid DNA, 0.2 mM dNTPs, 1.5 mM MgSO 4 , 1× PCR buffer, 0.02U / μL KOD-plus-Neo (TOYOBO)), and synthesized template DNA by PCR. PCR products were analyzed by 0.8% agarose gel electrophoresis. The target band was cut out and purified by gel extraction using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega).

[0288] (4) Synthesis of 3×FLAG-Fluc-Nluc mRNA by in vitro transcription

[0289] Prepare the transcription reaction solution (10 ng / μL template DNA, 1× T7 RNA polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2 , 2mM, spermidine), T7 RNA polymerase (Takara) 2.5U / μL, 5mM DTT, 2mM ATP, 2mM UTP, 2mM CTP, 2mM GTP or 0.4mM GTP and 1.6mM ARCA), and incubated at 37°C for 1 hour. For uncapped mRNA, 2mM GTP was used, and for capped mRNA, 0.4mM GTP and 1.6mM ARCA were added to the reaction solution for synthesis. Recombinant DNaesI (TaKaRa) was added to the reaction solution to make 0.3U / μL, and incubated at 37°C for 15 minutes to degrade the template DNA. After the reaction, it was purified by phenol-chloroform extraction and ethanol precipitation.

[0290] (5) Chemical synthesis of RNA

[0291] 5'-GACAGUCUGCUCGAAGCGGCCGCUCUAGAAGCGTCACC TTAATATGCGCC-3' (serial number 30)

[0292] Using Universal UnyLinker Support CPG (ChemGenes) was synthesized using a nucleic acid automatic synthesizer. The 5' end was monophosphorylated using a synthetic phosphoramidite (the above-mentioned compound 1) having a photoprotective group. The synthesis of compound 1 was based on the contents of "Onda, K. Master Thesis. Master thesis (Nagoya university) 2021." After the synthesis of compound 1, CPG was transferred to a 1.5 mL ring-threaded tube (Sarstedt), 1.0 mL of 40% methylamine aqueous solution / 28% ammonia aqueous solution (1:1) was added, and incubated at 65°C for 1 hour. After cooling to room temperature, it was filtered using a Millex LH 0.45 μm filter (Merck, Millipore), washed with sterile water (500 μL), and dried and solidified using a centrifugal evaporator. 1.0 mL of 1M TBAF in THF was added to dissolve it and allowed to stand overnight at room temperature. 1.0 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. Desalting was performed using a NAP-25 column (GE Healthcare). Purification of RNA to which phosphorylated synthetic phosphoramidite was added was performed by reverse phase HPLC. After removing acetonitrile and TEAA buffer using a centrifugal evaporator, the absorbance of the nucleic acid aqueous solution at 260 nm was measured to determine the concentration. The HPLC conditions are shown below. In addition, the HPLC results are shown in Fig.18 .

[0293] Chromatographic column: Triart C4 (YMC) 10×250 mm, mobile phase: A) 50 mM TEAA buffer (pH 7.0), 5% acetonitrile, B) acetonitrile, gradient: 0-20 min B concentration 0% to 40%, 20-30 min B concentration 80%, flow rate: 3.0 mL / min

[0294] (6) RNA deprotection by light irradiation

[0295] For about 100 μM RNA in a 96-well plate, MAX-305 (Asahi Corporation) was used at 4000 μW / cm 2 The RNA solution after light irradiation was purified by reverse phase HPLC under the same conditions as the purification of chemically synthesized RNA, confirming the removal of photoprotective groups. After removing acetonitrile and TEAA buffer using a centrifugal evaporator, the absorbance of the nucleic acid aqueous solution at 260 nm was measured to determine the concentration. The absorbance measurement results are shown in Fig.19 (a).

[0296] (7) Chemical capping of RNA

[0297] In a 1.5 mL tube, add 10 μM RNA and 10 mM CaCl to a final concentration. 2 , and solidified by freeze-drying. A capping reagent (structure shown in the following formula) dissolved in DMSO was added at a final concentration of 10 mM, and 2-nitroimidazole was added at a final concentration of 10 mM, and the volume was fixed to 20 μL with DMSO. The reaction solution was incubated at 55°C for 3 hours. After the reaction solution was diluted 10 times with sterile water, 5 pmol of RNA was mixed with 2× formamide loading solution and analyzed by 8% denaturing PAGE. Electrophoresis was performed at a constant current of 20 W for 1.5 hours, and staining was performed with SYBR Green II. The capping efficiency was calculated from the band intensity. The reaction solution diluted with sterile water was ultrafiltered using Amicon 3K (Merck, Millipore). The absorbance of the resulting RNA solution was measured at 260 nm to determine the concentration. A photograph of the gel of the capped RNA electrophoresis is shown in Fig.19 (b). In addition, the results of the absorbance measurement of the capped RNA are shown in Fig. 20 As a result, the capping efficiency was 78%.

[0298] [Chemistry 12]

[0299]

[0300] (8) Annealing of mRNA and csRNA or sRNA

[0301] Using the mRNA (3×FLAG-Fluc-Nluc mRNA), csRNA (capped short RNA), and sRNA (short RNA), 10 μL of annealing solution (0.1 μM mRNA, 0.2 μM csRNA or sRNA 2, 50 mM NaCl) was prepared and heated at 80°C for 5 minutes. Then, the mixture was slowly cooled to room temperature. The sequence of the annealed RNA (SEQ ID NO: 34) is shown in Fig.21 .

[0302] (9) Transfection into HeLa cells and translation reaction

[0303] One day before transfection, 1 × 10 4HeLa cells suspended in 100 μL of D-MEM medium (FUJIFILM, containing 10% FBS) were inoculated at a concentration of cells / well. The next day, the medium was replaced with 90 μL of Opti-MEM (registered trademark) (ThermoFisher SCIENTIFIC), and the annealed mRNA-csRNA or mRNA-sRNA was transfected using Lipofectamine (registered trademark) MessengerMAX (registered trademark) (Thermo Fisher SCIENTIFIC) (0.3 μL of Lipofectamine (registered trademark) MessengerMAX (registered trademark), 1 μL of annealing solution, and fixed to 10 μL with Opti-MEM (registered trademark)). The cells were incubated at 37°C and 5% CO 2 After incubation for 3.5 hours at room temperature, the medium was replaced with 50 μL of D-MEM medium containing 10% FBS and incubated at 37°C for 3 hours. The luminescence measurement was performed using the Nano-Glo (registered trademark) Dual-Luciferase (registered trademark) Reporter Assay System (Promega), and the luminescence of the nano luciferase was standardized with the luminescence of the firefly luciferase to determine the translation efficiency. The results are shown in Fig. 22 (a) of the figure shows the structure of RNA, and (b) shows the corresponding translation efficiency results.

[0304] In bicistronic mRNA, if the Cap-probe is hybridized to the start codon of the second half coding region, the translation of the coding region located downstream can be induced. This shows that regardless of whether there is a normal cap at the 5' end, translation can be specifically induced in the second half coding region.

[0305] 5.Multi uORF-mRNA (linear type: Rluc system)

[0306] Make the capped probe ( Fig.23 (b) RNA5~8) binds to mRNA with multiple coding regions ( Fig.23 (a) Fig.24 : Sequence number 39), to study whether the translation activity of the coding region downstream of the probe is improved. The luciferase sequence was inserted downstream of ORF3 of the full-length 1338nt mRNA. A probe (RNA1-8) complementary to the upstream of ORF3 was designed and synthesized. The translation activity was evaluated by the expression level of luciferase. The details of the experiment are shown below.

[0307] (1) Synthesis of Rluc mRNA transcription template DNA by PCR

[0308] Prepare 50 μL of PCR reaction solution (0.3 μM forward primer, 0.3 μM reverse primer, 1 ng / μL Rluc plasmid DNA, 0.2 mM dNTPs, 1.5 mM MgSO 4 , 1× PCR buffer, 0.02U / μL KOD-plus-Neo (TOYOBO)), and synthesized template DNA by PCR. PCR products were analyzed by 1% agarose gel electrophoresis. The target band was cut out and purified by gel extraction using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega).

[0309] (2) Synthesis of Rluc mRNA using in vitro transcription

[0310] Prepare the transcription reaction solution (10 ng / μL template DNA, 1× T7 RNA polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2 , 2mM spermidine), 2.5U / μL T7 RNA polymerase (Takara), 5mM DTT, 2mM ATP, 2mM UTP, 2mM CTP, 2mM GTP or 0.4mM GTP and 1.6mM ARCA), and incubate at 37°C for 1 hour. Recombinant DNaesI (TaKaRa) was added to the reaction solution at 0.3U / μL and incubated at 37°C for 15 minutes to degrade the template DNA. After the reaction, purification was performed by phenol-chloroform extraction, ethanol precipitation, and reverse phase HPLC. The conditions of HPLC are as follows. The results of the analysis after HPLC preparation are shown in Fig.25 .

[0311] Chromatographic column: Hydrosphere C18 (HS12S05-2546WT, 250×4.6mml.DS-5μm, 12nm), mobile phase: A) 50mM TEAA buffer (pH7.0), 5% acetonitrile, B) acetonitrile, gradient: 0-20min B concentration 0% to 20%, flow rate: 1.0mL / min, column temperature: 50℃

[0312] (3) Chemical synthesis of RNA

[0313] The synthesis was performed using a nucleic acid automatic synthesizer using the CPG and phosphoramidite shown below. After synthesis, the CPG was transferred to a 1.5 mL threaded tube with a ring (Sarstedt), 1.0 mL of 40% methylamine aqueous solution / 28% ammonia aqueous solution (1:1) was added, and incubated at 65°C for 30 minutes. After cooling to room temperature, it was filtered using a Millex LH 0.45 μm filter (Merck, Millipore), washed with sterile water (500 μL), and dried and solidified using a centrifugal evaporator. 1.0 mL of 1M TBAF in THF solution was added to dissolve it, and it was allowed to stand at room temperature overnight. 1.0 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. After desalting using a NAP-25 column (GE Healthcare), it was purified by reverse phase HPLC. The results of the HPLC post-preparation analysis are shown in Fig.26 The results of LC-MS are shown in the following table.

[0314] <CPG>

[0315] 3'-TOM ribo Adenosine(n-acetyl)2'-lcaa CPG (N-3201-10, ChemGenes) / 2'-TOM ribo Cytidine(n-acetyl)3'-lcaa CPG (N-3202-10, ChemGenes) / 2'-TOM ribo Guanosine(n-acetyl)CPG (N-3203-10, ChemGenes) / 2'-TOM ribo Uridine 2'-lcaa CPG (N-3205-10, ChemGenes)

[0316] <Phosphoramidite>

[0317] 5'-DMT-2'-TOM ribo Adenosine (ANP-3201, ChemGenes) / 2'-TOM riboCytidine (ANP-3202) / 2'-TOM ribo Guanosine (ANP-3203, ChemGenes) / 2'-TOM riboUridine (ANP-3205, ChemGenes) / 5'-Phosphate-ON Reagent (CLP-1544, ChemGenes)

[0318] <HPLC conditions>

[0319] Chromatographic column: Hydrosphere C18 (HS12S05-2546WT, 250×4.6mml.DS-5μm, 12nm), mobile phase: A) 50mM TEAA buffer (pH7.0), 5% acetonitrile, B) acetonitrile, gradient: 0-20min B concentration 0% to 30%, flow rate: 1.0mL / min, column temperature: room temperature

[0320] [Table 3]

[0321]

[0322] (4) Chemical capping of RNA

[0323] In a 1.5 mL tube, add 10 μM RNA and 10 mM CaCl 2 The mixture was mixed in a manner and dried and solidified by freeze drying. A capping reagent (Chemical 10 described above) dissolved in DMSO at a final concentration of 10 mM and 2-nitroimidazole at a final concentration of 10 mM were added, and the volume was fixed to 50 μL with DMSO. The reaction solution was incubated at 55°C for 3 hours. After the reaction, it was purified by Amicon Ultra (0.5 mL, 3K, Merck Millipore) and ethanol precipitation, and analyzed by 20% denaturing PAGE, and the capping efficiency was calculated from the band intensity. The results are shown in Fig.26 .

[0324] (5) Annealing of mRNA and csRNA or sRNA

[0325] Using the mRNA (Rluc mRNA), csRNA (capped short RNA), and sRNA (short RNA) obtained above, 10 μL of annealing solution (0.1 μM mRNA, 1.0 μM csRNA or sRNA, 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM EDTA (pH 8.0)) was prepared and heated at 80°C for 5 minutes. Then, the mixture was slowly cooled to room temperature.

[0326] (6) Transfection into HeLa cells and translation reaction

[0327] One day before transfection, 1 × 10 4HeLa cells were suspended in 100 μL of D-MEM medium (FUJIFILM, containing 10% FBS) at a concentration of 100 μL per well. The medium was replaced with 90 μL of Opti-MEM (registered trademark) (ThermoFisher SCIENTIFIC) the next day, and the annealed mRNA-csRNA or mRNA-sRNA was transfected using Lipofectamine (registered trademark) MessengerMAX (registered trademark) (Thermo Fisher SCIENTIFIC) (0.3 μL of Lipofectamine (registered trademark) MessengerMAX (registered trademark), 1 μL of annealing solution, and fixed to 10 μL with Opti-MEM (registered trademark)). The cells were incubated at 37°C and 5% CO 2 After incubation for 3 hours at room temperature, the medium was replaced with 50 μL of D-MEM medium containing 10% FBS and incubated at 37°C for 3 hours. Luminescence measurement was performed using Renilla Luciferase Assay System (Promega). The results are shown in Fig.28 . It can be seen that the luminescence intensity, that is, the translation activity of the capped RNA (csRNA) is higher than that of any uncapped RNA (sRNA) from mRNA without a cap structure (Figure (a)) to RNA5 to 8. In addition, in both mRNA without a cap structure (Figure (a)) and mRNA with a cap structure (Figure (b)), the translation activity is particularly improved when it is bound to cap probe 7 or 8.

[0328] 6. Comparison of capped circular RNA and encephalomyocarditis virus (EMCV) IRES

[0329] (1) Preparation of plasmid containing IRES

[0330] First, prepare 1 μL of 10 ng / μL plasmid DNA containing IRES and put it into a 1.5 mL tube. Add 10 μL of ECOSJM109 competent cells and transform them using the ECOS 6-minute protocol. Under an alcohol lamp, spread the transformed sample on LB / agar medium (containing 100 μL / mL of ampicillin) and incubate overnight in a 37°C incubator. After 15 hours, confirm the formation of colonies and add a single colony to 10 mL of LB / ampicillin liquid medium. Then, shake overnight at 37°C. Then, use Wizard Plus SV Minipreps DNA Purification system for plasmid extraction. The concentration of the plasmid is measured by absorbance at 260 nm.

[0331] (2) Purification of plasmid using IRES fragment of endonuclease

[0332] For 500ng of purified plasmid DNA containing IRES, 1μL of 10×K buffer, 0.5μL of EcoRI (Takara), and 0.5μL of BamHI (Takara) were added, and MQ water was added to make the total amount 10μL. After the sample was incubated at 37°C for 1 hour, endonuclease treatment (100V, 30 minutes) was confirmed by 1% agarose electrophoresis. The 645bp band is a sequence fragment containing IRES, so its band was separated and purified by Wizard Plus SV Minipreps DNA Purification system.

[0333] (3) Preparation of fragments containing NanoLuc luciferase

[0334] For 10 ng of plasmid DNA with 5'UTR shortened by 50 nt of pNL1.1TK, add only 10 μM to 25 pmol of forward primer and reverse primer, respectively. Add this sample to PCR reaction solution (5 μL of 10× buffer, 25 mM MgSO 4 3μL, 2mMdNTPs 5μL, KOD plus neo 1μL), prepared in a way that the total amount becomes 50μL. Then, for the prepared sample, PCR was performed under the conditions of 94℃2min→(98℃10sec, 55℃30sec, 68℃3min)×25→68℃3min→4℃. The results were confirmed by 1% agarose electrophoresis (100V, 30 minutes). For 48μL of PCR reaction solution, in order to digest the plasmid before the reaction, 0.5μL of endonuclease DpnI was added and incubated at 37℃ for 1 hour. In addition, the PCR reaction solution was purified by Wizard Plus SV Minipreps DNA Purification system.

[0335] (4) In-fusion reaction

[0336] The absorbance at 260 nm of the IRES fragment and NanoLuc luciferase fragment obtained above was measured respectively. Then, 2.5 μL of the IRES fragment (13.5 ng / μL), 1.5 μL of the linear vector containing NanoLuc luciferase (31.1 ng / μL), and 1 μL of 5×In-fusion HD Enzyme Premix (Takara) were mixed to a total volume of 5 μL. As a negative control sample, the following sample was also prepared: 1.5 μL of the linear vector containing NanoLuc luciferase (31.1 ng / μL) and 1 μL of 5×In-fusion HD Enzyme Premix (Takara) were mixed, and the total volume was set to 5 μL with MQ water. Then, the prepared sample was incubated at 50°C for 15 minutes. For the incubated sample, the ECOS 6-minute protocol was performed again, and 50 μL of ECOS JM109 competent cells were added. The sample was spread on LB / agar medium (containing 100 μL / mL of ampicillin) under an alcohol lamp and incubated overnight in a 37°C incubator. After 15 hours, colonies were confirmed to have formed, and a single colony was added to 10 mL of LB / ampicillin liquid medium. Then, it was shaken overnight at 37°C. Then, the plasmid was extracted using Wizard Plus SV Minipreps DNA Purificationsystem. The concentration of the plasmid was determined by absorbance at 260 nm.

[0337] (5) Amplify the NanoLuc luciferase region from plasmid DNA

[0338] Prepare PCR reaction solution (10× buffer 5 μL, 25 mM MgSO 4 3μL, 2mM dNTPs5μL, forward primer 10μM1.5μL, reverse primer 10μM 1.5μL, plasmid DNA 0.37μL, KOD plus neo 1μL) to make 50μL. Then, the prepared sample was subjected to PCR under the conditions of 94℃2min→(98℃10sec, 55℃30sec, 72℃90sec)×25→72℃3min→4℃. Through the above operations, the required NanoLuc luciferase region and IRES sequence were cut out from the product after plasmid extraction by PCR. The sequence of the cut DNA fragment (sequence number 40) is shown in Fig.29 The products obtained by PCR amplification were electrophoresed on agarose gel (1.0%, 1×TAE, 100 V, 30 minutes). After PCR, the PCR products were purified by Wizard SV gel and PCR Clean-up System.

[0339] (6) IVT (in vitro transcription) of purified DNA

[0340] For the purified DNA (3' fragment, full length) described above, an IVT reaction was performed. Prepare 600μL of transcription reaction solution (4000ng of each purified DNA, 60μL of 10× buffer, 60μL of 50mM DTT, 60μL of 20mM ATP, CTP, UTP, GMP, 15μL of 20mM GTP, 30μL of T7 RNA polymerase (Takara), and adjust the volume with MQ water) and incubate at 37°C for 2 hours. Then, the sample was electrophoresed using 5% denaturing PAGE (7.5M urea, 1×TBE buffer, 26mA, 60 minutes). Then, the sample after electrophoresis was stained for 20 minutes using a staining solution made of 3μL of SYBR Green II and 30mL of MQ water. Using ChemiDoc, photograph the denaturing PAGE to confirm the IVT product.

[0341] (7) Purification of IVT products

[0342] Add 20 μL of DNaseI (Takara) to 600 μL of the 3' fragment and full-length IVT product, and incubate at 37°C for 15 minutes. This removes the DNA remaining in the IVT reaction. Next, add 600 μL of neutral phenol and 600 μL of chloroform, and centrifuge at 14,500 rpm for 15 seconds. Then, add 600 μL of chloroform, and centrifuge in the same way. This removes proteins such as enzymes. Next, use a centrifugal evaporator to centrifuge at room temperature for 5 minutes. This removes chloroform that is not suitable for Amicon. Next, use Amicon 10K. This removes low molecules. Finally, use Amicon to add 100 μL of isopropanol 100 μL and 20 μL of 3M sodium acetate aqueous solution (pH 5.2) to the resulting 100 μL, and let stand at -30°C for 1 hour. Then, centrifuge at 14,500 rpm, room temperature, and 30 minutes. After removing the supernatant in such a way that the precipitate obtained by centrifugation is not sucked, 1 mL of 80% ethanol is added for washing. After centrifugation for 2 minutes under the same conditions, the supernatant is removed and allowed to stand for 5 minutes. Finally, 200 μL of MQ water is centrifuged three times to dissolve it and purify the 3' fragment and the full-length RNA.

[0343] (8) HPLC purification of IVT products

[0344] As mentioned above, the sample was purified after the IVT reaction, but double-stranded RNA or triphosphates were not removed in this operation. These can cause effects such as reduced yield and translation activity when verifying the ligation reaction or the translation reaction in cells, so they were removed by HPLC. A HITACHI HPLC system was used. The conditions were: Hydrpshere C18: solvent A: 50mM TEAA (pH7.0), 5% ACN; solvent B: ACN; gradient 0-20% B / 0-20min; flow rate, 1mL / min; column temperature: 50℃; column size 250×4.6mml.D, S-5μL, 12nm; detection wavelength: 260nm. After preparation by HPLC, acetonitrile was removed by concentration under reduced pressure. Then, after ethanol precipitation, the absorbance at 260nm was measured and used for subsequent experiments.

[0345] (9) Isolation and purification of circular mRNA containing IRES

[0346] Under the optimal conditions, the circularization reaction of the target RNA was carried out. Use 1μM guide strand, 0.4μM 3' fragment, 0.4μM RNA, 10×T4 RNA ligase 2 buffer, 60% PEG, and T4 RNA ligase 2 0.025μg / μL. After electrophoresis with 6% dPAGE (7.5μM urea, 1×TBE buffer, 30mA, 180 minutes), the band considered to be circular mRNA was cut with a cutter while irradiating ultraviolet light on the TLC plate and placed in a 1.5mL tube. Then, a total of 500μL of MQ water was added to the tube and shaken overnight with a shaker. Then, after centrifugation at 14500rpm and room temperature for 1 minute, the supernatant was recovered, and for the remaining gel, 400μL of MQ water was added for the same centrifugation to recover the supernatant. Next, the supernatant was divided into 2 times for filter filtration using Millex LCR 13mm. Then, the filtered sample was precipitated with isopropanol to purify the circular mRNA. The concentration of the purified circular mRNA was measured by absorbance at 260 nm, and samples for cell experiments were prepared.

[0347] (10) Confirmation of circular mRNA using RNA degrading enzymes

[0348] For the circular mRNA 10ng purified by the above separation and purification operation, add RNaseR (Epicenter, 20U / μL) to make it 1U / μL, dilute to 5μL with MQ water, and incubate at 37°C for 15 minutes. Then, phenol-chloroform extraction and isopropanol precipitation were used to purify the circular mRNA. Then, 5% dPAGE (7.5μM urea, 1×TBEbuffer, 30mA, 240 minutes) electrophoresis was performed. The gel after electrophoresis was stained with SYBR Green II for 30 minutes, and the electrophoresis results were confirmed with ChemiDoc.

[0349] (11) Inoculation of human cultured cells

[0350] The human cultured cells (HeLa) cultured in the culture dish were washed twice with 3 mL of PBS (Phosphate buffered saline, nacalai tesque), and 1 mL of 0.05% trypsin solution was added to lyse the cells, and then incubated for 1 minute. Then, 3 mL of culture medium was added to stop the trypsin lysis. The sample was centrifuged (Multripurposerefrigerated centrifuge EX-126, 200G, 3 minutes), the supernatant was removed, and the cells were resuspended in the culture medium. 20 μL of the supernatant was used for cell counting. Then, the cells were counted to 10×10 4 After adjusting the medium in a manner of 10×10 cells / well, 100 μL was added to each well to make 10×10 3 After 37 ℃ 5% CO 2 Incubate for 24 hours.

[0351] (12) Transfection of circular mRNA into human cultured cells

[0352] First, the sample for measuring the translation amount in human cultured cells was tested with 5 ng per well and 3 wells per sample. After removing the culture medium from the above incubated sample, wash once with 150 μL of PBS (Phosphate buffered saline, nacalaitesque). Add cells to a multi-well plate for cell culture (96 wells). Then, culture human cultured cells in a multi-well plate for cell culture (D-MEM, high glucose, containing phenol red, 37°C, 5% CO 2). Lipofectamine Messenger MAX transfection reagent (Invitrogen, 0.3 μL / well) and Opti-MEM (10 μL / well) were mixed with the cultured samples. 33 μL of the mixture was added to each sample RNA. 89 μL of Opti-MEM was added to each well, and 11.3 μL of the prepared RNA / Lipo reagent was added to each well. Incubate at 37°C with 5% CO 2 After incubation for 3 hours under the same conditions, the supernatant was removed and the culture medium was replaced with D-MEM.

[0353] (13) Luminescence Assay of Circular mRNA in Human Cultured Cells

[0354] 24 hours after the above transfection, the luminescence measurement of human cultured cells was performed. After aspirating the culture medium from the multi-well plate for cell culture (96 wells), wash it once with 150 μL of PBS. Use the Nano Glo luciferase detection system (Promega) to perform luminescence measurement of the washed samples. First, add 20 μL of 1×Go lysis buffer (Lysis Buffer) to each well. After incubating it at room temperature for 5 minutes, add 2 μL of the lysate of each cell to each well of the 96-well white plate. Add 0.1 μL of Nano Glo luciferase detection substrate and 10 μL of Nano Glo luciferase detection buffer to each well. Furthermore, after adding the reagent, measure it with a microplate reader (comparative example). The results are shown in Fig.30 .

[0355] In addition, the cap-containing circular RNA (Branch (+) Cap (+)) in the above-mentioned "2. Cap-containing circular RNA (branched type)" was also used to perform an evaluation experiment using the above-mentioned human cultured cells. The results are also shown in the figure. As can be seen from the figure, compared with the existing method using IRES, the cap-containing circular RNA showed a 10-fold increase in luciferase expression.

[0356] 6. Synthesis of circular mRNA containing two segments: a chemically synthesized RNA segment (54 bases long) and a transcribed synthetic RNA segment (550 bases long) ( Figures 31-33 )

[0357] Oligoribonucleotides with a main chain of 54 bases and a branched chain phosphorylated at the 5' end were synthesized using a chemical phosphorylation reagent containing a photodegradable protective group (Japanese Patent Application No. 2021-111420), a commercially available phosphoramidite reagent [ChemGenes products (ANP-3201, ANP-3202, ANP-3203, ANP-3205) were used for RNA chain synthesis, and Asymmetric Doubler (Lev) Phosphoramidite (10-1981) purchased from Glen Research was used for branch introduction] and a solid support (3'-TOM-ribo Uridine CPG 1000A, ChemGenes) according to a conventional method using a nucleic acid automatic synthesizer (NR-2A7MX or NRs-4A10R7NP, Japan Techno Service). In order to synthesize circular RNA without branches, a 54-base-long RNA sequence (SEQ ID No. 43) consisting only of a main chain was synthesized. After the synthesis is completed, add 1 mL of an equal mixture of 40% methylamine aqueous solution and concentrated ammonia water to the solid phase carrier, heat at 65°C for 20 minutes, cut out from the solid phase monomer, and deprotect the nucleic acid base. Filter the supernatant with a Millex LH filter (0.45μm, Merck), and dry and solidify under reduced pressure with a centrifugal evaporator. Then add 1M tetrabutylammonium fluoride THF solution to the residue and incubate at room temperature overnight. After desalting using a NAP-25 gel filtration column (Merck), the RNA contained in the eluate is recovered by ethanol precipitation. It is redissolved in ultrapure water, and the target is separated and purified by reverse phase HPLC.

[0358] [Hitachi LaChrom Elite or Chromaster system (Hitachi High-Technologies); chromatographic column: YMCTriart Bio C4 (250 mm × 10 mm ID, YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B: acetonitrile; linear gradient 0-20% solvent B (0-20 min); flow rate: 3 mL / min; detection wavelength: 260 nm; column temperature: 50°C].

[0359] The protective group on the phosphate group of the obtained target was removed by irradiation with 365-nm light. The light irradiation was performed using a MAX-305 light source device (Asahi Spectroscopy). 50 μL of RNA solution was added to each well of a transparent 96-well multiwell plate and the irradiation was performed at 4 mW / cm 2The RNA was recovered and separated and purified by ethanol precipitation. The RNA before and after phosphate group deprotection was analyzed by LC / MS system (Agilent), and the target product was confirmed. Then, the 5'-end phosphate group of the branched chain was treated with 7-methylguanosine 5'-diphosphoimidazole sodium salt (Im-m 7 GDP) reaction to obtain a capped RNA chain (WO2021172204A1). Add 5 μL of 200 mM calcium chloride aqueous solution to 2 nmol (26 μL) of raw RNA containing a phosphate group at the 5' end of the branched chain, freeze it with liquid nitrogen, and then freeze-dry it. After 3 hours, add 45 μL of dimethyl sulfoxide (DMSO) to the mixture of dried and solidified RNA and calcium chloride to dissolve it, and add 50 μL of Im-m 7 GDP / DMSO solution and 5μL of 200mM 2-nitroimidazole / DMSO solution were heated at 55°C for 3 hours. 122μL of 0.541M sodium acetate (pH5.2) aqueous solution was added, and a portion was taken to evaluate the efficiency of the capping reaction. 5pmol of the raw material and the RNA after the reaction were analyzed by 10% denaturing PAGE containing 7.5M urea as a denaturant to confirm the band shift of the capped body. 220μL of 2-propanol was added to the solution after adding the sodium acetate aqueous solution, cooled at -30°C overnight, and centrifuged (20,000g, 25 minutes) to obtain a precipitate. It was redissolved in ultrapure water, and the target product was separated and purified by reverse phase HPLC.

[0360] [Hitachi LaChrom Elite or Chromaster system (Hitachi High-Technologies); chromatographic column: YMC Cydrosphere C18 (250 mm × 4.6 mm ID, YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B: acetonitrile; linear gradient 0-20% solvent B (0-20 min) flow rate: 1 mL / min; detection wavelength: 260 nm; column temperature: 50°C].

[0361] The target product was recovered from the eluate by ethanol precipitation to obtain capped RNA. After the cap structure was introduced into the side chain as described above, the 5' end of the main chain RNA was phosphorylated using the enzyme T4 polynucleotide kinase. The composition of the phosphorylation reaction is shown below. 8μM RNA, 1mM ATP, 50mM Tris-HCl (pH8.0), 10mM magnesium chloride, 5mM dithiothreitol, 0.2U / μL T4 polynucleotide kinase (Takara Bio). After incubating the reaction at 37°C for 1 hour, the protein was removed using a mixture of equal amounts of TE-saturated phenol: chloroform, and ethanol precipitation was performed to recover the RNA.

[0362] PCR reaction was performed using pNL1.1.TK (Promega), a commercially available plasmid DNA containing the coding sequence of NanoLuc luciferase (Nluc), as a template and two synthetic oligo DNAs (5'-CCCGGATCCTAATACGACTCACTATAGGTCTTCACACTCGAAGATT TC-3' (SEQ ID NO: 25) / 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAGAATTACGCCAGAATGCG-3' (SEQ ID NO: 26)) as primers. The composition of the reaction solution is as follows: 1 ng / μL pNL1.1.TK, 0.3 μM oligo DNA, 0.2 mM dNTPs, 1.5 mM MgSO 4 , 1× PCR buffer for KOD-Plus-Neo, 0.02U / μL KOD-Plus-Neo (Toyobo). Using a T100 thermal cycler (Bio-Rad), the reaction solution was subjected to the following thermal cycling conditions. 94°C, 2 minutes → [98°C, 10 seconds → 55°C, 30 seconds → 72°C, 70 seconds] × 25 cycles. Combine the reaction solutions (50μL × 8), add 0.4mL of a mixture of TE-saturated phenol and chloroform in equal amounts, mix vigorously, centrifuge (20,000×g, 1 minute), and separate the aqueous layer. Further, add 0.4mL of chloroform, mix vigorously, centrifuge (20,000×g, 1 minute), and separate the aqueous layer. 40 μL of 3M sodium acetate aqueous solution (pH 5.2) and 440 μL of 2-propanol were added, cooled at -30°C overnight, and centrifuged (20,000×g, 20 minutes) to obtain the target DNA as a precipitate. Using the obtained DNA as a template, T7 RNA polymerase was used to prepare a 550-base-long RNA transcript with a phosphorylated 5' end. The composition of the reaction solution is as follows.

[0363] 15ng / μL template DNA, 2mM ATP, 2mM UTP, 2mM CTP, 0.5mM GTP, 2mM GMP, 40mM Tris-HCl (pH8.0), 8mM MgCl 2 , 2 mM spermidine, 5 mM DTT, 0.001 U / μL pyrophosphatase (New England Biolabs, M2403), and 2.34 ng / μL T7 RNA polymerase.

[0364] After incubating 1 mL of the reaction solution at 37°C for 2 hours, 10 μL of DNase I (5 U / μL, Takara Bio) was added and incubated at 37°C for 20 minutes. The reaction solution was extracted with an equal amount of a saturated phenol:chloroform mixture and chloroform to remove proteins. A 1 / 10 amount of a 3M sodium acetate aqueous solution (pH 5.2) and an equal amount of 2-propanol were added to the aqueous layer and centrifuged to obtain a crude RNA product as a precipitate. The obtained RNA transcripts were separated and purified by reverse phase HPLC [Hitachi LaChromElite or Chromaster system (Hitachi High-Technologies); chromatographic column: YMC Hydrosphere C18 (250 mm×4.6 mm I.D., YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile: solvent B: acetonitrile; linear gradient 5-15% solvent B (0-20 minutes); flow rate: 1 mL / minute; detection wavelength: 260 nm; column temperature: 50°C], and finally 420 μg of RNA transcripts were obtained.

[0365] A chemically synthesized RNA fragment with a main chain composed of 54 bases and a transcribed synthetic RNA with a length of 550 bases were annealed in the presence of two template DNAs, and linked and circularized using the enzyme T4 RNA ligase 2. The sequences of the two template DNAs composed of 30 bases are shown below. Splint_1, 5'-ACCTTAATATGCGCCTTTTTTTTTTTTTTT-3' (SEQ ID NO: 27); Splint_2, 5'-TCGAGTGTGAAGACCATGGTGGCTTTACCC-3' (SEQ ID NO: 28).

[0366] The composition of the enzyme reaction solution is as follows: 1 μM chemically synthesized RNA, 0.5 μM transcribed synthetic RNA, 2 μM Splint DNA_1, 2 μM Splint DNA_2, 50 mM Tris-HCl (pH 7.5), 2 mM MgCl 2, 1mM DTT, 400μM ATP, 10(w / v)% PEG6000, 0.05μg / μL T4 RNA ligase 2. Before adding PEG6000 and T4 RNA ligase 2 with stock solution concentrations of 60(w / v)%, respectively, the mixture was heated at 90°C for 3 minutes and slowly cooled to room temperature over about 20 minutes. Then, PEG6000 and ligase were added in such a way that the final concentrations were as shown above, and the mixture was incubated at 37°C for 1 hour. To the reaction solution, an equal amount of TE-saturated phenol: chloroform mixed solution was added, mixed vigorously, and centrifuged (20,000×g, 1 minute) to separate the aqueous layer. Furthermore, an equal amount of chloroform was added, mixed vigorously, and centrifuged (20,000×g, 1 minute) to separate the aqueous layer. 1 / 10 of the amount of the aqueous layer was added to the 3M sodium acetate aqueous solution (pH 5.2) and an equal amount of 2-propanol, and the mixture was cooled at -30°C for more than 1 hour, and then centrifuged (20,000×g, 20 minutes) to recover RNA. The obtained precipitate was dissolved in a small amount of ultrapure water and separated by denaturing polyacrylamide gel electrophoresis (PAGE) [6% polyacrylamide (acrylamide / N,N'-methylenebisacrylamide, 19 / 1) containing 7.5M urea and 25 (v / v)% formamide as a denaturant using TBE buffer (89mM Tris-boric acid, 2mM EDTA)]. The gel portion containing the target circular mRNA was detected by UV shadowing and cut out, and after the gel slice was broken, 50mM sodium acetate aqueous solution (pH 5.2) was added to extract RNA from the gel. The RNA contained in the extract was recovered by ethanol precipitation and then dissolved in ultrapure water. The RNA concentration was calculated based on the absorbance at 260nm. The purity of the isolated and purified circular RNA was confirmed by denaturing PAGE analysis (>90%).

[0367] 7. Synthesis of 5' end capped linear mRNA containing two fragments: a chemically synthesized RNA fragment (54 bases long) and a transcribed synthetic RNA fragment (550 bases long) ( Fig.33 )

[0368] Using a nucleic acid automatic synthesizer, a 5'-terminal phosphorylated chemically synthesized RNA oligomer with a main chain of 54 bases and no branching was synthesized in the same manner as the above-mentioned chemical synthesis including branching. The phosphate group at the 5' end was capped with a chemical capping reagent, 7-methylguanosine 5'-diphosphoimidazole sodium salt (Im-m 7GDP) reaction to obtain a capped RNA chain (WO2021172204A1). Add 5 μL of 200 mM calcium chloride aqueous solution to 2 nmol (26 μL) of 5' end phosphorylated RNA, freeze it with liquid nitrogen, and freeze dry it. After 3 hours, add 45 μL of dimethyl sulfoxide (DMSO) to the mixture of dried and solidified RNA and calcium chloride to dissolve it, and add 50 μL of Im-m 7 GDP / DMSO solution and 5μL of 200mM 2-nitroimidazole / DMSO solution were heated at 55°C for 3 hours. 122μL of 0.541M sodium acetate (pH5.2) aqueous solution was added, and a portion was taken to evaluate the efficiency of the capping reaction. 5pmol of the raw material and the RNA after the reaction were analyzed by 10% denaturing PAGE containing 7.5M urea as a denaturant to confirm the band shift of the capped body. 220μL of 2-propanol was added to the solution after adding the sodium acetate aqueous solution, cooled at -30°C overnight, and centrifuged (20,000g, 25 minutes) to obtain a precipitate. It was redissolved in ultrapure water, and the target product was separated and purified by reverse phase HPLC. [Hitachi LaChrom Elite or Chromaster system (Hitachi High-Technologies); chromatographic column: YMC Hydrosphere C18 (250 mm × 4.6 mm ID, YMC); solvent A: 50 mM triethylammonium acetate (pH 7.0), 5% acetonitrile: solvent B: acetonitrile; linear gradient 0-20% solvent B (0-20 min); flow rate: 1 mL / min; detection wavelength: 260 nm; column temperature: 50°C].

[0369] The target product was recovered from the eluate by ethanol precipitation to obtain capped RNA. The obtained capped RNA was linked to the same transcribed RNA as the RNA used in the synthesis of the branched circular mRNA described above by T4 RNA ligase 2 only in the presence of Splint DNA_2. The composition of the enzyme reaction solution is as follows. 1μM chemically synthesized 5' capped RNA, 0.5μM transcribed synthetic RNA, 2μM Splint DNA_2, 50mM Tris-HCl (pH7.5), 2mM MgCl 2, 1mM DTT, 400μM ATP, 10(w / v)% PEG6000, 0.05μg / μL T4 RNA ligase 2. The progress of the ligation reaction was confirmed by denaturing polyacrylamide gel electrophoresis (PAGE) [using TBE buffer (89mM Tris-boric acid, 2mM EDTA) to prepare 6% polyacrylamide (acrylamide / N,N'-methylenebisacrylamide, 19 / 1) containing 7.5M urea and 25(v / v)% formamide as a denaturant], and then separated and purified. The gel portion containing the linear mRNA as the target conjugate was detected by UV shadowing and cut out. After the gel slice was broken, 50mM sodium acetate aqueous solution (pH5.2) was added to extract RNA from the gel. The RNA contained in the extract was recovered by ethanol precipitation and redissolved in ultrapure water. The RNA concentration was calculated based on the absorbance at 260nm. The purity of the separated and purified RNA was confirmed by denaturing PAGE analysis.

[0370] 8. Synthesis of linear and circular mRNAs containing internal ribosome entry site (IRES) sequences Fig.33 )

[0371] From the commercially available plasmid DNA pIRES Vector (Takara Bio 631605), the sequence containing the IRES sequence was cut out using two restriction endonuclease sites (EcoR I / BamH I), and inserted into pNL1.1 TK Vector (Promega N1501) to prepare plasmid DNA. The sequence of this plasmid DNA (4396-bp, pIRES_NL) is shown in SEQ ID NO: 41 and used as a template for the following PCR reaction.

[0372] The above-mentioned pIRES_NL was used as a template and two synthetic oligo DNAs (5'-CCCGGATCCTAATACGACTCACTATAGGCGCATATTAAGGTGACGC GT-3' (SEQ ID NO: 42) / 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAGAATTACGCCAGAAT GCG-3' (SEQ ID NO: 43)) were used as primers to perform PCR reaction. The reaction solution composition was as follows: 1 ng / μL pIRES_NL, 0.3 μM oligo DNA, 0.2 mM dNTPs, 1.5 mM MgSO 4, 1× PCR buffer for KOD-Plus-Neo, 0.02U / μL KOD-Plus-Neo (Toyobo). Using a T100 thermal cycler (Bio-Rad), the reaction solution was subjected to the thermal cycling conditions shown below. 94°C, 2 minutes → 98°C, 10 seconds → 55°C, 30 seconds → 72°C, 90 seconds] × 25 cycles. After the reaction solution was deproteinized, the DNA was recovered by ethanol precipitation. Using the obtained DNA as a template, a transcription reaction was performed using T7 RNA polymerase in the same manner as for the sequence without the IRES sequence to prepare a linear mRNA. The obtained linear mRNA was also purified using reverse phase HPLC. The circular mRNA containing the IRES sequence was subjected to circularization reaction in the presence of only one type of Splint DNA SplintDNA_1 by the same method as the circular mRNA without IRES [0.5 μM RNA containing the transcribed IRES, 2 μM Splint DNA_1, 50 mM Tris-HCl (pH 7.5), 2 mM MgCl 2 , 1 mM DTT, 400 μM ATP, 10 (w / v)% PEG6000, 0.05 μg / μL T4 RNA ligase 2], and separated and purified by denaturing PAGE. The purity of the separated and purified circular RNA was confirmed by denaturing PAGE analysis (>90%).

[0373] 9. Experimental study on the evaluation of translation activity of mRNA using cultured HeLa cells ( Figures 31-33 )

[0374] One day before, 1 × 10 cells were seeded in a 96-well cell culture plate. 4 HeLa cells (Riken CellBank) were cultured in each well. 10 ng of RNA was introduced into the HeLa cells based on the recommended conditions of the transfection reagent (Lipofectamine MessengerMAX, ThermoFisher, 0.15 μL / well). Three hours after transfection, the supernatant was replaced with Dulbecco's Modified Eagle Medium (DMEM, Wako Pure Chemical Industries) containing 10 (w / w)% fetal bovine serum (FBS, Hyclone), and the cells were incubated at 37°C and 5% CO. 2 After culturing for 24 hours under the same conditions, the cells were lysed and the amount of NanoLuc luciferase protein contained in the lysate was measured using the Nano-Glo (registered trademark) Luciferase Assay System (Promega) and Mithras LB 940 microplate reader (Berthold).

[0375] 10. Experimental evaluation of translation activity of mRNA using experimental animals (mice) Fig.33 )

[0376] pH-responsive lipid (ALC-0315, MedChemExpress, Monmouth Junction, NJ, USA), phospholipid (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC, Fujifilm Wako, Osaka, Japan), cholesterol (Sigma Aldrich), and ALC-0159 (MedChemExpress) were prepared in an ethanol solvent at a molar ratio of 46.3:9.4:42.7:1.6. mRNA was dissolved in 50 mM citrate buffer (pH 3). mRNA and lipid were mixed at a volume ratio of 2:1 using a microfluidic system (NanoAssemblr (registered trademark) Spark, Precision Nanosystems, Vancouver, Canada). Then, it was diluted 40 times with PBS and ultrafiltered using an Amicon Ultra-15-30K centrifugal unit (Merck Millipore). LNP was administered from the tail vein in such a way that the mRNA concentration was 0.33 ug / mouse. Each organ was recovered 4 hours later. After homogenization in passive lysis buffer (Promega), the amount of luciferase was quantified using the Nano-Glo (registered trademark) luciferase assay system (Promega) and a Lumat3 LB9508 luminometer (Berthold technologies, Bad Wildbad, Germany).

[0377] 11. Immunogenicity evaluation experiment using mRNA cultured in HEK293-NF kappa B reporter cells ( Fig.33 )

[0378] NF-κB reporter (Luc)-HEK293 cells were purchased from BPS Bioscience. The day before transfection, the cells were treated with trypsin and plated at 3×10 5Each well was inoculated with 48-well cell culture plates. Immediately before transfection, the growth medium (DMEM medium containing 10% FBS and 100 μg / mL hygromycin B) was removed and replaced with 240 μL of Opti-MEM (registered trademark) I reduced serum medium (Reduced Serum Medium) (Thermo Fisher) per well. For each well, 20 ng of mRNA was mixed with 0.15 μL of Lipofectamine MessengerMAX (Thermo Fisher) and 10 μL of Opti-MEM I medium, added to the well, and the cells were cultured for 3 hours. The supernatant was replaced with growth medium (250 μL), and the cells were cultured for a total of 24 hours. The cells were lysed using 50 μL of Glo lysis buffer (Promega) per well. The total protein concentration in the cell lysate was measured using the Pierce BCA protein assay kit (Thermo Fisher), and the luciferase protein expression was measured using the One-Glo luciferase assay system (Promega). The luciferase expression level was normalized with the total protein concentration, and the relative value of the activation amount of the NF-κB signaling pathway introduced by each mRNA was calculated.

[0379] Fig.31 The experimental results show that the translation activity of circular mRNA with a cap structure introduced into the side chain is greatly improved compared with the circular mRNA without a cap structure. (a) is a conceptual diagram showing the synthesis method of circular mRNA containing a 5' cap structure in the side chain. A 54-base-long chemically synthesized RNA fragment (sequence number 44 to 48) and a transcriptionally synthesized RNA fragment (sequence number 49) are linked by an enzyme ligase to prepare a circular mRNA. The sequence and structure of the chemically synthesized RNA fragment and the enzyme-synthesized RNA fragment are shown in the figure. (b) shows the results of evaluating the translation activity of circular mRNA synthesized by the method shown in (a) in cultured HeLa cells. Circular mRNA was introduced into cultured HeLa cells by liposome transfection. After 24 hours of culture, the cells were lysed and the nanoluciferase activity of the lysate was measured. The activities of circular mRNAs with three branches of different chain lengths were compared. It was found that the translation activity of circular mRNA with a cap structure in the side chain was greatly improved compared with circular mRNA without a cap structure.

[0380] Fig.32The experimental results showing the relationship between the branch length and translation activity of circular mRNA with a cap structure introduced into the branch (variable branch length) are shown. (a) is a diagram showing the structure of a chemically synthesized RNA fragment (sequence number 48, 50, 51) containing a 5' cap structure in the branch. Three RNA chains with different branch lengths and sequences were prepared. (b) shows the results of evaluating the translation activity of circular mRNA synthesized using the fragment shown in (a) as a substrate in cultured HeLa cells. Its activity is compared with that of circular mRNA prepared using an RNA chain before the cap structure is introduced at the 5' end of the branch, and the results show the importance of introducing a cap structure into the end of the branch. Circular mRNA was introduced into cultured HeLa cells by liposome transfection, and after 24 hours of culture, the cells were lysed and the nanoluciferase activity of the lysate was measured. The activities of circular mRNAs with three branches of different chain lengths were compared. Although there was no significant difference in the activities, the circular mRNA with a branch of 6 bases showed the highest translation activity.

[0381] Fig.33 The results of experiments showing that the translation activity of circular mRNA with a cap structure is higher than that of mRNA containing an IRES sequence derived from EMCV. All RNAs contain a common Nano luciferase coding sequence, 3'UTR, and polyA30 tail. (a) is a schematic diagram showing the sequence and structure of the mRNA used. (b, c) are the results of evaluating the translation activity in cultured HeLa cells. mRNA was introduced into cultured HeLa cells by lipofectamine, and after 24 hours (b) or 18, 24, 48, and 72 hours (c) of culture, the cells were lysed and the Nano luciferase activity of the lysate was measured. (d) is the result of measuring the expression level in mouse spleen. (e) is the result of evaluating the immunogenicity of mRNA in the HEK293-NF kappa B-luciferase reporter cell system. mRNA was introduced into cells by lipofectamine.

[0382] As shown in (b-e), the translation activity of the branched circular mRNA (E) with a cap structure is higher than that of the linear (A) and circular mRNA (B) of EMCV-IRES, the linear mRNA with a cap structure (C), and the circular mRNA without a cap structure (D) in the human cultured cell system (b) and mouse animal experiment (d) (b). In addition, in the cultured cell system, the circular RNA (E) with a cap structure showed sustained translation activity for a longer period of time compared with the linear mRNA (C) with a cap structure. The experimental results show that the immunogenicity of the branched circular mRNA (E) with a cap structure is lower than that of the linear mRNA (C) with a cap structure.

[0383] 12. Translation of ATF4-Renilla mRNA and ATF4-csRNA5-8 in HeLa cells ( Fig.43 , Fig.44 )

[0384] (1) Synthesis of ATF4-Renilla mRNA Transcription Template DNA by PCR

[0385] Prepare PCR reaction solution (0.3 μM forward primer, 0.3 μM reverse primer, 1 ng / μL plasmid DNA (psiCHECK2_ATF4-Renilla), 0.2 mM dNTPs, 1.5 mM MgSO 4 , 1×PCR buffer (TOYOBO) for KOD-Plus-Neo, 0.02U / μL KOD-Plus-Neo (TOYOBO, made up to volume with MQ water), using a thermal cycler, synthesize template DNA by PCR. The PCR conditions were set to 94°C for 2 minutes for initial denaturation, and 30 cycles of 98°C for 10 seconds, 56°C for 30 seconds, and 72°C for 60 seconds. A 1% agarose gel (AgaroseS (Nippon Gene), 1×TAE buffer) was prepared, and 6× loading buffer (takara) was added to the PCR reaction solution for loading, and electrophoresis was performed at 100V for 30 minutes. After staining with EtBr, the target band was cut out, and the transcribed DNA was extracted and purified using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega). The absorbance of the obtained DNA solution at 260nm was measured to determine the concentration.

[0386] (2) Synthesis of ATF4-Renilla mRNA by in vitro transcription

[0387] In order to introduce a cap structure at the 5' end, an in vitro transcription reaction was performed with the following composition at a ratio of ARCA to GTP of 4:1. A transcription reaction solution (10 ng / μL template DNA, 1× T7 polymerase buffer (takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2 , 2mM spermidine), 5mM DTT, 2mM ATP, 2mM CTP, 2mM UTP, 0.4mM GTP, 1.6mM ARCA, 2.5U / μL T7 RNA polymerase, fixed to volume with MQ water). In addition, when the cap structure is not introduced, the transcription reaction solution is prepared according to the following composition (10ng / μL template DNA, 1× T7 polymerase buffer (takara) (40mM Tris-HCl (pH8.0), 8mM MgCl 2, 2mM spermidine), 5mM DTT, 2mM ATP, 2mM CTP, 2mM UTP, 2mM GTP, 2.5U / μL T7 RNA polymerase, made up to volume with MQ water). After incubation at 37°C for 1 hour, recombinant DNase I (takara) was added to the reaction solution to make its concentration 0.1U / μL, and incubated at 37°C for 15 minutes to decompose the template DNA. After the reaction, the protein was removed by phenol-chloroform extraction and concentrated using Amicon Ultra (0.5mL, 10K) (Merck Millipore). Then, purification was carried out by ethanol precipitation and reverse-phase HPLC. After removing the acetonitrile with a centrifugal evaporator, ethanol precipitation was performed. The absorbance of the nucleic acid aqueous solution at 260nm was measured to determine the concentration. The results are shown in Fig.34 .

[0388] (3) Chemical synthesis of RNA

[0389] Using Universal UnyLinker Support CPG(ChemGenes), 3'-TOM riboAdenosine(n-acetyl)2'-lcaa CPG (ChemGenes), 2'-TOM ribo Cytidine (n-acetyl) 3'-lcaa CPG (ChemGenes), 2'-TOM ribo Guanosine(n-acetyl)CPG (ChemGenes), 2'-TOM ribo Uridine 2'-lcaa CPG (ChemGenes), synthesized by a nucleic acid automatic synthesizer. The 5' end was phosphorylated using 5'-Phosphate-ON Reagent (ChemGenes). After synthesis, CPG was transferred to a 1.5 mL ring threaded tube (Sarstedt), 1 mL of 40% methylamine aqueous solution / 28% ammonia aqueous solution (1:1) was added, and incubated at 65°C for 30 minutes. After cooling on ice, it was filtered using a Millex LH 0.45μm filter, washed with 0.75 mL of MQ water, and dried and solidified using a centrifugal evaporator. 1 mL of 1M TBAF in THF solution was added and allowed to stand overnight at room temperature. 1 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. After desalting using a NAP-25 column (GE Healthcare), it was purified by ethanol precipitation and reverse phase HPLC. After removing acetonitrile using a centrifugal evaporator, ethanol precipitation was performed, and the concentration of the nucleic acid aqueous solution was determined by measuring the absorbance at 260 nm. The results are expressed in Fig.35 .

[0390] [Table 4]

[0391] LC-MS

[0392]

[0393] (4) Chemical capping of RNA

[0394] Add RNA aqueous solution and CaCl into a 1.5 mL tube. 2 The aqueous solution was dried and solidified by freeze drying. The capping reagent and 2-nitroimidazole dissolved in DMSO were added to it and the volume was fixed with DMSO. The composition of the final capping reaction solution is as follows (20μM RNA, 10mM CaCl 2 , 10mM capping reagent, 10mM 2-nitroimidazole, fixed to volume with DMSO). After incubating the reaction solution at 55°C for 3 hours, purify it by Amicon Ultra (Merck Millipore, 0.5mL, 3K) and ethanol precipitation, and determine the concentration of the nucleic acid aqueous solution by absorbance measurement at 260nm. Then, analyze it using denaturing PAGE. Mix 3pmol of RNA with 2×formamide loading solution, heat it at 80°C for 5 minutes, and then load it on the gel. Electrophoresis is performed at 25mA for 2 hours or at 20mA for 2.5 hours. After staining with SYBR Green II, the gel is photographed using ChemiDoc. The capping efficiency is calculated from the band intensity. The results are shown in Fig.36 .

[0395] [Table 5]

[0396] LC-MS

[0397]

[0398] (2) Annealing-luminescence measurement

[0399] Prepare annealing solution (0.1 μM ATF4_Renilla mRNA, 1 μM csRNA (SEQ ID NOs. 52-55), 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA (pH 8.0)) and heat at 80°C for 5 minutes. Then, slowly cool to room temperature to anneal the mRNA and csRNA. One day before transfection, place 1.5 × 10 4 HeLa cells suspended in 100 μL of D-MEM (Wako) containing 10% FBS were inoculated per well. The next day, the medium was removed and the annealed mRNA was transfected using Lipofectamine (registered trademark) MessengerMAX (registered trademark) (Thermo Fisher SCIENTIFIC) (0.3 μL of Lipofectamine (registered trademark) MessengerMAX (registered trademark), 1 μL of annealing solution, and fixed to 100 μL with Opti-MEM (registered trademark) (Thermo Fisher SCIENTIFIC). The cells were incubated at 37°C and 5% CO. 2 After incubation for 3 hours at 37°C and 5% CO, the medium was removed and 100 μL of D-MEM (Wako) containing 10% FBS was added. 2 After incubation for 3.5 hours at room temperature, the culture medium was removed and 20 μL of 1× Renilla Luciferase Assay Lysis Buffer (Promega) was added for lysis. 10 μL of the lysate was mixed with 30 μL of Renilla Luciferase Assay Reagent (Promega) for luminescence measurement.

[0400] Fig.43 (a) shows the sequence of the newly designed csRNA. The complementary strand region to the mRNA is underlined. The sequences are all recorded in the 5'→3' direction. (b) shows the secondary structure of ATF4-Renilla mRNA 5'UTR. The binding position of the csRNA is indicated by a mark in the figure.

[0401] Fig.44It is a figure showing the optimization of the binding position of csRNA. (a) is a schematic diagram of mRNA and csRNA used in translation. The red circle in the figure represents the cap structure. (b) is a figure showing the luminescence measurement of luciferase in HeLa cells. It represents the relative value when the luminescence intensity of mRNA (cap (-)) or mRNA (cap (+)) is 1. The error bar represents the standard error of the average of 3 experiments.

[0402] These results show that the translation promotion effect is enhanced (the translation amount of both mRNA cap (-) and mRNA cap (+) is greatly increased) by designing csRNA so that mRNA binds to a region that is considered not to form a double strand in the molecule.

[0403] 13. Translation reaction of csRNA with chemical modification (OMe, LNA) in HeLa cell extract ( Fig.45 )

[0404] (1) Synthesis of circular NanoLuc mRNA by in vitro transcription

[0405] In order to introduce a monophosphate group at the 5' end, an in vitro transcription reaction was performed with the following composition in which the ratio of GMP to GTP was set to 4:1. A transcription reaction solution (10 ng / μL template DNA, 1× T7 polymerase buffer (takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl 2 , 2mM spermidine), 5mM DTT, 2mM ATP, 2mM CTP, 2mM UTP, 2mM GTP, 10mM GMP, 2.5U / μL T7 RNA polymerase, made up to volume with MQ water), and incubated at 37°C for 2 hours. Recombinant DNaseI (takara) was added to the reaction solution to make it 0.1U / μL, and incubated at 37°C for 15 minutes to decompose the template DNA. After the reaction, the protein was removed by phenol-chloroform extraction and concentrated using Amicon Ultra (Merck Millipore, 0.5mL, 10K). Then, it was purified by ethanol precipitation and reverse-phase HPLC. After removing the acetonitrile with a centrifugal evaporator, ethanol precipitation was performed. The absorbance of the nucleic acid aqueous solution was measured at 260nm to determine the concentration. The results are shown in Fig.37 .

[0406] (2) Circularization reaction of circular NanoLuc mRNA

[0407] 1 mL of reaction solution (0.5 μM mRNA, 1.0 μM splint DNA, T4 RNA ligase II, 1×T4 RNA ligase II buffer, 10% PEG8000, fixed to volume with MQ water) was prepared and incubated at 37°C for 1 hour. Recombinant DNase I (takara) was added to the reaction solution to make it 0.1 U / μL, and incubated at 37°C for 15 minutes to decompose the splint DNA. After the reaction, the protein was removed by phenol-chloroform extraction and concentrated using Amicon Ultra (0.5 mL, 10K) (Merck Millipore). Then, ethanol precipitation was performed, and the progress of the cyclization reaction was confirmed by 5% denaturing PAGE. Then, denaturing PAGE was used to separate and purify the circular mRNA. The gel containing the target band was cut out by UV shadowing, and the cut gel was fully crushed. The gel slice was immersed in 2 mL of MQ water and soaked overnight at 4°C to extract RNA. Centrifuged at 10,000 rpm for 5 minutes at 4°C, and the supernatant was recovered. Add 500 μL of MQ water to the gel slice again, centrifuge in the same manner, and recover the supernatant. Filter all the recovered supernatant through a filter (Millex-LCR, 0.45 μm (Merck Millipore)) to remove the mixed gel slice. Desalt and concentrate the filtrate through ultrafiltration (Amicon Ultra (0.5 mL, 10K) (Merck Millipore)) and then precipitate with ethanol. Measure the absorbance of the nucleic acid aqueous solution at 260 nm to determine the concentration. The results are shown in Fig.38 .

[0408] (3) Synthesis of csRNA for circular Nluc mRNA (Nluc-csRNA_polyA, Nluc-csRNA_polyA_OMe, Nluc-csRNA_polyA_LNA)

[0409] (a) RNA synthesis

[0410] RNA synthesis was performed at a 0.2 μmol scale using NTS M-2-MX DNA / RNA synthesizer or NRs-4A10R7 DNA / RNA synthesizer from Japan Techno Service Co., Ltd. The phosphoramidites used in RNA solid phase synthesis were rA (5'-DMT-2'-TOM-ribo-Adenosine (n-acetyl) OP), rC (5'-DMT-2'-TOM-ribo-Cytidine (n-acetyl) OP), rG (5'-DMT-2'-TOM-ribo-Guanosine (n-acetyl) OP), and U (5'-DMT-2'-TOM-ribo-Uridine OP) (ChemGenes). The phosphorylation reagent used was 5'phosphate-ON Reagent (ChemGenes). 2'-OMe RNA phosphoramidites used were 2'-OMe-C-CE-phosphoramidite and 2'-OMe-G(iBu)-CE-phosphoramidite (ChemGenes). LNA phosphoramidites used were MBN-Ganosine(N,N-DMF)-phosphoramidite (ChemGenes) and MBN-5'-Methyl-Cytidine(N-bz)-phosphoramidite (ChemGenes). CPG used was 3'-TOM-ribo Cytidine(n-acetyl)2'-lcaaCPG 3'-TOM-ribo Adenosine(n-acetyl)2'-lcaa CPG (ChemGenes), 3'-phosphate ON lcaa CPG 1000A. After synthesis, CPG was transferred to a 1.5 mL ring threaded tube (Sarstedt), 1.0 mL of 40% methylamine aqueous solution / 28% ammonia aqueous solution (1:1) was added, and incubated at 65°C for 20 minutes. Filtered using a Millex LH 0.45 μm filter, washed with sterile water (500 μL), and dried and solidified using a centrifugal evaporator. 1.0 mL of 1M TBAF THF solution was added to dissolve it and allowed to stand at room temperature overnight. 1.0 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. Desalting was performed using a NAP-25 column (GE Healthcare). Purification was performed by reverse phase HPLC. HPLC (HITACHI) conditions; chromatographic column: hydrosphere C18 column (4.6x250mm; YMC), mobile phase: A) 50mMTEAA buffer (pH7.0), 5% acetonitrile, B) acetonitrile, gradient: 0-20min B concentration 0% to 20%, flow rate: 1.0mL / min

[0411] Analyze by 15% denaturing polyacrylamide gel electrophoresis (PAGE) (acrylamide: bisacrylamide = 19: 1 (wt / wt), 7.5 M urea). PAGE uses TBE buffer (89 mM Tris-borate, 2 mM EDTA, pH 8.3). Analyze by LC / MS. LC / MS (agilent) conditions; ACQUITY UPLC BEH C18 Column, 0.3 mL / min, A; 8.6 mM TEA / 100 mM HFIP solution, B; MeOH, 0-30% / 20 min. The results are shown in Fig.39 .

[0412] LC-MS

[0413] Nluc-sRNA_polyA; calcd.16259.1, obs.16261.4

[0414] Nluc-sRNA_polyA_OMe; calcd.16287.1, obs.16289.5

[0415] Nluc-sRNA_polyA_LNA; calcd.16373.2, obs.16375.2

[0416] (4) Phosphorylated RNA capping reaction

[0417] In a 1.5 mL tube, add RNA at a final concentration of 20 μM, CaCl at 10 mM, 2 Mix, freeze-dry and solidify, and then dissolve in DMSO. Add Im(m7GDP)·Na (Hongene Biotech) dissolved in DMSO to a final concentration of 10mM, and add 2-nitroimidazole to a final concentration of 10mM. Incubate the reaction solution at 55°C for 3 hours. Dilute the reaction solution 2 times with sterile water and precipitate with isopropanol. Perform HPLC purification. HPLC conditions; chromatographic column: hydrosphere C18column (4.6x250mm; YMC), mobile phase: A) 50mM TEAA buffer (pH7.0), 5% acetonitrile, B) acetonitrile, gradient: 0-20min B concentration 0% to 20%, flow rate: 1.0mL / min

[0418] Analyzed by LC / MS. LC / MS (agilent) conditions: ACQUITY UPLC BEH C18 Column, 0.3 mL / min, A: 8.6 mM TEA / 100 mM HFIP solution, B: MeOH, 0-30% / 20 min

[0419] HPLC-purified capped RNA was precipitated using isopropanol and sodium acetate (pH 5.2).

[0420] LC-MS

[0421] Nluc-csRNA_polyA; calcd.16699.3, obs.16701.0

[0422] Nluc-csRNA_polyA_OMe; calcd.16727.4, obs.16728.7

[0423] Nluc-csRNA_polyA_LNA; calcd.16813.5, obs.16814.9

[0424] (5) Chemical synthesis of RNA

[0425] Using Universal UnyLinker Support CPG (ChemGenes) was synthesized using a nucleic acid automatic synthesizer. The 5' end was phosphorylated using 5'-Phosphate-ON Reagent (ChemGenes). After synthesis, CPG was transferred to a 1.5 mL ring threaded tube (Sarstedt), 1 mL of 40% methylamine aqueous solution / 28% ammonia aqueous solution (1:1) was added, and incubated at 65°C for 30 minutes. After cooling on ice, it was filtered using a Millex LH 0.45μm filter, washed with 1 mL of MQ water, and dried and solidified using a centrifugal evaporator. 1 mL of 1M TBAF in THF solution was added and allowed to stand overnight at room temperature. 1 mL of 1M Tris-HCl buffer (pH 7.5) was added, and the organic solvent was distilled off using a centrifugal evaporator. After desalting using a NAP-25 column (GE Healthcare), it was purified using ethanol precipitation and reverse phase HPLC. After removing acetonitrile using a centrifugal evaporator, ethanol precipitation was performed, and the concentration of the nucleic acid aqueous solution was determined by measuring the absorbance at 260 nm. The results are expressed in Fig.40 .

[0426] [Table 6]

[0427] LC-MS

[0428]

[0429] (6) Chemical capping of RNA

[0430] Add RNA aqueous solution and CaCl into a 1.5 mL tube. 2 The aqueous solution was dried and solidified by freeze drying. The capping reagent and 2-nitroimidazole dissolved in DMSO were added to it and the volume was fixed with DMSO. The composition of the final capping reaction solution is as follows (20μM RNA, 10mM CaCl 2 , 10mM capping reagent, 10mM 2-nitroimidazole, fixed to volume with DMSO). After incubating the reaction solution at 55°C for 3 hours, ethanol precipitation and reverse phase HPLC were used for purification. After removing the acetonitrile with a centrifugal evaporator, it was concentrated by freeze drying, and the concentration of the nucleic acid aqueous solution was determined by measuring the absorbance at 260nm. Then, it was analyzed by denaturing PAGE. 10pmol of RNA was mixed with 2× formamide loading solution, heated at 80°C for 5 minutes, and loaded on the gel. After electrophoresis at 25mA for 2 hours, the gel was stained with SYBR Green II and photographed using ChemiDoc. The capping efficiency was calculated from the band intensity. The results are shown in Fig.41 , Fig.42 .

[0431] [Table 7]

[0432] LC-MS

[0433]

[0434] An annealing solution (0.2 μM circular NanoLuc mRNA, 0.4 μM csRNA (SEQ ID NOs. 56 to 58), 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA (pH 8.0)) was prepared and heated at 80°C for 5 minutes. Then, the mixture was slowly cooled to room temperature to anneal the mRNA and csRNA. Mixture-2 w / o DTT 4.85 μL, 50 mM DTT 1.648 μL, and HeLa cell extract 8.7 μL were mixed and incubated at room temperature for 10 minutes, and then Mixture-3 1.8 μL and annealing solution 1 μL were added. After incubation at 32°C for 4 hours, 1 μL of the reaction solution was mixed with 20 μL of Nano-Glo (registered trademark) Luciferase Assay Substrate (Promega) diluted with 1× Glo Lysis Buffer (Promega) and luminescence measurement was performed.

[0435] Fig.45 (a) shows the sequence of the csRNA after the introduction of chemical modification. The complementary strand region to the mRNA is underlined. m :2'OMe;Bold: LNA. Sequences are recorded in the direction of 5'→3'. (b) is a graph of luciferase luminescence measurement in HeLa cell extract. It shows the relative value when the luminescence intensity of circ.Nluc mRNA is set to 1. The error bar is the standard error of the average of 3 experiments.

[0436] From these results, it can be seen that cap structure-dependent translation promotion was observed in all csRNAs when annealing was performed (w / annealing). The effect was enhanced by introducing LNA. On the other hand, in the absence of annealing (w / oannealing), Nluc-csRNA_polyA_LNA had a high translation promotion effect, and it can be seen that by including LNA, an excellent effect is exerted even without annealing.

[0437] 14. Translation reaction of LNA-modified csRNA and circular mRNA in HeLa cells ( Fig.46 )

[0438] (1) Annealing-luminescence measurement

[0439] Prepare annealing solution (0.1 μM circular NanoLuc mRNA, 1 μM csRNA (SEQ ID NOs. 59-64), 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA (pH 8.0)) and heat at 80°C for 5 minutes. Then, slowly cool to room temperature to anneal the mRNA and csRNA. One day before transfection, place 1.5 × 10 4 HeLa cells suspended in 100 μL of D-MEM (Wako) containing 10% FBS were seeded per well. The next day, the medium was removed and the annealed mRNA was transfected using Lipofectamine (registered trademark) MessengerMAX (registered trademark) (Thermo Fisher SCIENTIFIC) (0.3 μL of Lipofectamine (registered trademark) MessengerMAX (registered trademark), 1 μL of annealing solution, and fixed to 100 μL with Opti-MEM (registered trademark) (Thermo Fisher SCIENTIFIC). The cells were incubated at 37°C and 5% CO 2 After incubation for 3 hours at 37°C and 5% CO, the medium was removed and 100 μL of D-MEM (Wako) containing 10% FBS was added. 2 After incubation for 3 hours at room temperature, the medium was removed and 20 μL of 1×Glo Lysis Buffer (Promega) was added for lysis. 10 μL of the lysate was mixed with 20 μL of Nano-Glo (registered trademark) Luciferase Assay Substrate (Promega) diluted with 1×Glo Lysis Buffer (Promega) for luminescence measurement.

[0440] Fig.46 (a) is the sequence of csRNA used in translation. The complementary chain region to mRNA is underlined. Bold: LNA. The sequences are all recorded in the direction of 5'→3'. (b) is the luciferase luminescence measurement in HeLa cells. It represents the relative value when the luminescence intensity of mRNA (cap (-)) or mRNA (cap (+)) is set to 1. The error bars are set to the standard error of the average of 3 experiments.

[0441] These results show that the activity of Nluc-csRNA_LNA_6 / 20 is greatly improved compared to natural csRNA.

Claims

1. A capped RNA, characterized in that: The capped RNA comprises a translation region starting from a start codon and encoding a protein, and an upstream region on the upstream side of the start codon, wherein the capped RNA includes a branch having a cap structure in the upstream region.

2. The capped RNA according to claim 1, characterized in that: The branch portion has at least one of the following structures (a) to (c): (a) a capping probe having a sequence complementary to a part or all of the sequence of the upstream region and having the cap structure hybridizes with the upstream region; (b) a branch chain branching from the middle of the main chain constituting the RNA is provided in a part of the upstream region, and the cap structure is provided on the branch chain; (c) The RNA is a linear RNA, and the 5' end of the main chain of the upstream region has a branched structure divided into two or more branches, and the cap structure is provided on each branch.

3. The capped RNA according to claim 2, characterized in that: In (a), the RNA is a circular RNA, The capping probe having a sequence complementary to a part or all of the sequence of the upstream region of the circular RNA and having a cap structure hybridizes with the upstream region of the circular RNA.

4. The capped RNA according to claim 2, characterized in that: In the above (a), the RNA is a linear RNA, A capping probe having a sequence complementary to a part or all of the upstream region of the linear RNA and having a cap structure hybridizes with the upstream region of the linear RNA.

5. The capped RNA according to claim 2, characterized in that: In (b), the RNA is a circular RNA, A branch chain branching from the middle of the main chain constituting the RNA is provided in a part of the upstream region of the circular RNA, and the cap structure is provided on the branch chain.

6. The capped RNA according to claim 2, characterized in that: In the above (b), the RNA is a linear RNA, A branch chain branching from the middle of the main chain constituting the RNA is provided in a part of the upstream region of the linear RNA, and the cap structure is provided on the branch chain.

7. The capped RNA according to claim 2, characterized in that: In the above (b), it has a structure represented by the following formula (3): Among them, m 7 G represents a cap, p represents a phosphate group; Nuc represents a polynucleotide formed by linking one or more natural or non-natural nucleotides; m represents an integer from 1 to 5, and multiple m's may be the same or different; RNA1 and RNA2 represent RNAs constituting the main chain, RNA1 is linked to a portion of the branch structure at the 3' end, and RNA2 is linked to a portion of the branch structure at the 5' end; the RNA of formula (3) may be a circular RNA in which the 5' end of RNA1 is linked to the 3' end of RNA2 to form a circular structure, or may be a straight-chain RNA in which the 5' end of RNA1 is not linked to the 3' end of RNA2.

8. The capped RNA according to claim 2, characterized in that: In the above (c), it has a structure represented by the following formula (1) or formula (2): Among them, m 7 G represents a cap, p represents a phosphate group, Gm represents a structure in which the 2'-hydroxyl group of the guanine nucleotide is methylated, m represents an integer of 1 to 5, and a plurality of m's may be the same or different, and n represents an integer of 1 to 5, and a plurality of n's may be the same or different.

9. The capped RNA according to claim 8, characterized in that: The formula (1) has a structure represented by the following formula (1-1), and the formula (2) has a structure represented by the following formula (2-1):

10. The capped RNA according to claim 1, characterized in that: The RNA has multiple translation regions.

11. The method for producing capped RNA according to claim 1, characterized in that: The method comprises at least one of the following steps (a) to (c): (a) hybridizing a capping probe having a sequence complementary to a part or all of the sequence of the upstream region and having a cap structure to the upstream region; or (b) synthesizing the RNA having a branched chain branching from the main chain constituting the RNA in a part of the upstream region, and then binding the cap structure to the branched chain; (c) After synthesizing the RNA as a linear RNA and having a branched structure in which the 5' end of the main chain of the upstream region is divided into two or more branches, the cap structure is bound to each branch.

12. A protein production device, characterized in that: include: The capped RNA according to claim 1; and a eukaryotic cell expression system capable of expressing the protein encoded by the translation region using the capped RNA as a template.

13. A method for producing a protein, characterized in that: The capped RNA according to claim 1 is added to an expression system of eukaryotic cells capable of expressing the protein encoded by the translation region using the capped RNA as a template, thereby expressing the protein.

14. A detection device for a target RNA having a cap structure at the 5' end of the RNA, characterized in that: include: A detection probe composed of a circular RNA, wherein the circular RNA has a translation region starting from a start codon and encoding a marker protein, and an upstream region on the upstream side of the start codon, wherein the upstream region has a sequence complementary to a part or all of the sequence of the target RNA to be detected; adding the circular RNA to a sample containing the target RNA, allowing the target RNA to hybridize with the upstream region of the circular RNA to generate a capped RNA unit; An expression system of eukaryotic cells capable of expressing the marker protein by adding the capped RNA; and Detecting the unit of the marker protein expressed by the expression system.

15. A method for detecting a target RNA having a cap structure at the 5' end of the RNA, characterized in that: include: A step of preparing a detection probe composed of a circular RNA, wherein the circular RNA has a translation region starting from a start codon and encoding a marker protein, and an upstream region on the upstream side of the start codon, wherein the upstream region has a sequence complementary to a part or all of the sequence of the target RNA to be detected; A step of adding the circular RNA to a sample containing the target RNA, allowing the target RNA to hybridize with the upstream region of the circular RNA to generate capped RNA; A step of adding the capped RNA to an expression system of eukaryotic cells capable of expressing the marker protein to express the marker protein; and A step of detecting the marker protein expressed by the expression system.

16. A capped RNA, characterized in that: It is a capped RNA having a cap structure in the non-translated region of an RNA having a translation region that starts from a start codon and encodes a protein and a non-translated region on the upstream side of the start codon, The capped RNA has at least one of the following structures (a) to (c): (a) a capping probe having a sequence complementary to a part or all of the sequence of the untranslated region and having a cap structure hybridizes with the untranslated region; (b) a branch chain branching from the middle of the main chain constituting the RNA is provided in a part of the untranslated region, and the cap structure is provided on the branch chain; (c) The RNA is a linear RNA, the 5' end of the main chain of the untranslated region has a branched structure divided into two or more branches, and the cap structure is provided on each branch.

Images