Targeting nanometer material covering erythrocyte membrane as well as preparation method and application thereof

Abstract

The invention discloses a targeting nano material covering an erythrocyte membrane as well as a preparation method and application of the targeting nano material covering the erythrocyte membrane. The targeting nano material covering the erythrocyte membrane comprises a metal organic framework material, the surface of the metal organic framework material is coated with the erythrocyte membrane; the aptamer is connected with the outer surface of the erythrocyte membrane; the aptamer is Apt19S, and the nucleotide sequence of the aptamer is as shown in SEQ ID NO. 1. The nano material provided by the invention has good stability and targeting performance, can specifically recruit bone marrow mesenchymal stem cells to participate in osteogenic differentiation, and can be used as a novel nano material for promoting bone regeneration.

Description

Technical Field

[0001] The present invention belongs to the field of material science and technology, and specifically relates to a nano material covering red blood cell membrane with targeting property, and a preparation method and application thereof. Background Art

[0002] Metal-organic framework (MOF) is a type of crystalline material constructed by metal ions and organic frameworks. It has the characteristics of diverse structures, large specific surface area, uniform cavity, etc. MOF materials are widely used in catalysis, sensing and drug delivery. Among them, ZIF-8 is a kind of MOF with a large specific surface area and pore volume. It is an ideal drug carrier. Moreover, the Zn released in ZIF-8 2+ It can promote the osteogenic differentiation of bone marrow mesenchymal stem cells. However, the simple use of ZIF-8 as a drug carrier still has some defects, such as: no targeting ability, poor fusion with cells, easy degradation in water, thus reducing its efficacy.

[0003] With the maturity of cell membrane display technology, many materials are encapsulated in the cell membrane to improve biosafety, prolong blood circulation time, and enhance fusion with cells. Red blood cells are the most abundant cells in the blood. The red blood cell membrane is easy to obtain, has low immunogenicity, and maintains structural stability. Integrating the functions of red blood cell membranes and the characteristics of ZIF-8 nanomaterials can achieve effective drug transport. However, the delivery and targeting of nanomaterials still need further improvement. Summary of the invention

[0004] The purpose of the present invention is to overcome the technical defects existing in the prior art. Targeted nanomaterials can accurately deliver drugs to the target location, recruit specific cells to perform functions, and improve the utilization rate of drugs. Aptamers are short single-stranded nucleic acid sequences that can bind to targets. They have high affinity and specificity for specific targets and have been widely used in targeted drug delivery systems. Apt19S, as an aptamer, can recruit bone marrow mesenchymal stem cells to reach bone defects and promote their osteogenic differentiation. A targeted nanomaterial covering the red blood cell membrane, a preparation method and an application are provided. The provided targeted nanomaterial covering the red blood cell membrane has the effect of promoting the osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration.

[0005] In a first aspect of the present invention, a targeted nanomaterial covering red blood cell membrane is provided, comprising a metal organic framework material, a red blood cell membrane wrapped on the surface of the metal organic framework material, and an aptamer connected to the outer surface of the red blood cell membrane; the aptamer is Apt19S, and its nucleotide sequence is shown in SEQ ID NO.1.

[0006] Furthermore, the 5' end of the aptamer is modified with cholesterol.

[0007] The provided targeted nanomaterial covering the red blood cell membrane, when co-cultured with bone marrow mesenchymal stem cells, has low cytotoxicity, high biocompatibility, is easier to enter the cells, and recruits more bone marrow mesenchymal stem cells to participate in osteogenic differentiation, further promoting bone regeneration. The provided nanomaterial has good stability and targeting performance, can specifically recruit bone marrow mesenchymal stem cells to participate in osteogenic differentiation, and can be used as a new nanomaterial to promote bone regeneration.

[0008] Furthermore, the metal organic framework material is ZIF-8.

[0009] Furthermore, the average particle size of the metal organic framework material is 200 nm to 400 nm.

[0010] Furthermore, the average particle size of the targeted red blood cell membrane-covering nanomaterial is 200 nm to 400 nm.

[0011] The average particle size of the metal-organic framework material coated with red blood cell membrane increased slightly.

[0012] The second aspect of the present invention provides a method for preparing a targeted nanomaterial covering red blood cell membrane, comprising the following steps:

[0013] Extruding the metal organic framework material and the red blood cell membrane by a membrane extrusion method to obtain a metal organic framework material coated with the red blood cell membrane;

[0014] The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the targeted nanomaterial covering the red blood cell membrane.

[0015] The preparation method is based on metal organic framework materials, and the extracted red blood cell membrane is coated on the surface of the metal organic framework material by membrane extrusion technology. After modification with aptamers, a targeted nanomaterial covering the red blood cell membrane is obtained. The preparation method is easy to operate, the synthesis equipment is simple, and the biocompatibility is high.

[0016] Furthermore, the membrane extrusion method is to use 400 nm and 200 nm microporous membranes for extrusion in sequence, and cyclically extrude for 15 to 25 times.

[0017] Furthermore, the mass ratio of the metal organic framework material to the red blood cell membrane is 1:(100-200).

[0018] Furthermore, the mass ratio of the aptamer to the metal organic framework material coated with the red blood cell membrane is 1:(200-400).

[0019] The third aspect of the present invention provides a targeted use of a nanomaterial covering an erythrocyte membrane in the preparation of a material for promoting osteogenic differentiation of bone marrow mesenchymal stem cells or a bone regeneration material.

[0020] Furthermore, the targeted nanomaterial covering the red blood cell membrane is used as a carrier of bone marrow mesenchymal stem cells.

[0021] A fourth aspect of the present invention provides a biomaterial for promoting osteogenic differentiation or bone regeneration of bone marrow mesenchymal stem cells, wherein the biomaterial is prepared from a targeted nanomaterial covering the red blood cell membrane.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The targeted red blood cell membrane-covered nanomaterial of the present invention is connected to an aptamer targeting bone marrow mesenchymal stem cells, and can specifically recruit bone marrow mesenchymal stem cells to exert osteogenic differentiation function.

[0024] (2) The targeted nanomaterial covering the red blood cell membrane of the present invention has a uniform nanostructure, is easy to operate, and has high biosafety. The Zn released by the ZIF-8 metal organic framework material 2+ It can promote osteogenic differentiation of mesenchymal stem cells and bone regeneration.

[0025] (3) The targeted erythrocyte membrane-covered nanomaterial described in the present invention uses the erythrocyte membrane to cover the metal organic framework material, thereby enhancing the compatibility with the cell membrane, promoting more material to be taken up by cells, maintaining structural integrity, and reducing drug leakage.

[0026] (4) The targeted nanomaterial covering the red blood cell membrane described in the present invention can be used as a carrier to improve the targeting performance of the material, accurately target the bone defect area, and promote bone regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a transmission electron microscopy image of ZIF-8@RM-Apt prepared in Example 1;

[0028] Figure 2 The particle size distribution diagram of ZIF-8@RM-Apt prepared in Example 1 and ZIF-8 prepared in Comparative Example 2;

[0029] Figure 3 Potential distribution diagrams of ZIF-8@RM-Apt and RM erythrocyte membrane prepared in Example 1 and ZIF-8 prepared in Comparative Example 2;

[0030] Figure 4Fluorescence confocal microscopy images of ZIF-8@RM-Apt prepared in Example 1 and Comparative Example 1 after co-culture with bone marrow mesenchymal stem cells;

[0031] Figure 5 The CCK-8 test results after co-culturing ZIF-8@RM-Apt prepared in Example 1 and ZIF-8 prepared in Comparative Example 2 with bone marrow mesenchymal stem cells;

[0032] Figure 6 ALP staining results of bone marrow mesenchymal stem cells after osteogenic induction by ZIF-8@RM-Apt prepared in Example 1 and ZIF-8 prepared in Comparative Example 2. DETAILED DESCRIPTION

[0033] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0034] The present invention provides a targeted nanomaterial covering red blood cell membrane, comprising a metal organic framework material, a red blood cell membrane wrapped on the surface of the metal organic framework material, and an aptamer connected to the outer surface of the red blood cell membrane; the aptamer is Apt19S, and its nucleotide sequence is shown in SEQ ID NO.1.

[0035] The 5' end of the aptamer is modified with cholesterol.

[0036] The metal organic framework material is ZIF-8.

[0037] The aptamer Apt19S used is specifically used to recognize and bind to bone marrow mesenchymal stem cells. Its binding rate with various non-stem cells is low, and it can be used to study the specific binding and directional recruitment of stem cells. ZIF-8 is a metal organic framework material with good biocompatibility and low cytotoxicity. The released Zn 2+ It can promote osteogenesis. The erythrocyte membrane is not immunogenic, can maintain the stability of the internal material, and enhance the fusion with the cell membrane. The targeted nanomaterial covering the erythrocyte membrane provided by this method has low cytotoxicity, high biocompatibility, and is easier to enter the cells when co-cultured with bone marrow mesenchymal stem cells, and can recruit more bone marrow mesenchymal stem cells to participate in osteogenic differentiation, further promoting bone regeneration.

[0038] In some examples, the aptamer is modified with cholesterol. Considering that the red blood cell membrane is a lipid structure, the aptamer modified with cholesterol can be more conducive to the connection between the aptamer and the red blood cell membrane, and the connection efficiency is better than other modifications.

[0039] The present invention also provides a method for preparing a targeted nano material covering red blood cell membrane, comprising the following steps:

[0040] Extruding the metal organic framework material and the red blood cell membrane by a membrane extrusion method to obtain a metal organic framework material coated with the red blood cell membrane;

[0041] The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the targeted nanomaterial covering the red blood cell membrane.

[0042] In some examples, the membrane extrusion method is to use 400 nm and 200 nm microporous membranes for extrusion in sequence, and cyclically extrude 15 to 25 times.

[0043] In some examples, the metal organic framework material is a ZIF-8 solution, and the mass ratio of the ZIF-8 to the erythrocyte membrane is 1: (100-200). During the research, it was found that when the amount of ZIF-8 solution is too much, there will be more ZIF-8 particles that are not coated by the erythrocyte membrane; when the amount of erythrocyte membrane is too much, there will be more erythrocyte membranes that are not coated with ZIF-8 particles scattered in the material. Through transmission electron microscopy observation, it was found that when there is a suitable concentration ratio, ZIF-8 particles and erythrocyte membranes will be more fully utilized and coated, otherwise there will be more remaining ZIF-8 or erythrocyte membranes, which will affect the quality of the prepared nanomaterials with targeted coverage of erythrocyte membranes. Moreover, because there are too many ZIF-8 or erythrocyte membranes, they need to be removed specifically, which makes the preparation process more complicated and more difficult.

[0044] The aptamer mentioned is provided in the form of an aptamer solution. The aptamer is Apt19S, with cholesterol modification at the 5' end, and the nucleotide sequence is shown in SEQ ID NO.1, specifically aggtcagatgaggagggggacttaggactgggtttatgacctatgcgtg (5'-3').

[0045] In some examples, the mass ratio of the aptamer to the metal organic framework material coated with the red blood cell membrane is 1: (200~400). When the aptamer content is too much, the aptamer that cannot bind to the metal organic framework material coated with the red blood cell membrane will exist in the solution in a free manner and can be removed after washing. When the aptamer content is too little, some metal organic framework materials coated with the red blood cell membrane cannot fully bind to the aptamer, and the efficiency is low. In our experiment, the aptamers synthesized according to the sequence will have a concentration and a recommended amount, which can meet the requirements of fully binding to the red blood cell membrane without too much waste. The coating of the red blood cell membrane will increase the particle size of the metal organic framework to a certain extent. Under this ratio condition, a nanomaterial with a suitable volume and targeted coverage of the red blood cell membrane can be obtained, and a good biological effect can be achieved, which has little effect on the transport and release of the nanomaterial in the cell.

[0046] In some examples, the ZIF-8 solution is obtained by resuspending the ZIF-8 particles in distilled water and dispersing them by ultrasonication. The ZIF-8 particles are obtained by mixing 2-methylimidazole and zinc nitrate hexahydrate, stirring, centrifuging the obtained suspension, and collecting white precipitated particles.

[0047] In some examples, the molar ratio of the zinc nitrate hexahydrate to the 2-methylimidazole is 1:(20-24). If the molar ratio of zinc nitrate hexahydrate to 2-methylimidazole is too high or too low, the properties of the obtained material will change, such as failure to nucleate to obtain a suspension, too small or too large particle size, color mismatch, etc.

[0048] In some examples, the incubation is at 4° C. for 10 to 20 hours. After the incubation, the cell is centrifuged at 5000 to 10000 rpm to remove the aptamer.

[0049] In some examples, the red blood cell membrane solution is obtained by the following method:

[0050] After blood is collected from the animal, a series of centrifugation processes are performed, and the obtained white precipitate is dissolved in a buffer solution to obtain a red blood cell membrane solution. The volume ratio of the blood collected from the animal to the red blood cell membrane solution is (6-7):1, and the animal is a rat.

[0051] The present invention also provides a targeted use of a nano material covering an erythrocyte membrane in the preparation of a material for promoting osteogenic differentiation of bone marrow mesenchymal stem cells or a bone regeneration material.

[0052] The present invention also provides a biomaterial, which is used to promote the osteogenic differentiation or bone regeneration of bone marrow mesenchymal stem cells. The biomaterial is prepared from a targeted nanomaterial covering the red blood cell membrane.

[0053] In some examples, the provided targeted red blood cell membrane-covered nanomaterials can be used as carriers of bone marrow mesenchymal stem cells.

[0054] In the present invention, the targeted nanomaterial covering the red blood cell membrane is co-cultured with bone marrow mesenchymal stem cells to observe its targeting and osteogenesis effects. At the same time, a random sequence aptamer (Random Apt) is used as a control, and its nucleotide sequence is shown in SEQ ID NO.2. The experimental results show that Apt19S has stronger targeting.

[0055] The ZIF-8 material is coated with erythrocyte membrane, which is easy to obtain and has low immunogenicity. The coating has little effect on the volume of the material. Compared with other membrane materials, such as bone marrow mesenchymal stem cell membrane, it does not have the disadvantages of difficult control of extraction efficiency and extraction volume and large membrane volume.

[0056] ZIF-8 material, due to its strong loading capacity and high biocompatibility, can release Zn 2+ , which has been widely used. The present invention coats the erythrocyte membrane on the ZIF-8 material, and connects it to the cholesterol-affinity Apt19S sequence according to its characteristics, thereby overcoming the problems of easy degradation, insufficient targeting, and low efficiency. The provided targeted erythrocyte membrane-covered nanomaterial can be used as a carrier to accurately target the bone defect area and promote bone regeneration.

[0057] The protection scheme of the present invention is described below by means of specific embodiments. It should be noted that these embodiments are only used to facilitate the understanding of those skilled in the art and should not be regarded as limiting the protection scope of the present invention.

[0058] Unless otherwise specified, all reagents used in the examples can be obtained commercially.

[0059] Example 1

[0060] The preparation method of the targeted red blood cell membrane-covering nanomaterial ZIF-8@RM-Apt provided in this embodiment is as follows:

[0061] (1) Preparation of ZIF-8 nanomaterials:

[0062] First, 65.6 mg of 2-methylimidazole was dissolved in 0.5 mL of distilled water to obtain a 2-methylimidazole solution; 11.88 mg of zinc nitrate hexahydrate was dissolved in 0.5 mL of distilled water to prepare a zinc nitrate hexahydrate solution. The zinc nitrate hexahydrate solution was slowly dripped into the 2-methylimidazole solution, stirring throughout the process; after stirring at room temperature for 4 hours, the obtained milky white suspension was transferred to a centrifuge tube. Centrifuge at 10,000 rpm for 10 minutes in a centrifuge, discard the supernatant, add distilled water and centrifuge three times to collect the white precipitate particles of ZIF-8.

[0063] (2) Extraction of red blood cell membrane:

[0064] After 5 rats were anesthetized by intraperitoneal injection of sodium pentobarbital, blood was collected from the abdominal aorta under negative pressure into anticoagulant tubes containing citrate anticoagulant, a total of 4 tubes, each with 8 mL, and centrifuged at 4000 rpm for 20 minutes after balancing, and the supernatant and the middle layer of white fluffy material were discarded. The lower red precipitate was resuspended with 3 times the volume of pre-cooled PBS, centrifuged at 4000 rpm for 20 minutes and the supernatant was discarded, and repeated 3 times. Then, the lower red precipitate was resuspended with 40 times the volume of Tris-HCl (10 mM, pH 7.4) and allowed to stand at 4℃ for 1.5 hours. After ultracentrifugation at 9000 rpm for 20 minutes, the supernatant was discarded. Then, the white precipitate was resuspended with pre-cooled PBS, ultracentrifuged at 9000 rpm for 20 minutes, and the supernatant was discarded, and repeated 3 times. The final white precipitate is the red blood cell membrane, which is collected in a 15 mL centrifuge tube with PBS to make the concentration of the red blood cell membrane 150 μg / mL for standby use.

[0065] (3) Preparation of ZIF-8 nanomaterials covering red blood cell membranes:

[0066] The 0.45 μg ZIF-8 white precipitate particles obtained in step (1) were resuspended in 1200 μL distilled water, and then ultrasonically dispersed and mixed with 300 μL of the erythrocyte membrane mixture obtained in step (2), and squeezed through microporous membranes with pore sizes of 400 nm and 200 nm in sequence using a membrane squeezer, and squeezed back and forth 20 times to obtain the erythrocyte membrane-coated ZIF-8 material, so that the concentration of the erythrocyte membrane-coated ZIF-8 material was 100 μg / mL. That is, the mass ratio of ZIF-8 material to erythrocyte membrane was 1:100.

[0067] (4) Preparation of aptamer-linked ZIF-8 nanomaterials covering red blood cell membranes ZIF-8@RM-Apt:

[0068] 5 μL of 200 μg / mL cholesterol-modified aptamer solution was added dropwise to 2 mL of the erythrocyte membrane-coated ZIF-8 material obtained in step (3), incubated at 4°C for 12 hours, centrifuged at 5000 rpm for 5 minutes to remove free aptamers, washed three times by centrifugation with distilled water, and ZIF-8@RM-Apt was collected; the aptamer was Apt19S, with cholesterol modification at the 5' end, and its nucleotide sequence was shown in SEQ ID NO. 1. That is, the mass ratio of the aptamer to the erythrocyte membrane-coated metal organic framework material in this embodiment was 1:200.

[0069] Example 2

[0070] The preparation method of the targeted erythrocyte membrane-covered nanomaterial ZIF-8@RM-Apt provided in this embodiment is basically the same as that of Example 1, except that in step (4) of this embodiment, 2.5 μL of a 200 μg / mL cholesterol-modified aptamer solution is added dropwise to 2 mL of the erythrocyte membrane-coated ZIF-8 material obtained in step (3). That is, the mass ratio of the aptamer to the erythrocyte membrane-coated metal organic framework material in this embodiment is 1:400.

[0071] Example 3

[0072] The preparation method of the targeted erythrocyte membrane-covering nanomaterial ZIF-8@RM-Apt provided in this embodiment is basically the same as the preparation method in Example 1, except that: the amount of ZIF-8 white precipitate particles added in step (3) is 0.225 μg. The final concentration and amount of the erythrocyte membrane mixture added in step (3) remain unchanged. That is, the mass ratio of ZIF-8 material to erythrocyte membrane in this embodiment is 1:200.

[0073] Comparative Example 1

[0074] The preparation method of the targeted red blood cell membrane-covering nanomaterial ZIF-8@RM-Apt provided in this comparative example is basically the same as the preparation method in Example 1, except that the aptamer in this comparative example is RandomApt, and its nucleotide sequence is shown in SEQ ID NO.2, which is different from the nucleotide sequence in Example 1, and the sequence length is consistent.

[0075] Comparative Example 2

[0076] In this comparative example, the material without red blood cell membrane covering and aptamer connection was used for subsequent physical and chemical performance test, cytotoxicity test and bone marrow mesenchymal stem cell osteogenic differentiation ability test, that is, the nano material ZIF-8 was directly selected. The preparation method of the nano material ZIF-8 was prepared according to step (1) of Example 1, specifically:

[0077] First, 65.6 mg of 2-methylimidazole was dissolved in 0.5 mL of distilled water to obtain a 2-methylimidazole solution; 11.88 mg of zinc nitrate hexahydrate was dissolved in 0.5 mL of distilled water to prepare a zinc nitrate hexahydrate solution. The zinc nitrate hexahydrate solution was slowly dripped into the 2-methylimidazole solution, stirring throughout the process; after stirring at room temperature for 4 hours, the obtained milky white suspension was transferred to a centrifuge tube. Centrifuge at 10,000 rpm for 10 minutes in a centrifuge, discard the supernatant, add distilled water and centrifuge three times to collect the white precipitate particles of ZIF-8.

[0078] Test example

[0079] (1) Physical and chemical properties test

[0080] The transmission electron microscopy image of ZIF-8@RM-Apt prepared in Example 1 is as follows: Figure 1 As shown, the results show that ZIF-8@RM-Apt has a hexahedral structure with a membrane-like structure wrapped on the outer layer.

[0081] The particle size distribution diagrams of ZIF-8@RM-Apt prepared in Example 1 and the nanomaterial ZIF-8 prepared in Comparative Example 2 are shown in FIG. Figure 2 As shown, the results show that the particle size gradually increases from ZIF-8 to ZIF-8@RM-Apt, and the particle size of ZIF-8@RM-Apt is about 270nm.

[0082] The potential distribution diagrams of ZIF-8@RM-Apt and RM red blood cell membrane prepared in Example 1 and the nanomaterial ZIF-8 prepared in Comparative Example 2 are shown in FIG. Figure 3 As shown, the results show that the potential of ZIF-8 is approximately 19 mV, the RM red blood cell membrane potential is approximately -31 mV, and the potential of ZIF-8@RM-Apt is approximately -26 mV.

[0083] (2) Cell co-localization detection

[0084] Cell co-localization detection was performed on ZIF-8@RM-Apt prepared in Example 1 and Comparative Example 1, respectively.

[0085] 1×10 5 Rat bone marrow mesenchymal stem cells were inoculated on a cell slide with a diameter of 15 mm. After culturing in an incubator at 37°C for 12 hours, two groups of 10 μL of ZIF-8@RM-Apt with red fluorescent dye were added to the cells for co-culture. One group was prepared in Comparative Example 1, denoted as Random-Apt, and the other group was prepared in Example 1, denoted as Apt19S.

[0086] After co-culture in an incubator at 37°C for 6 h, the cells were rinsed three times with distilled water, fixed with 4% paraformaldehyde, stained with DAPI for nuclei, stained with DIO dye for cell membranes, and photographed with confocal microscope.

[0087] Fluorescence confocal microscopy results Figure 4 As shown, ZIF-8@RM-Apt co-localizes with cells and can enter the cytoplasm. In the figure, green represents the membrane of bone marrow mesenchymal stem cells, red represents the aptamer, and blue represents the cell nucleus. From the co-localization image, it can be concluded that the materials in the Apt19S group can be taken up by bone marrow mesenchymal stem cells after 6 hours of co-culture, while the materials in the Random-Apt group are still around the cells.

[0088] (3) Cytotoxicity assay

[0089] Cytotoxicity test was performed on ZIF-8@RM-Apt prepared in Example 1 and ZIF-8 prepared in Comparative Example 2, and the specific steps were as follows:

[0090] 1×10 5 Rat bone marrow mesenchymal stem cells were seeded into 12-well plates and cultured in an incubator at 37°C for 12 hours. Then, 10 μL of ZIF-8 and ZIF-8@RM-Apt were added to the cells for co-culture. The cell culture medium was replaced every two days and ZIF-8 and ZIF-8@RM-Apt materials were added again. The CCK-8 kit (manufacturer: MCE, China) was used to detect cell activity on the 1st, 3rd and 5th days of co-culture.

[0091] Results Figure 5 As shown, ZIF-8 and ZIF-8@RM-Apt showed no obvious cytotoxicity and had high biosafety.

[0092] (4) Detection of osteogenic differentiation ability of bone marrow mesenchymal stem cells

[0093] The osteogenic differentiation ability of bone marrow mesenchymal stem cells was detected on ZIF-8@RM-Apt prepared in Example 1 and ZIF-8 prepared in Comparative Example 2, and the specific steps were as follows:

[0094] 1×10 5 Rat bone marrow mesenchymal stem cells were inoculated into a 12-well plate and cultured in an incubator at 37°C for 12 hours. Then, 10 μL of ZIF-8 and ZIF-8@RM-Apt were added to the cells for co-culture. The cell culture medium was replaced every two days and ZIF-8 and ZIF-8@RM-Apt materials were added again. After culturing with osteogenic induction medium for 7 days, the cells were rinsed with distilled water for 3 times, fixed with 4% paraformaldehyde, and stained with an ALP staining kit (manufacturer: Beyotime, China).

[0095] Results Figure 6 As shown, both ZIF-8 and ZIF-8@RM-Apt can promote the osteogenic differentiation of bone marrow mesenchymal stem cells, and ZIF-8@RM-Apt has a stronger effect.

[0096] The material provided by the present invention can be used to promote osteogenic differentiation of bone marrow mesenchymal stem cells. By co-culturing ZIF-8@RM-Apt with bone marrow mesenchymal stem cells, more cells can be targeted to participate in osteogenic differentiation. The fusion between cell membranes is conducive to the uptake of ZIF-8 particles by bone marrow mesenchymal stem cells. 2+ The release of can further promote osteogenic differentiation. Therefore, the present invention can be used as a targeted drug delivery system to enhance the osteogenic differentiation of bone marrow mesenchymal stem cells and has great potential to promote bone regeneration.

[0097] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A targeted nanomaterial covering red blood cell membrane, characterized in that: It comprises a metal organic framework material, an erythrocyte membrane wrapped on the surface of the metal organic framework material and an aptamer connected to the outer surface of the erythrocyte membrane; the aptamer is Apt19S, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The targeted nanomaterial covering red blood cell membrane according to claim 1, characterized in that: The 5' end of the aptamer is modified with cholesterol.

3. The targeted nanomaterial covering red blood cell membrane according to claim 1, characterized in that: The metal organic framework material is ZIF-8.

4. The targeted nanomaterial covering red blood cell membrane according to claim 1, characterized in that: The average particle size of the metal organic framework material is 200 nm to 400 nm, and the average particle size of the targeted nanomaterial covering the red blood cell membrane is 200 nm to 400 nm.

5. A method for preparing a targeted nanomaterial covering red blood cell membrane according to any one of claims 1 to 4, characterized in that: The following steps are involved: Extruding the metal organic framework material and the red blood cell membrane by a membrane extrusion method to obtain a metal organic framework material coated with the red blood cell membrane; The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the targeted nanomaterial covering the red blood cell membrane.

6. The method for preparing a targeted nanomaterial covering red blood cell membrane according to claim 5, characterized in that: The membrane extrusion method is to use 400 nm and 200 nm microporous membranes for extrusion in sequence, and cyclically extrusion 15 to 25 times.

7. The method for preparing a targeted nanomaterial covering red blood cell membrane according to claim 5, characterized in that: The mass ratio of the metal organic framework material to the red blood cell membrane is 1:(100-200).

8. The method for preparing a targeted nanomaterial covering red blood cell membrane according to claim 5, characterized in that: The mass ratio of the aptamer to the metal organic framework material coated with the red blood cell membrane is 1:(200-400).

9. Use of a targeted nanomaterial covering red blood cell membrane in the preparation of a material for promoting osteogenic differentiation of bone marrow mesenchymal stem cells or a bone regeneration material.

10. A biomaterial, characterized in that: The biomaterial is used for promoting osteogenic differentiation or bone regeneration of bone marrow mesenchymal stem cells, and the biomaterial is prepared from a targeted nanomaterial covering the red blood cell membrane.

Images