Preparation method of exocrine protein PC and its application in regulating intestinal flora

The intestinal flora is regulated through exocrine protein Pc, and the non-targeting problem of regulating intestinal flora in the prior art is solved, and the intestinal flora is achieved targeted regulation, promoting host health, and is applied in food, drugs and feed.

CN119679920BActive Publication Date: 2025-08-29NANKAI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411653192.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-08-29
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

The existing methods of regulating intestinal flora have non-targeting and potential risks, and cannot effectively target and regulate intestinal flora, affecting host health.

Method used

Exocrine protein Pc is used, which contains β-N-acetylglucosidase (GL) domain protein. By binding to specific bacteria in the intestinal bacteria, it regulates its proliferation and autolysinase activity, reduces iron absorption and ROS pressure, promotes the proliferation of beneficial bacteria, and inhibits the formation of pathogenic bacteria biofilms.

Benefits of technology

It has achieved targeted regulation of intestinal bacteria, promoted host health, enriched beneficial bacteria, and reduced the formation of pathogenic bacteria. It is used in food, drugs and feed, and has potential prebiotic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119679920B_ABST
    Figure CN119679920B_ABST
Patent Text Reader

Abstract

The present invention relates to a preparation method of an exocrine protein Pc and its application in regulating intestinal flora. The fungal-derived Pc protein directly interacts with a protein in the intestinal microorganisms that has exocrine properties and contains a β-N-acetylglucosaminidase (GL) domain and inhibits its enzymatic activity, thereby regulating the proliferation of beneficial microorganisms by alleviating cellular iron and ROS pressure. The Pc protein can regulate the expression of bifunctional autolysins, and can enrich beneficial Staphylococcus bacteria with bifunctional autolysins in the insect intestine, or can enrich beneficial Lachnospiraceae bacteria with bifunctional autolysins in the intestines of healthy mammalian mice, or can enrich Blautia bacteria in the intestines of obese mice induced by a high-fat diet, or can enrich Akkermansia bacteria in the intestines of mice with DSS-induced colitis. The Pc protein can significantly reduce the formation of biofilms of Staphylococcus aureus (S. aureus) with bifunctional autolysins. Pc protein can be used as a new potential prebiotic to regulate the proliferation of beneficial intestinal microorganisms with bifunctional autolysins, and has potential application value in the preparation of food, medicine and disease treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological preparations, and in particular relates to a method for preparing an exocrine protein Pc and its application in regulating intestinal flora. Background Art

[0002] The vast and diverse intestinal flora, forming an ecological barrier that protects against invasion by pathogenic and potentially pathogenic bacteria, plays a crucial role in animal growth and health. Gut microbial homeostasis is crucial for maintaining host health and growth. Research has shown that various substances and approaches can regulate gut microbial balance, including probiotics, prebiotics, antibiotics, immunoglobulins, and fecal microbiota transplants. However, these approaches are non-targeted and often carry potential risks and side effects. Summary of the Invention

[0003] In order to solve the above technical problems, the present invention provides a method for preparing an exocrine protein Pc and its application in regulating intestinal flora.

[0004] The technical solution adopted by the present invention is: application of exocrine protein Pc in regulating intestinal flora.

[0005] Preferably, the exocytic protein Pc regulates the protein having exocytic properties and containing the β-N-acetylglucosaminidase (GL) domain, and promotes the proliferation of bacteria containing the protein having exocytic properties and containing the β-N-acetylglucosaminidase (GL) domain.

[0006] Preferably, the protein having exocrine properties and containing a β-N-acetylglucosaminidase (GL) domain is an autolysin.

[0007] Preferably, the Pc protein binds to the β-N-acetylglucosaminidase domain of the autolysin, thereby inhibiting the enzymatic activity of the autolysin, resulting in the inhibition of cell wall degradation during cell division.

[0008] Preferably, the expression of genes related to iron absorption is downregulated to reduce cellular iron absorption and alleviate cellular ROS pressure.

[0009] Preferably, the Pc protein promotes the proliferation of one or more of the bacteria of the genus Staphylococcus, the bacteria of the family Lachnospiraceae, the bacteria of the genus Blautia of the family Lachnospiraceae, and the bacteria of the genus Akkermansia;

[0010] Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the genus Staphylococcus in the insect gut;

[0011] Preferably, the Pc protein promotes the enrichment of beneficial bacteria of the Lachnospiraceae family in the intestines of healthy mammals;

[0012] Preferably, the Pc protein promotes the enrichment of Blautia bacteria in the intestines of high-fat diet-induced obese mice;

[0013] Preferably, the Pc protein promotes the enrichment of Akkermansia bacteria in the intestines of mice with DSS-induced colitis.

[0014] Preferably, the formation of biofilms of S. aureus bacteria having bifunctional autolysins is inhibited.

[0015] An additive comprising one or more of an exogenous protein Pc, a natural microorganism containing the Pc protein, and an engineered bacterium capable of heterologously expressing the Pc protein;

[0016] Preferably, the natural microorganism containing Pc protein is Penicillium herquei cultivated by Knotweed Leaf Weevil;

[0017] Preferably, a vector engineering bacterium for heterologously expressing Pc protein is constructed, the engineered bacteria are cultured, and the expression of Pc protein is induced by BL21 (DE3); the primary Pc protein is preliminarily purified using a nickel affinity purification column, and then the Pc protein is eluted using a Tris-HCl (pH 7.8-8.0) solution containing 0.2M sodium chloride through a DEAE-Sepharose FF anion exchange column to obtain the Pc protein.

[0018] Preferably, it can be used in food, feed or medicine;

[0019] Preferably, it is used in health food.

[0020] Application of exoprotein Pc in drugs for treating enteritis.

[0021] The advantages and positive effects of the present invention are: providing a Pc protein that can target and regulate intestinal flora, which can be used as a new potential prebiotic in food, medicine or feed; by interacting with exosomes containing GL domains in bacteria in the intestinal flora, regulating the proliferation of such bacteria, thereby promoting host health;

[0022] The Pc protein regulates the expression of bifunctional autolysins, enriching beneficial Staphylococcus bacteria with bifunctional autolysins in the guts of insects, Lachnospiraceae bacteria with bifunctional autolysins in the guts of healthy mice, Blautia bacteria in the guts of high-fat diet-induced obese mice, and Akkermansia bacteria in the guts of mice with DSS-induced colitis. The Pc protein significantly reduces biofilm formation by Staphylococcus aureus (S. aureus) bacteria with bifunctional autolysins.

[0023] Pc protein can be used as a new potential prebiotic to regulate the proliferation of beneficial intestinal microorganisms with bifunctional autolysins, and has potential application value in the preparation of food, medicine and disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Subcellular localization of Pc protein after fusion with mCherry;

[0025] Figure 2 Effects of hyphae of Pc gene knockout strain on the body weight of Tenebrio molitor;

[0026] Figure 3 Effects of mycelial exosomes of Pc gene knockout strain on the body weight of Tenebrio molitor;

[0027] Figure 4 Effects of purified Pc protein on body weight of Tenebrio molitor;

[0028] Figure 5 Effects of hyphae of Pc gene knockout strain on intestinal microorganisms of Tenebrio molitor;

[0029] Figure 6 Effects of heterologous expression of purified Pc protein on the intestinal microbiota of Tenebrio molitor;

[0030] Figure 7 The antibiotic feeding method was used to establish intestinal sterility in Tenebrio molitor larvae; a, Cultivation of intestinal microorganisms of the control group (CK) and antibiotic-treated group (FB) larvae in different culture media under aerobic and anaerobic conditions; b, Verification of intestinal bacterial survival in the control group and antibiotic-treated group larvae;

[0031] Figure 8 Effects of Pc protein on the body weight of intestinal sterile mealworms;

[0032] Figure 9Effects of Staphylococcus bacteria on the body weight of intestinal sterile mealworms; CK, blank control group supplemented with PBS; Pc, group fed with Pc protein; Ssu, group supplemented with S. succinus bacteria; Skl, group supplemented with S. kloosii bacteria; Sxy, group supplemented with S. xylosus bacteria; Sga, group supplemented with S. gallinarum bacteria; Ssa, group supplemented with S. saprophyticus bacteria; Hhu, group supplemented with Herbaspirillum huttiense bacteria; Tin, group supplemented with Tenebrionibacter intestinalis bacteria; Kin, group supplemented with Kluyvera intermedia bacteria;

[0033] Figure 10 Effects of Pc protein on the proliferation of Staphylococcus bacteria in liquid culture in vitro; a shows the growth of S. kloosii, b shows the growth of S. succinus, and c shows the growth of S. gallinarum.

[0034] Figure 11 Schematic diagram of the docking of Pc protein and bifunctional autolysin (Atl) molecule;

[0035] Figure 12 Verify that Pc protein binds to the bifunctional autolysin (Atl) of Staphylococcus bacteria;

[0036] Figure 13 Pc protein inhibits the activity of the bifunctional autolysin enzyme;

[0037] Figure 14 Pc protein regulates the expression of S. kloosii bifunctional autolysin and other iron absorption-related genes;

[0038] Figure 15 Pc protein down-regulates S. kloosii autolysin-dependent iron uptake and cellular ROS stress;

[0039] Figure 16 Pc protein enriches Lachnospiraceae bacteria with bifunctional autolysins in the intestines of disease-free mice;

[0040] Figure 17 Pc can bind to exosome-containing proteins containing GL domains from various bacteria. Structures a1-a28 in the figure show the molecular docking results of Pc with exosome-containing proteins containing GL domains from different bacteria listed in Table 2. Blue represents Pc protein, green represents exosome-containing proteins containing GL domains, and brown represents GL domains.

[0041] Figure 18Pc can significantly reduce the biofilm formation of Staphylococcus aureus;

[0042] Figure 19 Pc can effectively alleviate high-fat diet-induced obesity by regulating intestinal microbiota; a, DIO mouse model feeding experimental plan; b, mouse body weight changes before Pc protein gavage; c, mouse body weight changes during Pc protein gavage; d, total body fat weight of mice after feeding; e, H&E staining of epididymal adipose tissue; f, average size of epididymal adipocytes; g, H&E and Oil Red O (ORO) staining of liver tissue

[0043] staining; h, Changes in intestinal microorganisms of mice in each group;

[0044] Figure 20 Pc can effectively alleviate DSS-induced colitis by regulating intestinal microbiota. a, Experimental plan for feeding colitis (UC) model mice; b, Changes in mouse weight before DSS treatment; c, Changes in mouse weight during DSS treatment; d, Changes in disease severity index (DAI) of each group of mice during DSS treatment; e, Statistical results of colon length of each group of mice after DSS treatment; f, Comparison of colon length of each group of mice after DSS treatment; g, Comparison of spleen index of each group of mice after DSS treatment; h, Comparison of spleen size of each group of mice after DSS treatment; i, H&E staining results of paraffin-embedded colon tissue sections of each group of mice after DSS treatment; j, Changes in intestinal microbiota of each group of mice after DSS treatment. DETAILED DESCRIPTION

[0045] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0046] The present invention relates to a novel preparation method of exoprotein Pc and its application in targeted regulation of intestinal flora. Exoprotein Pc was originally extracted from the protruding appendages outside the hyphae of the leaf-rolling weevil cultivation fungus Penicillium herquei. Exoprotein Pc regulates proteins with exosome properties and containing a β-N-acetylglucosaminidase (GL) domain, promoting the proliferation of bacteria containing proteins with exosome properties and containing a β-N-acetylglucosaminidase (GL) domain. Exoprotein Pc is expected to serve as a new potential prebiotic for regulating the proliferation of beneficial intestinal microorganisms, including those with exosome properties and containing a β-N-acetylglucosaminidase (GL) domain, such as Staphylococcaceae or Lachnospiraceae bacteria. Based on this characteristic, exoprotein Pc has potential application value in the preparation of food, medicine and the treatment of diseases.

[0047] The nucleotide sequence (including introns) of the exoprotein Pc is shown in GenBank accession number PP496239. This gene originates from the fungus Penicillium herquei, which is cultivated by the leaf weevil. The exoprotein Pc was produced by constructing a heterologous expression vector for this gene and expressing it in Escherichia coli BL21(DE3). The purified Pc protein can be used for experimental research on its function or directly added to food or feed.

[0048] Pc protein can play a pro-growth role by regulating intestinal microorganisms. Feeding experiments have shown that Pc protein can enrich beneficial bacteria of the genus Staphylococcus with bifunctional autolysins in the insect intestine, thereby achieving a pro-growth effect. In addition, Pc protein can also enrich beneficial bacteria of the family Lachnospiraceae with bifunctional autolysins in the intestines of disease-free C57BL / 6J mice, and also play a regulatory role in the regulation of intestinal microorganisms in mammalian mice. In addition, Pc protein can also produce certain therapeutic effects on diseased mouse models, enriching Blautia bacteria in the intestines of high-fat diet-induced obese mice, or enriching Akkermansia bacteria in the intestines of DSS-induced colitis mice, thereby promoting host health.

[0049] Molecular modeling and docking results also showed that the Pc protein can bind to proteins with exocytic properties and β-N-acetylglucosaminidase (GL) domains from various beneficial bacteria used in food production. The Pc protein can regulate the expression of bacterial bifunctional autolysins. Binding to the β-N-acetylglucosaminidase domain of autolysins inhibits their enzymatic activity, hindering cell wall degradation during cell division. Furthermore, the Pc protein regulates the expression of genes involved in iron absorption, thereby reducing bacterial iron absorption and alleviating cellular ROS stress, thereby promoting the proliferation of beneficial bacteria. When regulating intestinal microbes, the Pc protein directly binds to bifunctional autolysins of insect gut microbes to inhibit their enzymatic activity. This, in turn, regulates the proliferation of beneficial microbes with bifunctional autolysins (Atl) by alleviating cellular iron and ROS stress, thereby promoting host growth.

[0050] In addition, the Pc protein can significantly reduce the formation of biofilms of Staphylococcus aureus (S. aureus) that possesses bifunctional autolysins. Therefore, this protein is expected to serve as a new potential prebiotic for regulating the proliferation of beneficial intestinal microorganisms with bifunctional autolysins. Pc protein originates from the insect symbiotic system and can be consumed by the symbiotic host insects without toxic effects. The protein can also bind to the β-N-acetylglucosaminidase (GL) domain in the exoproteins of intestinal bacteria, thereby directly targeting and regulating the proliferation of probiotic bacteria containing exoproteins containing the GL domain, thereby promoting host health.

[0051] The present invention is described below with reference to the accompanying drawings. Experimental methods without specific operating steps are carried out in accordance with the corresponding product specifications. Unless otherwise specified, the instruments, reagents, and consumables used in the examples can be purchased from commercial companies.

[0052] Example 1: Preparation of exocrine protein Pc

[0053] The gene sequence for the Pc protein is derived from the fungus Penicillium herquei, which is cultivated by the leaf weevil. The gene sequence (including introns) has been uploaded to the NCBI database, with accession number PP496239. The pET-32M plasmid was used as the heterologous protein expression vector. The plasmid was linearized and the TrxA tag sequence was removed by double digestion with XbaI and XhoI. The Pc gene was amplified using a high-fidelity enzyme and the cDNA as a template using the primers shown in SEQ ID No. 1 and SEQ ID No. 2. The Pc gene was then ligated into the linearized vector by seamless cloning.

[0054] The primer sequences are as follows:

[0055] SEQ ID No. 1Pc3-3:

[0056] GGATAACAATTCCCCTCTAGAAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTTGATAAGTGGCAGCCA

[0057] SEQ ID No.2Pc4:

[0058] GTGGTGGTGGTGGTGCTCGAGAGCAGTAATAGTAAACGGGCCAG

[0059] The ligated plasmid was first transformed into Escherichia coli DH5α competent cells using the heat shock transformation method for plasmid amplification, and then the amplified plasmid was used to transform the Escherichia coli expression strain BL21 (DE3) and the primers shown in SEQ ID No. 3 and SEQ ID No. 4 were used to verify the positive transformants.

[0060] The primer sequences are as follows:

[0061] SEQ ID No. 3Pet-YF1

[0062] ATACCCACGCCGAAACAA

[0063] SEQ ID No. 4Pet-YR

[0064] GCTTTGTTAGCAGCCGGATCT

[0065] Positive transformants were cultured in LB medium until OD 600 The expression of protein was induced at 16 °C and 150 rpm for 12 h or overnight using 500 μM isopropyl-β-D-thiogalactopyranoside (IPTG).

[0066] Use a 50ml centrifuge tube to collect the induced expression bacteria by centrifugation at 4°C and 10000rpm for 3 minutes, and collect 150ml of bacterial culture fluid per tube. Subsequently, add 15-20ml of lysis buffer (300mM NaCl, 50mM NaH2PO4.2H2O, 10mM imidazole, pH7.8-8.0) to fully resuspend the bacteria, and after ultrasonic disruption, centrifuge at 4°C for 15 minutes. Collect the supernatant and filter it using a 0.45μm filter. Use nickel affinity filler to adsorb the Pc protein with His tag, and use an eluent containing 250mM imidazole (300mM NaCl, 50mM NaH2PO4.2H2O, 10mM imidazole, pH7.8-8.0) to elute and collect the target protein. The obtained target protein is dialyzed using Tris-HCl solution (20mM Tris, HCl adjusted to pH 7.8-8.0). The dialyzed protein solution was passed through a DEAE-Sepharose FF anion exchange column, and the Pc protein was eluted and purified using Tris-HCl (20 mM Tris, HCl adjusted to pH 7.8-8.0) containing 0.2 M NaCl, and then dialyzed into PBS for storage.

[0067] Example 2: Study on the expression of Pc protein in the fungus cultivated by leaf weevils

[0068] The Pc-mCherry fusion red fluorescent protein was constructed using the pFGL815N plasmid as a backbone and then transformed into the leaf weevil culturing fungus Penicillium herquei. The formed hyphae were observed to explore the expression location of the Pc protein. The results are as follows Figure 1 As shown, the extrahyphae appendages showed red fluorescence, confirming the excretion of Pc protein into the hyphal appendages.

[0069] Example 3: Effects of feeding exoprotein Pc on mealworm larvae

[0070] 3.1 Effects of Pc protein-containing cultured mycelium on the body weight of Tenebrio molitor larvae

[0071] Tenebrio molitor larvae (0.8-1 cm in length) were used as a feeding model. Mycelium of the fungus Penicillium herquei, cultured on leaf-rolling weevils, was freeze-dried and added to a basal diet of wheat bran. Weight gain was measured after six days of feeding at room temperature. The model mealworm larvae were divided into five groups. Before the experiment, 1 gram of mealworm larvae was accurately weighed in each group. 40 mg of freeze-dried cultured mycelium, cultured Pc gene knockout strain 1, cultured Pc gene knockout strain 2, and wild-type mycelium isolated and purified from the environment were added, in that order. The cultured mycelium refers to the symbiotic Penicillium herquei cultured on the leaf-rolling weevil. Pc knockout strains 1 and 2 are derived from two Pc knockout strains derived from the pFGL815N and pAg1-H3 plasmid backbones by knocking out both copies of the Pc gene. Wild-type mycelium refers to Penicillium herquei isolated and purified from the environment.

[0072] The mycelium of each group was ground and added to 4g of basic feed wheat bran. The moisture content of the feed was adjusted to 18%. The experimental group of mealworm larvae was fed at room temperature. The mealworm larvae were fed directly with basic feed wheat bran without adding any additives as the control group. After feeding for 6 days, the weight of the mealworm larvae in each group was weighed. The results are as follows: Figure 2 As shown, the results showed that the cultivated hyphae containing Pc protein could significantly promote the growth of larvae, while the cultivated hyphae of Pc gene knockout strain lacked the expression of Pc protein, so the larvae grew slower than other groups.

[0073] The mycelial appendages of cultured mycelia, cultured Pc gene knockout mycelia, and wild-type mycelia isolated from the environment were extracted and collected using 50% methanol aqueous solution. After freeze-drying, 20 mg of the powder was dissolved in an appropriate amount of water and mixed with 4 g of wheat bran to adjust the moisture content of the feed to 18%. After feeding at room temperature for 6 days, the weight of the mealworm larvae in each group was weighed. The results are as follows: Figure 3 As shown in the results, the mycelial appendages of the cultivated strain containing Pc protein can significantly promote the growth of larvae, while the exocrine appendages of the mycelium of the cultivated Pc gene knockout strain cannot promote the growth of larvae, indicating that Pc protein has a significant effect on the growth of Tenebrio molitor larvae; by feeding the mycelium of the Pc gene knockout strain and the exocrine appendages of the knockout strain mycelium respectively, it was confirmed that Pc protein is a key protein that promotes the growth of Tenebrio molitor larvae.

[0074] 3.2 Effects of heterologous expression of purified Pc protein on the body weight of Tenebrio molitor larvae

[0075] Tenebrio molitor larvae (0.8-1 cm in length) were selected as the feeding model. 200 μg of purified Pc protein was added to 2 g of basal feed wheat bran, and the moisture content of the feed was adjusted to 18% using PBS. Uc protein and bovine serum albumin (BSA) were also used as control proteins. After six days of feeding at room temperature, the weight of each group of mealworm larvae was weighed. Uc protein, an unknown protein identified from mycelial exudates, was named Uc because its content in mycelial exudates is second only to Pc protein and it is also a low-molecular-weight protein (approximately 12 kDa). Therefore, Uc protein was selected as the control protein.

[0076] The results are as follows Figure 4 As shown, the results showed that heterologous expression of purified Pc protein could significantly promote larval growth.

[0077] Example 4: Effect of Pc protein on the intestinal flora of Tenebrio molitor larvae

[0078] The intestinal flora of the mealworms raised in Example 3 was analyzed. The intestinal tracts of the mealworm larvae fed with the Pc gene knockout strain hyphae and the mealworm larvae fed with purified Pc protein were extracted, and the abundance of intestinal bacteria was determined by 16S amplicon sequencing. The results showed that both feeding with hyphae containing Pc protein and feeding with heterologously expressed purified Pc protein significantly enriched Staphylococcus bacteria. Figure 5 As shown, the blank control group refers to the group fed with only basic wheat bran feed; the Pc knockout strain mycelium group refers to the group fed with cultured mycelium with Pc gene knockout; the Pc non-knockout strain mycelium group refers to the group fed with cultured mycelium with Pc gene not knocked out; from the comparison of the results, it can be seen that the intestinal tract of the cultured mycelium group with Pc gene not knocked out was significantly enriched with Staphylococcus bacteria. Figure 6 As shown in the figure, the Pc protein group, which was fed with wheat bran supplemented with Pc protein, also showed a significant enrichment of Staphylococcus bacteria in the intestines of mealworms. These results further support the idea that Pc protein can promote the growth of mealworm larvae and significantly enrich Staphylococcus bacteria in the larval intestines.

[0079] Example 5: Effect of Pc on intestinal sterile mealworm larvae

[0080] 5.1 Preparation of intestinal sterile mealworm larvae

[0081] An appropriate number of mealworm larvae were placed in sterile Petri dishes and fed wheat bran containing bacterial and fungal antibiotics. Per gram of feed, 300 μl of fungal antibiotics (0.5 mg / ml fluconazole, 0.1 mg / ml amphotericin B, and 1 mg / ml 5-fluorocytosine) and 300 μl of bacterial antibiotics (0.125 mg / ml ciprofloxacin, 0.1 mg / ml metronidazole, 0.05 mg / ml vancomycin, 100 U streptomycin, and 100 U penicillin) were added. The Petri dishes and feed were replaced daily for 5 consecutive days. Three larvae were randomly selected, and the larval intestines were removed using a sterile scalpel and forceps and placed in a 1.5 ml sterile centrifuge tube. 1 ml of sterile water was added, and the intestines were ground using a sterile grinding rod. The tubes were centrifuged at low speed, and the supernatant was diluted 10-fold before being applied to LA, PDA, M17, and Lactobacillus (Lact) culture media, respectively. The supernatant was then cultured under anaerobic and aerobic conditions. The growth of microorganisms was observed and the results showed that no microorganisms remained in the intestines of the larvae after 5 days of antibiotic intake. Figure 7 As shown in a.

[0082] Five larval intestines were used to extract intestinal bacterial genomic DNA using the CTAB method. The following steps were performed: crush the obtained intestines in a centrifuge tube; briefly centrifuge the intestinal fluid at 800 rpm and collect the supernatant; add PBS to the precipitate, briefly centrifuge with shaking and collect the supernatant; centrifuge at 12,000 rpm to remove the lower layer of bacteria; wash the precipitate twice with PBS; mix the obtained bacterial supernatant and add 400 μl of CTAB lysis solution (containing 1 mg / ml lysozyme); incubate at 37°C for 10 minutes, water bath at 65°C for 10 minutes, centrifuge at 12000 rpm for 5 minutes, and take the supernatant; add 400 μl phenol: chloroform: isopropanol (25:24:1), centrifuge at 12000 rpm for 10 minutes, and take the supernatant; add an equal volume of chloroform: isopropanol (24:1), centrifuge at 12000 rpm for 10 minutes; aspirate the supernatant and add 0.6 times the volume of isopropanol, shake up and down, and place in a -20 refrigerator for precipitation; centrifuge at 12000 rpm for 15 minutes, collect the DNA precipitate, wash the DNA with 500 μl of 75% alcohol, centrifuge at 12000 rpm for 10 minutes, dry and dissolve in ultrapure water, use universal primers 27F and 1492R to perform PCR amplification of the 16S sequence to verify whether there are bacteria in the intestine. The results showed that no bacteria remained in the intestine after 5 days of taking antibiotics. The results are as follows Figure 7 As shown in b.

[0083] Effects of 5.2Pc protein on the growth of sterile mealworm larvae

[0084] The intestinal sterile larvae were randomly divided into a blank control group, a PC group, and a BSA group; each group contained 0.5 g of larvae and 1 g of wheat bran as feed, and the water content of the feed was controlled to 18% using PBS solution. The blank control group was provided with wheat bran only; the PC group was provided with wheat bran containing 100 μg of Pc protein; and the BSA group was provided with wheat bran containing 100 μg of BSA protein. The larvae were raised in a black plastic lunch box at room temperature in the dark for 6 days. Three replicates were set for each group. After the experiment, the total weight of each group of larvae was weighed, and the results are as follows: Figure 8 The results showed that Pc protein could not promote the growth of sterile mealworm larvae, which further proved the role of Pc protein in regulating intestinal microorganisms. 5.3 Effect of Staphylococcus bacteria on the growth of sterile mealworm larvae

[0085] Take the mealworm larvae fed with the cultivated mycelium as described above, use sterile tweezers and a scalpel to extract the intestines of 3-5 larvae, add an appropriate amount of sterile and use a sterile grinding rod to grind them, place them in a centrifuge for a short time at 3000 rpm, draw an appropriate amount of supernatant and dilute it, then spread it on LA solid plates, culture at 37°C overnight, pick a single colony, and use universal primers 27F and 1492R to amplify and sequence the 16S sequence to identify, isolate and purify the intestinal bacteria. The isolated and purified Staphylococcus bacteria S. gallinarum (Sga), S. kloosii (Skl), S. succinus (Ssu), S. saprophyticus (Ssa), S. xylosus (Sxy) and other Gram-negative control bacteria Herbaspirillum huttiense (Hhu), Tenebrionibacter intestinalis (Tin) and Kluyvera intermedia (Kin) were selected and cultured overnight in LB liquid medium. After centrifugation, the OD was adjusted with sterile water. 600 The value is 1. 400 μl of bacterial solution was mixed with 1 g of wheat bran and fed to 0.5 g of mealworm larvae. The weight of each group of larvae was measured after feeding for 6 days. Figure 9 As shown, the results showed that bacteria from the Staphylococcus genus S. gallinarum, S. kloosii and S. succinus could significantly promote larval growth.

[0086] Effects of 5.4Pc protein on the proliferation of Staphylococcus bacteria in vitro

[0087] S. gallinarum, S. succinus and S. kloosii bacteria that can promote the growth of intestinal sterile mealworm larvae were cultured in LB liquid medium containing 20 μg / ml PC at 32°C and 100 rpm. Samples were taken at different time points to measure OD 600 Value, the result is Figure 10 As shown, the results showed that Pc protein can significantly promote the proliferation of Staphylococcus bacteria.

[0088] Example 6: Analysis of the interaction between Pc protein and bacterial bifunctional autolysin (Atl)

[0089] 6.1 Screening of potential interacting proteins of Pc protein

[0090] S. kloosii was cultured overnight in TSB medium, centrifuged at 10,000 rpm for 5 minutes, and the supernatant was discarded to collect the cells. An appropriate amount of PBS was added to resuspend the cells, disrupted by sonication, and centrifuged at 12,000 rpm for 15 minutes at 4°C. The cells were then filtered through a 0.22 μm filter and concentrated using a 3 kDa ultrafiltration centrifuge tube. The concentration was determined using a protein analyzer. Based on the pGEX-GST backbone, the pGEX-GST-Pc protein expression plasmid was designed and constructed using the specific restriction sites BamHI and XhoI. This plasmid and an empty vector plasmid were heterologously expressed in the BL21(DE3) strain, and GST-Pc and GST proteins were purified using GST affinity media. The GST protein, GST affinity media, GST-Pc, and S. kloosii cell fragments were mixed and allowed to bind at low speed at room temperature for 3 hours. After washing with PBS, potential interacting proteins of the Pc protein were detected by SDS-PAGE. Specific protein bands were identified by protein profiling. The results showed that there were three obvious specific protein bands, and the mass spectrometry identification results were bifunctional autolysin protein (about 143kDa), carbamoyl-phosphate synthetase (about 117kDa) and 2-oxoglutarate dehydrogenase (about 105kDa). Among them, only the bifunctional autolysin protein Atl was an exogenous protein. It is speculated that Atl is most likely an interacting protein of Pc protein. AlphaFold3 was then used to perform docking experiments between protein molecules, and the results are as follows Figure 11 As shown, it shows that only Atl can bind to Pc protein.

[0091] 6.2 Verification of Pc protein binding to bifunctional autolysin

[0092] The binding of Pc and Atl was further verified by pulldown experiments using GST- and His-tagged fusion proteins. As described above, GST-Atl and Atl-His fusion-tagged proteins were constructed using the pGEX-GST and pET28a empty plasmid backbones, respectively. GST-Atl and Atl-His proteins were purified using GST affinity media and Ni affinity media, respectively. As described above, GST-Atl was first used to pull down Pc-His. The experiment was divided into a GST protein blank control group and a GST-Atl treatment group. The control group consisted of a mixture of 8 μl of GST protein solution, 160 μl of Pc-His protein solution, 432 μl of PBS-Triton solution, and 50 μl of GST affinity medium, followed by low-speed rotation for 3 hours. The treatment group consisted of a mixture of 200 μl of GST-Atl, 160 μl of Pc-His protein, 240 μl of PBS-Triton solution, and 50 μl of GST affinity medium, followed by low-speed rotation for 3 hours at room temperature. Subsequently, GST-Pc protein was used to pull down Atl-His. The experiment was divided into a GST protein blank control group and a GST-Pc treatment group. The control group mixed 4μl GST protein solution, 160μl Atl-His protein solution, 436μl PBS-Triton solution and 50μl GST affinity medium; the treatment group mixed 80μl GST-Pc protein solution, 160μl Atl-His protein solution, 360μl PBS-Triton solution and 50μl GST affinity medium. Rotate at low speed for 3h at room temperature, wash the medium with 1ml PBS-Triton solution for 3min, centrifuge at low speed for 3min, and repeat the wash 8 times. Add 45μl PBS and 20μl loading buffer to the medium precipitate, heat at 100℃ for 7min, centrifuge briefly, load on SDS-PAGE electrophoresis and detect Pc-His and Atl-His proteins by Western blot. The results are as follows Figure 12 As shown, it was shown that GST-Atl protein can bind to Pc-His and GST-Pc protein can bind to Atl-His.

[0093] Effect of 6.3Pc protein on Atl enzyme activity

[0094] The effect of Pc protein on the activity of bifunctional autolysin Atl enzyme was determined by Atl lysis experiment. Considering that S.kloosii bacteria express and secrete bifunctional autolysin by themselves, rifamycin sodium (RS) was used to eliminate self-interference. First, a rifamycin sodium mother liquor with a mother liquor concentration of 4 mg / ml was prepared, and the overnight cultured S.kloosii bacteria were adjusted to OD using LB liquid medium. 600About 0.65, take 1 ml of bacterial solution and add 2 μg / ml, 4 μg / ml, 8 μg / ml rifamycin sodium mother solution respectively, culture at 37℃, 180 rpm for 2 h, and then measure OD 600 Based on the measurement results, 4 μg / ml was selected as the addition standard for the subsequent bifunctional autolysin enzyme activity assay. After inoculating S. kloosii into LB medium for overnight culture, an appropriate amount of bacterial solution was drawn, centrifuged at 6500 rpm for 3 minutes, washed twice with PBS solution, and the bacterial OD was adjusted with PBS. 600 The value of RIFA is 1. The subsequent experiments were conducted in 4 groups, namely CK+Rifamycin Sodium group, Atl+Rifamycin Sodium group, Atl+50μg / ml Pc+Rifamycin Sodium group, Atl+100μg / ml Pc+Rifamycin Sodium group. Finally, each group was kept at 1ml system and initial OD 600 The value was 0.92 and the concentration of Atl was 100 μg / ml. The cells were placed in a 35°C incubator and samples were taken at 3, 7 and 11 hours to measure OD 600 The detailed components added in each group are shown in Table 1. The concentration of Pc protein stock solution was 1 mg / ml and the concentration of Atl stock solution was 1.4 mg / ml. Figure 13 As shown, it shows that Pc protein can significantly reduce bacterial autolysis.

[0095] Table 1 The amount of each component added in the experiment of the effect of Pc protein on Atl enzyme activity

[0096]

[0097] Effects of 6.4Pc protein on iron-related genes in S. kloosii

[0098] An appropriate amount of S. kloosi bacteria was resuspended in 1 ml of RNAiso Plus and transferred to an RNA extraction tube containing fine zirconium beads. The tube was then ground five times with 15 seconds between each rotation using a three-dimensional cryo-grinder. The tube was placed on ice for 5 minutes. 200 μl of phenol / chloroform / isoamyl alcohol (25:24:1) was added, mixed by inversion, and centrifuged at 12,000 rpm for 15 minutes. 400 μl of the supernatant was aspirated and added to 400 μl of pre-chilled isopropanol. The tube was placed in a -20°C refrigerator for 20 minutes, removed, and centrifuged at 12,000 rpm for 20 minutes. The supernatant was removed, 1 ml of pre-chilled 75% ethanol was added, mixed by inversion, and centrifuged at 12,000 rpm for 8 minutes. Repeat twice. RNA was dissolved in 50 μl of sterile, enzyme-free water. RNA concentration was measured using a nucleic acid analyzer. After reverse transcription, target genes were analyzed by quantitative PCR. Six iron-related genes were selected for validation. Among them, Ftp1 and Ftp2 both encode iron ABC transporter permeases (accession numbers: PTJ74169 and PTJ74168); Ftsb encodes iron ABC transporter substrate binding protein (accession number: PTJ74166); Fstsb encodes siderophore ABC transporter substrate binding protein (accession number: PTJ74927); Fctsb encodes ferrochrome ABC transporter substrate binding protein (accession number: PTJ80362); and atl encodes a bifunctional autolysin (accession number: PTJ79456). tufA, encoding the elongation factor EF-Tu1, was used as an internal reference gene, and reference was made to 2 (-ΔΔCT) The relative expression of genes was analyzed by the method. Figure 14 As shown, it was shown that Pc protein (20 μg / ml) could down-regulate the expression of iron-related genes.

[0099] Effects of 6.5Pc protein on iron and ROS in S. kloosii cells

[0100] Use TSB liquid medium to adjust the OD of S. kloosii 600The value was 3. A stock solution of 50 mM FeCl₃.6H₂O was prepared and sterilized by filtration through a 0.22 μm filter. Cell iron content was determined in four groups: a blank control group, a 50 μM Fe group, a Pc + 50 μM Fe group, and a Pc + 100 μM Fe group. Each group contained 2.836 ml of bacterial culture, with a final protein concentration of 20 μg / ml in the Pc group. The volume of each group was adjusted to 3 ml using PBS. The bacterial culture in each group was incubated in a 37°C incubator with shaking for 1 hour. The cells were collected by centrifugation and the pellet was washed twice with ultrapure water. The cells were freeze-dried in a freeze dryer and the dry weight was measured. The cells were completely transferred to a glass tube and digested with concentrated nitric acid at 65°C for 45 minutes. The nitric acid was evaporated in a 90°C metal heating apparatus. After thorough dissolution with 5 ml of deionized water, the cells were filtered through a 0.22 μm filter. The iron content of each sample was determined by ICP. Similarly, the cellular ROS content assay was divided into three groups: blank control group, 50 μM Fe group, and Pc+50 μM Fe group. The OD of S. kloosii was adjusted using TSB liquid medium. 600 The value was 2. 1.9 ml of bacterial solution was added to each group. The final protein concentration in the PC group was 20 μg / ml; PBS was used to adjust the final volume of each group to 2 ml. After 1 hour of culture, the OD of each group was measured. 600 The ROS content in each group was normalized using the protein content. Figure 15 As shown, it was shown that under 50 μM Fe conditions, Pc protein could significantly promote bacterial proliferation and reduce bacterial cell iron content and ROS pressure.

[0101] Example 7: Effect of Pc protein on intestinal flora of normal mice

[0102] Six-week-old normal disease-free male mice (C57BL / 6J) were selected as the gavage model and divided into a control group and a PC treatment group (6 mice in each group). The control group was gavaged with 200 μl PBS every day, and the treatment group was gavaged with 200 μl PC protein (250 μg / ml) every day. After 7 consecutive days of gavage, the mouse feces were collected and the intestinal bacterial abundance was determined by 16S amplicon sequencing. Figure 16 As shown, Pc protein also plays a regulatory role in the regulation of intestinal microorganisms in mammalian mice. This protein can regulate the significant proliferation of Lachnospiraceae bacteria in the intestines of normal disease-free mice.

[0103] According to the UniProt protein database, bacteria of the Lachnospiraceae family have bifunctional autolysins. Given that the Pc protein mainly binds to the conserved GL domain, in order to verify whether the Pc protein binding to the GL domain is universal, other bacteria (including Lachnospiraceae family) with bifunctional autolysins or exocytic GL domain proteins were investigated, and bifunctional autolysins or exocytic GL domain-containing proteins of representative strains (as shown in Table 2) were selected to implement molecular docking with Pc proteins. The molecular docking results of AlphaFold3 are shown in Figure 2. Figure 17 As shown, it shows that in addition to the bifunctional autolysins of a few bacteria with potential pathogenic characteristics that can achieve molecular docking with Pc protein, the bifunctional autolysins or exotype GL domain-containing proteins of most probiotic bacteria that can be used in food can also achieve molecular docking with Pc protein. This shows that the binding of Pc protein to the bifunctional autolysins or exotype GL domain-containing proteins of bacteria has a universal effect. Considering that some Staphylococcus bacteria are pathogenic or opportunistic pathogens, such as Staphylococcus aureus, the effect of Pc protein on the biofilm formation of pathogenic Staphylococcus aureus was further explored, and the results are shown in the figure below. Figure 18 As shown, Pc protein can significantly reduce the formation of pathogenic biofilms. This result further demonstrates the safety of Pc protein in regulating intestinal microorganisms and promoting host health and growth.

[0104] Table 2 Molecular simulation docking information of Pc protein and exocytic GL domain-containing proteins of various bacteria

[0105]

[0106]

[0107] Example 8: Effects of Pc protein on high-fat diet-induced obese (DIO) mice

[0108] Eleven-week-old male mice (C57BL / 6J background) were purchased from Weitong Lihua (China) and induced with a high-fat diet (feed: XTHF60) for 6 weeks starting at 5 weeks of age. They were divided into a control group (CK) and a PC-treated group (8 mice per group). After grouping, the mice were adaptively fed in an SPF-grade mouse facility for 7 days; subsequently, the control group was gavaged with 200 μl of PBS daily, and the treated group was gavaged with 200 μl of PC protein (250 μg / ml) daily for 33 consecutive days. During the entire 40-day feeding period (e.g., Figure 19a) Weigh the mice every 2 days. After 40 days, collect subcutaneous fat, visceral fat, epididymal white fat, intestinal fat, liver, and feces. Measure the wet weight of each fat type and the size of epididymal white adipocytes; perform H&E and ORO staining on liver tissue; and perform 16S amplicon sequencing on fresh feces to determine intestinal bacterial abundance. Figure 19 As shown, 7 days before oral administration of PC protein, there was no significant difference in the body weight of mice in each group (e.g. Figure 19 b); Pc protein can significantly reduce the weight gain of obese mice fed a high-fat diet (e.g. Figure 19 c); it can also significantly reduce the accumulation of body fat, the size of epididymal adipocytes and the accumulation of liver fat (such as Figure 19 dg); the results of 16S amplicon sequencing of intestinal bacteria showed (such as Figure 19 h), Pc protein can significantly enrich Blautia bacteria in the intestines of DIO mice, and a large number of literature reports have shown that this genus of bacteria can effectively alleviate obesity.

[0109] Example 9: Effects of Pc protein on DSS-induced colitis (UC) mice

[0110] Five-week-old C57BL / 6J male mice purchased from Weitong Lihua Co., Ltd. (China) were divided into a control group (CK), a DSS group, and a DSS+Pc group, with 8 mice in each group. After grouping, the mice were adaptively fed in an SPF-grade mouse facility for 7 days; during the second week, the DSS group was gavaged with 200 μl of PBS every day, and the DSS+Pc group was gavaged with 200 μl of Pc protein (250 μg / ml) every day; at the third week, the DSS and DSS+Pc groups had free access to 3% DSS aqueous solution every day, and the DSS group was gavaged with 200 μl of PBS every day, and the DSS+Pc group was gavaged with 200 μl of Pc protein (250 μg / ml) every day (as shown in Figure 2). Figure 20 a). During the 14 days before DSS treatment, the body weight of each group of mice was measured every 2 days. During DSS treatment, the body weight of the mice was measured daily, and the softness and hardness of the feces and the presence of blood in the feces were recorded. After 7 days of DSS treatment, the spleens of the mice were collected and weighed to calculate the spleen index (ratio of spleen weight to body weight). The colon tissues of the mice were collected, their lengths were measured, and paraffin-embedded sections were used for H&E staining. Fresh feces of the mice were collected for 16S amplicon sequencing to determine the abundance of intestinal bacteria. The results are shown in Figure 2. Figure 20 As shown, there was no difference in the body weight changes of mice in each group within 2 weeks before DSS induction (e.g. Figure 20 b); After 4 days of DSS treatment, the mice lost significant weight, but PC treatment could effectively alleviate the weight loss (e.g. Figure 20 c); At the same time, Pc protein can significantly reduce the disease index of mice induced by DSS (such as Figure 20 d) Relieve colon shortening (such as Figure 20e,f), reduce spleen index (such as Figure 20 g, h) and relief of colonic lesions, such as reduction of marked epithelial degeneration, crypt destruction, extensive focal ulceration, and inflammation (e.g. Figure 20 i); The results of intestinal bacterial abundance determination showed that Pc protein could significantly enrich Akkermansia bacteria in the intestines of colitis mice (such as Figure 20 j) Numerous studies have reported that Akkermansia bacteria, acting as an intestinal barrier, can effectively alleviate colitis, regulate immune responses, and maintain intestinal health. This suggests that Pc protein can alleviate colitis and maintain intestinal health.

[0111] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and should not be considered to limit the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. Application of exocrine protein Pc in the preparation of products for regulating intestinal flora, characterized by: The nucleotide sequence of the exoprotein Pc is shown in GenBank accession number PP496239. The intestinal flora regulation is that the exoprotein Pc inhibits Staphylococcus aureus with a bifunctional autolysin. S. aureus Biofilm formation.

2. Use of exocrine protein Pc in the preparation of a medicament for treating ulcerative colitis, characterized in that: The nucleotide sequence of exoprotein Pc is shown in GenBank accession number PP496239.