N-acetylneuraminic acid synthase mutant and its application in the production of N-acetylneuraminic acid

By performing site-directed mutagenesis on N-acetylneuraminic acid synthase NeuB, NeuBC86T was obtained, which solved the problem of low NeuAc yield and achieved efficient production of NeuAc, making it suitable for industrial application.

CN119685283BActive Publication Date: 2025-10-14WUHAN YINZHI BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510033666.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-09
Publication Date
2025-10-14
Estimated Expiration
2045-01-09

AI Technical Summary

Technical Problem

In the existing microbial fermentation method for synthesizing N-acetylneuraminic acid (NeuAc), the enzymatic activity of N-acetylneuraminic acid synthase NeuB limits the production of NeuAc, resulting in high production costs and low efficiency, making it difficult to achieve large-scale industrial production.

Method used

By mutating the 86th amino acid of Neisseria meningitidis NeuB from cysteine ​​to threonine, an N-acetylneuraminic acid synthase mutant NeuBC86T was obtained and expressed in Bacillus licheniformis DW2△nagB1::gna1△yvmC::age to improve the enzyme activity.

Benefits of technology

The mutant NeuBC86T significantly increased the production of NeuAc to 3.68 g/L, a 57% increase compared to the wild type, and has good prospects for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005234906450000011
    Figure HDA0005234906450000011
Patent Text Reader

Abstract

The application belongs to the field of genetic engineering and enzyme engineering, and discloses a kind of N-acetylneuraminic acid synthase mutant and its application in N-acetylneuraminic acid production, the mutant NeuB C86T is obtained by site-specific mutation on wild-type N-acetylneuraminic acid synthase from Neisseria meningitidis (N. meningitidis) Neisseria meningitidis The 86th amino acid is replaced from cysteine (C) to threonine (T). Through high performance liquid chromatography (HPLC) analysis of N-acetylneuraminic acid yield, the results show that, compared with wild-type enzyme, the mutant NeuB C86T The synthesis efficiency of N-acetylneuraminic acid is significantly improved by 57%, which indicates that it has potential superiority in producing N-acetylneuraminic acid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a mutant of N-acetylneuraminic acid synthase and application thereof in production of N-acetylneuraminic acid. BACKGROUND

[0002] N-acetylneuraminic acid (NeuAc), also known as sialic acid, is a nine-carbon monosaccharide derivative containing amino. More than 50 kinds of sialic acids have been found, among which the content of N-acetylneuraminic acid accounts for 99% of the entire sialic acid family, so sialic acid usually refers to NeuAc. NeuAc, as the terminal sugar of various glycoproteins, glycopeptides and glycolipids, has diverse physiological functions. It can regulate the half-life of blood proteins, neutralize toxins, participate in cell adhesion, and has the functions of antibacterial detoxification, anti-adhesion and anticancer. NeuAc is often used in the research of antiviral drugs such as zanamivir and targeted therapy of cancer. In addition, exogenous dietary supplementation of NeuAc is beneficial to promoting the growth and development of the brain of infants and enhancing memory.

[0003] Due to the broad application prospect of NeuAc, its production strategy has become a research hotspot. At present, the production methods of NeuAc mainly include natural product extraction method, chemical synthesis method, enzyme catalysis method and whole cell catalysis method. The natural product extraction method and the chemical synthesis method are easy to cause environmental pollution. The enzyme catalysis method and the whole cell catalysis method have the problems of low product yield and high production cost, which limit the large-scale industrial production. Compared with the above methods, the microbial fermentation method is more popular due to its green, economic, efficient and sustainable characteristics.

[0004] At present, in the microbial fermentation method for synthesizing NeuAc, N-acetylneuraminic acid synthase NeuB is mainly used to catalyze N-acetylmannosamine (ManNAc) and phosphoenolpyruvate (PEP) to synthesize NeuAc. There are studies on improving the expression of N-acetylneuraminic acid synthase by screening and optimizing the expression of N-acetylneuraminic acid synthase. Liu et al. verified and optimized the neuB gene encoding N-acetylneuraminic acid synthase from three different microorganisms of Neisseria meningitides, Moritella viscosa and Escherichia coli, and found that the NeuB enzyme from Neisseria meningitides was determined as the best source. However, the enzyme activity of N-acetylneuraminic acid synthase NeuB limits the yield of NeuAc, so we plan to improve the enzyme activity of NeuB by modifying the protein structure to improve the yield of NeuAc. SUMMARY

[0005] The present application aims to provide a mutant of N-acetylneuraminic acid synthase NeuB C86T , wherein the mutant is shown in sequence 2.

[0006] Another object of the present invention is to provide an N-acetylneuraminic acid synthase mutant NeuB C86T Application in the catalytic production of N-acetylneuraminic acid.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant mutated the 86th amino acid of the wild-type N-acetylneuraminic acid synthase from Neisseria meningitides from cysteine ​​C to threonine T to obtain the N-acetylneuraminic acid synthase mutant NeuB of the present invention. C86T , as shown in SEQ ID NO.4.

[0009] The protection scope of the present invention also includes:

[0010] A fusion protein obtained by fusing the mutant protein described in SEQ ID NO.4 with a protein tag.

[0011] The gene encoding the mutant protein or fusion protein described in SEQ ID NO.4.

[0012] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above-mentioned coding gene.

[0013] The mutant, fusion protein, the mutant or fusion protein encoding gene of SEQ ID NO. 4, the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in the preparation of N-acetylneuraminic acid synthase.

[0014] A method for improving the activity of N-acetylneuraminic acid synthase comprises the following steps: performing the following mutation on the N-acetylneuraminic acid synthase: mutating the 86th cysteine ​​C in SEQ ID NO.2 to threonine T.

[0015] The gene encoding the mutant of SEQ ID NO.4 is preferably as shown in SEQ ID NO.3.

[0016] The mutant, fusion protein, the mutant or fusion protein encoding gene of SEQ ID NO. 4, the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in the preparation of N-acetylneuraminic acid.

[0017] The above application preferably comprises the following steps: preparing N-acetylneuraminic acid by culturing a recombinant microorganism, wherein the recombinant microorganism is obtained by transferring a recombinant vector having the above encoding gene into the engineered bacterium DW2△nagB1::gna1△yvm C::age;

[0018] The engineering bacteria DW2△nagB1::gna1△yvmC::age is Bacillus licheniformis DW2 (CN118995551A) which integrates glucose-6-phosphate acetyltransferase Gna1 with gene sequence number 850529 and N-acylglucosamine 2-epimerase Age with gene sequence number WP_011320279.1, and knocks out glucosamine-6-phosphate deaminase NagB1 with gene sequence number WP_020450463.1 and cyclic dipeptide synthase YvmC with gene sequence number WP_020452964.1.

[0019] Compared with the prior art, the present application has the following advantages:

[0020] The present application mutates the 86th threonine in the C-terminal domain of N-acetylneuraminic acid synthase to cysteine by site-directed mutagenesis (named mutant NeuB C86T in the present application), and the yield of NeuAc of the recombinant strain expressing the mutant NeuB C86T is 3.68 g / L, which is significantly increased by 57%, indicating that it is more suitable for industrial production. Experiments show that the Bacillus licheniformis recombinant strain based on the expression of N-acetylneuraminic acid synthase mutant has excellent NeuAc production capacity, and has better industrial application prospect compared with the recombinant strain containing unmutated N-acetylneuraminic acid synthase gene. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Comparison of NeuAc yields of N-acetylneuraminic acid synthase mutant and wild-type strain. DETAILED DESCRIPTION

[0022] The technical solutions of the present application are conventional solutions in the art if not specifically stated; the reagents or materials are from commercial channels if not specifically stated. In order to make the technical solutions and advantages of the present application clearer and more apparent, the following will further illustrate the present application with specific examples, but do not constitute a limitation to the present application.

[0023] The culture medium involved in the following examples is as follows:

[0024] LB liquid medium: yeast powder 5 g·L -1 , protein peptone 10 g·L -1 , NaCl 10 g·L -1 , pH 7.0.

[0025] LB solid medium: yeast powder 5 g·L -1, peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0026] Fermentation medium: yeast powder 12g·L -1 , peptone 6g·L -1 、(NH4)2SO4 6g·L -1 、K2HPO4·3H2O11g·L -1 、KH2PO4 3g·L -1 、MgSO4·7H2O 3g·L -1 , urea 6g·L -1 , glucose 60g·L -1 , pH 7.0, sterilize at 115℃ for 20min.

[0027] Example 1:

[0028] Construction of wild strain N-acetylneuraminic acid synthase NeuB:

[0029] The primer pair neuB-F / neuB-R was designed to clone the N-acetylneuraminic acid synthase gene neuB (GenBank: WP_002215299.1, gene sequence shown in SEQ ID NO. 1, encoded protein shown in SEQ ID NO. 2) from Neisseria meningitidis (GenBank: NZ_LLXR00000000.1). Using the genome of Bacillus subtilis 168 as a template, primers P43-F and P43-R were used to amplify the P43 promoter; primers TamyL-F and TamyL-R were used to amplify the amylase terminator TamyL. Using primers P43-F and TamyL-R, the P43, neuB, and TamyL fragments were amplified by SOE-PCR to generate the fusion fragment P43-neuB-TamyL. Using the plasmid pHY300PLK as a template and primers pHY-T5-F and pHY-T5-R, a full-plasmid PCR amplification was performed to obtain the linearized pHY300PLK vector. The amplified product was verified by electrophoresis and purified using an Omega DNA agarose gel recovery kit. The fusion fragment was then fused to the linearized pHY300PLK vector using the ClonExpress II One-Step Cloning Kit to generate the recombinant plasmid.

[0030] P43-F: TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

[0031] P43-R: TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA

[0032] neuB-F: AGAAAGGAGGAATATATAATGAGTAATATATATATCGTTGCTG

[0033] neuB-R: GTAAACTTGGTCTGACAGTTATTCCCCCTGATTTTTGA

[0034] TamyL-F: CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT

[0035] TamyL-R:TTTGCCCCAAGCTTCTAGAAGCGCAATAATGCCGTCGCACT

[0036] pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC

[0037] pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT.

[0038] The fused recombinant plasmid was transformed into E. coli DH5α competent cells, and positive colonies were screened on LB plates containing tetracycline. After overnight culture at 37°C in a shaking incubator, the plasmid was extracted and verified by sequencing. The recombinant plasmid that was correctly sequenced was named pHY-P43-neuB.

[0039] The sequencing correct plasmid pHY-P43-neuB was transformed into the competent cells of DW2△nagB1::gna1△yvmC::age which integrated the key genes of sialic acid synthesis, glucose-6-phosphate acetyltransferase Gna1 (Genome sequence number NC_001138.5; gene sequence number 850529) and N-acylglucosamine 2-epimerase Age (Genome sequence number NC_007413.1; gene sequence number WP_011320279.1), and knocked out the genes of glucosamine-6-phosphate deaminase NagB1 (Genome sequence number NC_021362.1; gene sequence number WP_020450463.1) and cyclic dipeptide synthase YvmC (Genome sequence number NC_021362.1; gene sequence number WP_020452964.1) by using the BIO-RAD Pulse controller (GenePulserTM) electric pulse transformation instrument at 2.4 kV and 4.8-5.2 ms, and then 800 μL of LB recovery solution was quickly added, and the cells were recovered at 37°C and 110 rpm for 3 h, and then spread on the screening medium with tetracycline resistance, and cultured at 37°C overnight, and then the transformants were selected, and the correct ones were verified by colony PCR, and then inoculated into the LB medium with 20 μg / mL tetracycline resistance, and cultured at 37°C for 14 h, and then the N-acetylneuraminic acid synthase NeuB wild strain was obtained.

[0040] The preparation method of the engineering bacteria DW2△nagB1::gna1△yvmC::age is as follows:

[0041] Firstly, taking the integrated gene gna1 as an example, the integrated expression method is described, the integration site is selected as the coding gene nagB1 of glucosamine-6-phosphate deaminase, and the integrated expression vector T2-△nagB1::gna1 is constructed.

[0042] According to the complete genome information of B. licheniformis DW2 (NC_021362.1), the complete sequences of genes gna1 and nagB1 were found on the NCBI website. Primers T2-△nagB1::gna1-F1 and T2-△nagB1::gna1-R1 were designed for the 572 bp upstream of gene nagB1, and primers T2-△nagB1::gna1-F5 and T2-△nagB1::gna1-R5 were designed for the 531 bp downstream of gene nagB1. The upstream and downstream homology arms of gene nagB1 were amplified by PCR using DNA from DW2 as template. The promoter P43UTR12 (Xiao et al., ACS Synth Biol. 2020 May) was used to amplify the upstream and downstream homology arms of gene nagB1. 15; 9(5): 1051-1058.) was used as a template and the promoter P43UTR was amplified using primers T2-△nagB1::gna1-F2 and T2-△nagB1::gna1-R2. 12; Using the Saccharomyces cerevisiae genome (genome sequence number NC_001138.5) as a template, the gna1 gene fragment was amplified using primers T2-△nagB1::gna1-F3 and T2-△nagB1::gna1-R3; using the plasmid PHY300PLK as a template, the terminator fragment Tamp was amplified using primers T2-△nagB1::gna1-F4 and T2-△nagB1::gna1-R4; according to overlap extension PCR (SOE-PCR), the upstream homologous arm of the gene nagB1, the promoter P43UTR12, the gene nagB1, the terminator Tamp and the downstream homologous arm of nagB1 were partially connected using primers T2-△nagB1::gna1-F1 and T2-△nagB1::gna1-R5. After recovery and purification of the SO E-PCR product, the product was digested with the restriction endonucleases Sac I and BamH I. The digested fragment was ligated with the T2 plasmid digested with Sac I and BamH I using T4 ligase. The ligated product was then transformed into E. coli DH5α. After verification by colony PCR and sequencing, the integrated expression plasmid T2-ΔnagB1::gna1 was obtained.T2-ΔnagB1::gna1-F1 : CTGCAGCCCGGGGGATCCAATGGTGCAACTCAAGGCG T2-ΔnagB1::gna1-R1 : GCATGAAATTGGAAATTCCGCGAATAATTTTCACGTCGTTCTCC T2-ΔnagB1::gna1-F2: GGAGAACGACGTGAAAATTATTCGCGGAATTTCCAATTTCATGC T2-ΔnagB1::gna1-R2: CGCGTCAAAGATGTGGCTCATTATATATTCCTCCTTTCTAATAT T2-ΔnagB1::gna1-F3: ATATTAGAAAGGAGGAATATATAATGAGCCACATCTTTGACGCG T2-ΔnagB1::gna1-R3: TATGAGTAAACTTGGTCTGACAGCTAAAACCGTTGCGTCATGAA AT2-ΔnagB1::gna1-F4: TTTCATGACGCAACGGTTTTAGCTGTCAGACCAAGTTTACTCAT AT2-ΔnagB1::gna1-R4: TCTGCCATCACAATCACATCATGTCTGACGCTCAGTGGAAC T2-ΔnagB1::gna1-F5: GTTCCACTGAGCGTCAGACATGATGTGATTGTGATGGCAGA T2-ΔnagB1::gna1-R5: GATCTTTTCTACGAGCTCATGTCTCTGAATGACAAGGATAAAC T2-ΔnagB1::gna1-YF: TAAAGGTCAAGAGGGAGGGTTC.

[0043] T2-ΔnagB1::gna1-YR: TTATGATGGACCCTTTGCGG

[0044] T2-F: ATGTGATAACTCGGCG T2-R: TCTGCTGAAGCCAGTTAC.

[0045] The sequencing correct plasmid T2-ΔnagB1::gna1 was transformed into B. licheniformis DW2 by electroporation (BIO-RAD) at 2.4 kV, pulse time 4.8-5.2 ms, and incubated at 37 °C overnight. The transformants were selected and verified by colony PCR. The positive clones were picked and used for single and double crossover passaging.

[0046] Single exchange: Pick the transformants that were successfully electroporated in the previous step, inoculate them into 5 mL of liquid LB medium (containing 20 μg / mL Kan antibiotics), and culture them at 45°C and 180 rpm for 10-12 hours to pass the first generation. Dilute the bacterial solution after the third passage by 10 -6 times, take 100 μL of the diluted bacterial solution and evenly spread it on a plate culture medium containing 20 μg / mL Kan antibiotics, and culture it at 45°C; after a single colony grows on the plate, pick a small number of single colonies and streak culture on the corresponding antibiotic plate. After 5 to 6 hours, pick an appropriate amount of bacteria for single exchange verification; after the verification is correct, perform double exchange subculture.

[0047] Double exchange: Take an appropriate amount of single colonies verified by single exchange and place them in 5 mL of liquid LB medium, subculture at 37°C and 180 rpm for a total of 3 generations; dilute the culture medium after the third subculture by 10 -6 times, take 100 μL and evenly spread it on LB solid culture medium plates, and culture it at 37°C; after single colonies grow on the plates, pick single colonies and spot-inoculate them on LB solid culture medium plates and LB solid culture medium plates containing 20 μg / mL Kan antibiotics, respectively, and culture them at 37°C for 12 h; select single colonies that do not grow on LB culture medium plates containing 20 μg / mL Kan antibiotics for double-exchange colony PCR identification, and the strain with correct double-exchange verification is named DW2△nagB1::gna1.

[0048] Next, the integrative expression vector T2-△yvmC::age was constructed using the same method as for T2-△nagB1::gna1. The age gene template was from Mucor variabilis (genome sequence number NC_007413.1). The constructed integrative expression vector T2-△yvm C::age was electroporated into the DW2△nagB1::gna1 strain. Through single and double cross-culture, the engineered strain DW2△nagB1::gna1△yvmC::age was constructed.

[0049] T2-△yvmC::age-F1:CTGCAGCCCGGGGGATCCCTCCTTTATCAATGTCAACGAAC

[0050] T2-△yvmC::age-R1:GCATGAAATTGGAAATTCCGCGGCGTCTGGCGTTTTAGTATTTC T2-△yvmC::age-F2:GAAATACTAAAACGCAGACGCCGCGGAATTTCCAATTTCATGC T2-△yvmC::age-R2:CCAACGCTTGCAGGTTTTTGCCCATTATATATTCCTCCTTTCT T2-△yvmC::age-F3:AGAAAGGAGGAATATATAATGGGCAAAAACCTGCAAGCGTTGG T2-△yvmC::age-R3:TATGAGTAAACTTGGTCTGACAGTTAGCTCAGGCTTCAAATTGTT GC T2-△yvmC::age-F4:GCAACAATTTGAAGCGCTGAGCTAACTGTCAGACCAAGTTTACTC ATA

[0051] T2-△yvmC::age-R4:TTAGATTCCACACTTTCGTCCGGTCTGACGCTCAGTGGAAC

[0052] T2-△yvmC::age-F5:GTTCCACTGAGCGTCAGACCGGACGAAAGTGTGGAATCTAA T2-△yvmC::age-R5:GATCTTTTCTACGAGCTCAGCGAGCTGTTCACTGCATTTA

[0053] T2-ΔyvmC::age-YF: GATGAACAGCGAGACGGACAGT2-ΔyvmC::age-YR: CATCGCTACTCCCTCGTATTCG.

[0054] Example 2:

[0055] Construction of N-acetylneuraminic acid synthase NeuB mutant strain:

[0056] The neuB catalytic active site was subjected to site-directed mutagenesis and reverse PCR amplification to replace the mutation in the gene sequence. Specifically, position 86 of the catalytic domain of the N-acetylneuraminic acid synthase molecule was mutated from cysteine ​​to threonine. Primers C86T-F and C86T-R were used, and the plasmid of Example 1 was used as a template to amplify the linear plasmid of the entire neuB mutant sequence C86T (the N-acetylneuraminic acid synthase neuB gene after point mutation is shown in SEQ ID NO. 3, and the encoded protein is shown in SEQ ID NO. 4).

[0057] C86T-F: GAAAGAACCGCGCTGAACGAA

[0058] C86T-R: GCGCGGTTCTTTCCATGATT.

[0059] Recovery and purification were performed according to the method in Example 1, linear plasmid was treated by ClonExpress II One-Step Cloning Kit, and transformed into E. coli DH5a competent cells. Positive colonies were screened on LB plates containing tetracycline. After verification by specific primers, inoculate into LB medium with Tet resistance, incubate at 37°C overnight, extract plasmid pHY-P43-neuB C86T , and perform sequencing verification. The recombinant plasmid with correct sequencing was named as pHY-P43-neuB C86T .

[0060] The above plasmid was electroporated into B. licheniformis DW2△nagB1::gna1△yvmC::age, spread on a selective medium with Tet resistance, incubated at 37°C overnight, selected transformants, and inoculated into LB medium with 20 μg / mL tetracycline resistance at 37°C for 14 h. The N-acetylneuraminic acid synthase NeuB mutant strain was obtained.

[0061] Example 3:

[0062] Comparison of NeuAc production of N-acetylneuraminic acid synthase NeuB mutant strain and wild type strain:

[0063] N-acetylneuraminic acid synthase NeuB mutant strain and N-acetylneuraminic acid synthase NeuB wild type strain were activated from the preserved glycerol tube, and inoculated into LB medium with 20 μg / mL tetracycline resistance at 37°C for 14 h. The inoculation amount was 3%. Then, they were transferred into fermentation medium and incubated at 37°C for 48 h. The fermentation supernatant was collected by centrifugation at 12000 rpm for 10 min, diluted 20 times, passed through a 0.22 μm filter membrane by a 1 mL syringe, and injected into a liquid phase bottle with 500 μL. The sample was analyzed by liquid chromatography HPLC.

[0064] Liquid chromatography conditions: Agilent liquid chromatograph (configured with a UV detector), sample injection amount 1 μL, mobile phase: 5 mM H2SO4, chromatographic column: organic acid column, column temperature: 30°C.

[0065] The results showed that the NeuAc production of the recombinant strain NeuB C86T mutant reached 3.68 g / L, which was significantly improved by 57% compared with the control.

Claims

1. A synthetic N-acetylneuraminic acid synthase mutant NeuB C86T The amino acid sequence of the N-acetylneuraminic acid synthase mutant is shown in SEQ ID NO.

4.

2. A fusion protein obtained by fusing the mutant according to claim 1 with a protein tag.

3. A gene encoding the mutant according to claim 1 or the fusion protein according to claim 2.

4. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell comprising the coding gene according to claim 3.

5. Use of the mutant according to claim 1, the fusion protein according to claim 2, the coding gene according to claim 3, or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the coding gene according to claim 3 according to claim 4 in the preparation of N-acetylneuraminic acid synthase.

6. A method for improving the activity of N-acetylneuraminic acid synthase, comprising the following steps: mutating N-acetylneuraminic acid synthase by mutating the cysteine ​​C at position 86 of SEQ ID NO. 2 to threonine T.

7. The coding gene according to claim 3, wherein the polynucleotide encoding the gene is shown as SEQ ID NO.

3.

8. Use of the mutant according to claim 1, the fusion protein according to claim 2, the coding gene according to claim 3, or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the coding gene according to claim 3 according to claim 4 in the preparation of N-acetylneuraminic acid.

Citation Information

Patent Citations

  • Bacillus licheniformis for producing gamma-aminobutyric acid through fermentation method as well as construction method and application of bacillus licheniformis

    CN118995551A

  • Ozone sterilizer for clothes

    CN2538337Y

  • Sialyltransferase for production of sialylated oligosaccharides

    CN118401655A

  • 5-aminolevulinic acid synthetase mutant and application thereof

    CN119193522A