Typing analysis method for extracellular vesicles secreted by tumor cells and immune cells

Abstract

The invention discloses a typing analysis method for extracellular vesicles secreted by tumor cells and immune cells, which comprises the following steps: designing a PD-L1 protein recognition aptamer PD-L1-L, an EpCAM protein recognition aptamer EpCAM-L and a molecular beacon according to different expression levels of surface markers of the extracellular vesicles (PD-L1 + and EpCAM +) derived from the tumor cells and the extracellular vesicles (PD-L1 + and EpCAM-) derived from the immune cells; when the DNA probe recognizes the extracellular vesicles, fluorescence of the Cy5-PD-L1-L aptamer of the tumor cell source extracellular vesicles is quenched, a fluorescence signal of the Connector is recovered, and the immune cell source extracellular vesicles do not respond, so that the two extracellular vesicles are subjected to typing analysis. The method has the advantages that the extracellular vesicles of different cell sources can be subjected to typing analysis by using a strategy based on double aptamers and double switches, and false positive signals caused by single aptamer recognition are avoided.

Description

Technical Field

[0001] The present invention relates to a method for analyzing the typing of extracellular vesicles secreted by tumor cells and immune cells. Background Art

[0002] Extracellular vesicles are vesicles secreted by cells with a lipid bilayer enclosed structure. Extracellular vesicles contain protein markers, nucleic acids, lipids and other molecules. These biological molecules play an important role in the participation of extracellular vesicles in cell-to-cell communication, thereby regulating a variety of biological processes. Existing methods for studying extracellular vesicles are mostly to separate and detect total extracellular vesicles from cell culture supernatants or body fluids (blood, urine, breast milk, tears) and tissues. Body fluids and tissues contain extracellular vesicles from different cell sources. The detection of the total number of extracellular vesicles and marker levels conceals the biological function information of the extracellular vesicles from different cell sources themselves, and the understanding of the biological significance of extracellular vesicles in intercellular communication is limited. Therefore, it is necessary to develop typing and analysis methods for extracellular vesicles from different cell sources. Summary of the invention

[0003] The main purpose of the present invention is to provide a method for analyzing the typing of extracellular vesicles secreted by tumor cells and immune cells.

[0004] The technical solution adopted by the present invention to solve its technical problem is:

[0005] A method for extracellular vesicle typing analysis comprises the following steps:

[0006] Step 1, providing two aptamer probes and a connecting arm, wherein the two aptamer probes are respectively an aptamer probe PD-L1-L for recognizing PD-L1 protein and an aptamer probe EpCAM-L for recognizing EpCAM protein, and the two aptamers respectively have a sequence that binds to the target protein and a DNA extension chain, and the DNA extension chains on the two aptamers are respectively complementary to a DNA sequence of the connecting arm, and the connecting arm is a hairpin structure modified with a quenching group and a first luminescent group; the PD-L1-L aptamer probe is modified with a second luminescent group.

[0007] Step 2: Obtain extracellular vesicles, incubate them with two aptamer probes, wash to remove unbound probes, and then incubate them with the connecting arm.

[0008] Step 3. Using fluorescence identification, a dual-switch mode in which the first fluorescence of the connecting arm is restored and the second fluorescence of PD-L1-L is quenched is used to identify the extracellular vesicles as derived from tumor cells; the first fluorescence of the connecting arm is quenched and the second fluorescence of PD-L1-L is maintained, which is used to identify the extracellular vesicles as derived from immune cells.

[0009] Specifically, when extracellular vesicles derived from tumor cells bind to the PD-L1-L aptamer and the EpCAM-L aptamer and are incubated with the connecting arm, due to the complementarity of PD-L1-L and EpCAM-L with the partial sequence of the connecting arm, the hairpin structure of the connecting arm is opened, and the first fluorescence is restored. At the same time, the quenching group on the connecting arm is adjacent to the second fluorescent molecule on PD-L1-L, which can quench the second fluorescence, thereby generating a dual switching mode of first fluorescence recovery and second fluorescence quenching, thereby identifying extracellular vesicles derived from tumor cells; immune cells only express PD-L1 and not EpCAM, so they can only bind to the PD-L1-L aptamer but not the EpCAM-L aptamer; when incubated with the connecting arm, the hairpin structure of the connecting arm cannot be opened, the second fluorescence of PD-L1-L is maintained, and the first fluorescence of the connecting arm is quenched, and it is identified as an extracellular vesicle derived from an immune cell.

[0010] Furthermore, in step 1, the first sequence on the connecting arm that is complementary to the aptamer probe PD-L1-L and the second sequence on the connecting arm that is complementary to the aptamer probe EpCAM-L do not overlap.

[0011] Furthermore, in step 2, the method for obtaining extracellular vesicles includes a method based on physical separation or immune capture.

[0012] Furthermore, the physical separation method includes ultracentrifugation, filtration, and size exclusion chromatography.

[0013] Furthermore, the capture molecule used in the immune capture method is an antibody, a polypeptide or a nucleic acid aptamer, wherein the antibody, polypeptide or aptamer is an aptamer that specifically recognizes CD63, CD81 or CD9.

[0014] Furthermore, the first fluorescent species include organic small molecules, quantum dots, and fluorescent proteins; the second fluorescent species include organic small molecules, quantum dots, and fluorescent proteins; and the quenching group species include BHQ, Tamra, and Dabcyl.

[0015] The present invention also provides the application of the extracellular vesicle typing analysis method in a tumor microenvironment in the screening of extracellular vesicle pattern cells secreted by tumor cells and immune cells.

[0016] Compared with the background technology, this technical solution has the following advantages:

[0017] The present invention develops a dual switch strategy based on dual aptamers and molecular beacons for the typing analysis of extracellular vesicles secreted by tumor cells and immune cells. + EpCAM + ) and immune cell-derived extracellular vesicles (PD-L1 +EpCAM - ) Based on the different expression levels of surface markers of different cells, the PD-L1 protein recognition aptamer PD-L1-L, the EpCAM protein recognition aptamer EpCAM-LL and the molecular beacon Connector are designed. When the DNA probe recognizes the extracellular vesicles, the fluorescence of the Cy5-PD-L1-L aptamer of the tumor cell-derived extracellular vesicles is quenched, the fluorescence signal of the Connector is restored, and the extracellular vesicles derived from immune cells have no response, thereby performing typing analysis on the two types of extracellular vesicles. The advantage of the method of the present invention is that the strategy based on dual aptamers and dual switches can be used to perform typing analysis on extracellular vesicles from different cell sources, avoiding false positive signals caused by a single aptamer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0019] Figure 1 It is a schematic diagram of the principle of the present invention.

[0020] Figure 2 Characterization of PD-L1 and EpCAM expression levels of A375 extracellular vesicles.

[0021] Figure 3 Fluorescence intensity of the A375 extracellular vesicle surface linker (A) and the Cy5-PD-L1-L aptamer (B) under the dual-switch strategy.

[0022] Figure 4 Confocal imaging of A375 extracellular vesicles. (A) A375 extracellular vesicles incubated with Cy5-PD-L1-L aptamer and EpCAM-L aptamer; (B) A375 extracellular vesicles incubated with Cy5-PD-L1-L aptamer, EpCAM-L aptamer and linker.

[0023] Figure 5 Characterization of PD-L1 and EpCAM expression levels of U251 extracellular vesicles.

[0024] Figure 6 Fluorescence intensity of the U251 extracellular vesicle surface linker (A) and the Cy5-PD-L1-L aptamer (B) under the dual-switch strategy.

[0025] Figure 7 Confocal imaging of U251 extracellular vesicles. (A) U251 extracellular vesicles incubated with Cy5-PD-L1-L aptamer and EpCAM-L aptamer; (B) U251 extracellular vesicles incubated with Cy5-PD-L1-L aptamer, EpCAM-L aptamer and linker.

[0026] Figure 8Identification of mixed samples of A375 and U251 extracellular vesicles. Yellow arrows: A375 extracellular vesicles; blue arrows: U251 extracellular vesicles. DETAILED DESCRIPTION

[0027] Example 1

[0028] See also Figure 1 , which is a schematic diagram of the principle of the present invention, provides a method for analyzing extracellular vesicles secreted by tumor cells and immune cells, and distinguishes extracellular vesicles derived from tumor cells and extracellular vesicles derived from immune cells by the difference in the expression of PD-L1 and EpCAM markers on the surface of extracellular vesicles. An aptamer probe (Cy5-PD-L1-L) and an EpCAM protein aptamer probe (EpCAM-L) are designed to recognize PD-L1 protein. These two aptamers have a sequence that binds to the target protein and a DNA extension chain, and the DNA extension chain is complementary to a DNA sequence of the connecting arm (Conenctor). Tumor cells are double positive for PD-L1 and EpCAM, and can bind to Cy5-PD-L1-L aptamer and EpCAM-L aptamer. When incubated with Conenctor modified with FAM and quenching group BHQ, due to the complementarity of Cy5-PD-L1-L and EpCAM-L with the Connector partial sequence, the hairpin structure of Conenctor is opened and the FAM fluorescence is restored. At the same time, the quenching group BHQ on Conenctor is adjacent to the Cy5 fluorescent molecule on Cy5-PD-L1-L, which can quench the fluorescence of Cy5. This produces a dual-switch mode of FAM fluorescence recovery and Cy5 fluorescence quenching, thereby identifying extracellular vesicles derived from tumor cells. Immune cells are PD-L1 positive, so they can only bind to the Cy5-PD-L1-L aptamer but not the EpCAM-L aptamer. When incubated with the connecting arm, the hairpin structure of Conenctor cannot be opened, so the Cy5 fluorescence of Cy5-PD-L1-L is maintained, and the FAM fluorescence of the connecting arm is quenched.

[0029] Specifically, the sequences and fluorescent labels of the two probes and the connecting arms of the present invention are as follows:

[0030] Cy5-PD-L1-L(5'-3'): TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTTTGTGGTCTATGTCGTCGTTCGCTAGT AGTTC / iCy5dT / CTGGGCTGCAC;

[0031] EpCAM-L(5'-3':TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCTCACTACAGAGG TTGCGTCTGTCCCACG TTGTCATGGGGGGTTGGCCTG;

[0032] Connector (Connector,5'-3'):FAM-CTGGGCTGTTATTGTATTCTACGCCTCGAGTGCAGCCCAG-BHQ

[0033] According to the dual switch mode or fluorescence maintenance principle of the present invention, in other embodiments, other sequences of PD-L1-L, EpCAM-L and connecting arms can also be used to achieve the dual switch mode or fluorescence maintenance, and the effect of FAM fluorescence quenching of the connecting arm. In addition, the types of fluorescent groups and quenching groups can also be replaced. The above specific sequences and fluorescent groups and quenching groups are only used for example and not for limitation.

[0034] After A375 cells were revived, they were cultured with DMEM medium (10% serum to remove extracellular vesicles and 1% double antibody) for 60 hours, and the culture medium was collected. The collected cell culture supernatant was centrifuged at 3000g for 20 minutes at 4°C to remove cell debris. The supernatant after centrifugation was taken out with a pipette and centrifuged at 4°C, 16500g, 45min to remove large vesicles. The supernatant was then centrifuged at 100,000g, 4°C for 2 hours, and the precipitate after centrifugation was harvested. Finally, the precipitate obtained in the previous step was suspended in PBS, centrifuged at 4°C, 100000g, 2h, the supernatant was removed, and the A375 extracellular vesicle sample was resuspended with 200μL PBS.

[0035] First, the expression of PD-L1 and EpCAM in A375 extracellular vesicles obtained by ultracentrifugation was verified. The total protein concentration of A375 extracellular vesicles was detected using a BCA kit. 10 μg of extracellular vesicle sample was incubated with 4 μL of latex aldehyde beads at room temperature for 2 h and blocked with 100 mM glycine and 0.5% BSA for 30 min. Wash twice with PBS (containing 0.5% BSA), suspend in 50 μL of PBS containing 0.5% BSA, and prepare latex aldehyde beads-extracellular vesicle complexes. 5 μL of latex aldehyde bead-extracellular vesicle complex was reacted with 200 nM FAM-PD-L1-L / FAM-EpCAM-L / FAM-labeled 59-base random sequence in binding buffer (PBS containing 10 mM MgCl2, 0.5% BSA) at room temperature for 30 min, washed twice by centrifugation with 0.5% BSA (5500 rpm, 3 min), and the fluorescence of FITC channel was characterized on a flow cytometer to characterize the expression of PD-L1 and EpCAM in A375 extracellular vesicles.

[0036] The results of flow cytometry analysis showed that the fluorescence intensity of FAM-PD-L1-L and FAM-EpCAM-L in A375 extracellular vesicles was significantly stronger than that of control DNA ( Figure 2 ), indicating that A375 extracellular vesicles are PD-L1 positive and EpCAM positive, and PD-L1-L aptamer and EpCAM-L aptamer can be used to identify A375 extracellular vesicles that are double positive for PD-L1 and EpCAM.

[0037] Then flow cytometry was used to verify the feasibility of this strategy for detecting PD-L1-positive and EpCAM-positive extracellular vesicles. The latex aldehyde beads-A375 extracellular vesicle complex was prepared according to the above method. 5 μL of latex aldehyde beads-extracellular vesicle complex was incubated with 200nM Cy5-PD-L1-L aptamer and 200nM EpCAM-L aptamer in binding buffer (PBS containing 10mM MgCl2, 0.5% BSA) at room temperature for 40min, washed twice by centrifugation (5500rpm, 3min) with 0.5% BSA, and then 1μM Connector was added, incubated in binding buffer at room temperature for 20min, washed 3 times, and resuspended in binding buffer. The control group was latex aldehyde beads-extracellular vesicle complex incubated with Cy5-labeled 59-base random sequence / Cy5-PD-L1-L aptamer / EpCAM-L aptamer for 40min, and then incubated with Connector at room temperature for 20min. After incubation, the fluorescence of FITC channel and Cy5 channel was characterized on the flow cytometer to characterize the applicability of DNA probe. The results showed that compared with the reaction with control DNA, PD-L1-L or EpCAM-L aptamer, the fluorescence intensity of the connecting arm increased when A375 extracellular vesicles reacted with PD-L1-L aptamer and EpCAM-L aptamer at the same time ( Figure 3 A), this is because when the PD-L1-L aptamer and EpCAM-L exist at the same time, they can complement each other with the tether, open the hairpin structure of the tether, and make the fluorescent group FAM and the quenching group BHQ of the tether move away, and the fluorescence of the FAM fluorescent group is restored. The fluorescence intensity characterization of the Cy5-PD-L1-L aptamer showed that when the PD-L1-L aptamer, EpCAM-L aptamer and tether were added at the same time, the fluorescence intensity of the Cy5-PD-L1-L aptamer was lower than that of other control conditions ( Figure 3 B), this is because under this condition, after the hairpin structure of the connecting arm is opened, the quenching group BHQ modified on the connecting arm is adjacent to the Cy5 fluorescent molecule of the Cy5-PD-L1-L aptamer, quenching the fluorescence of Cy5.

[0038] Next, the feasibility of detecting A375 extracellular vesicles was investigated using a laser confocal microscope. The A375 extracellular vesicles were coupled to latex aldehyde beads using the above method and then incubated with the corresponding probes. After the incubation was completed, they were dropped onto a confocal dish for confocal imaging. The results showed that after the control DNA (a random sequence of 59 bases labeled with Cy5) / PD-L1-L aptamer / EpCAM-L aptamer were incubated with the tether respectively, the hairpin structure of the tether was not opened, so the fluorescence of the tether remained quenched, and the fluorescence intensity of Cy5 remained unchanged. After the A375 extracellular vesicles were incubated with the PD-L1-L aptamer, EpCAM-L aptamer, and tether at the same time, the hairpin structure of the tether was opened, the FAM fluorescence modified on the tether was restored, and the Cy5 fluorescence of the Cy5-PD-L1-L aptamer was quenched ( Figure 4 ), it is worth noting that the Cy5 fluorescence of some Cy5-PD-L1-L aptamers was not quenched, which is consistent with the results of flow cytometry analysis. This result shows that the extracellular vesicles of A375 cells that are double positive for PD-L1 and EpCAM can be imaged by laser confocal microscopy.

[0039] Example 2

[0040] Analysis of extracellular vesicles secreted by immune cells

[0041] Immune cell-derived extracellular vesicles express PD-L1 + , EpCAM - Therefore, when immune cell-derived extracellular vesicles were incubated with Cy5-PD-L1-L aptamer and EpCAM-L aptamer, they could only bind to Cy5-PD-L1-L aptamer, and when incubated with the linker arm, the hairpin structure of the linker arm could not be opened. Therefore, the Cy5 fluorescence of Cy5-PD-L1-L was maintained, and the FAM fluorescence of the linker arm was quenched.

[0042] After the U251 cells were revived, they were cultured with DMEM medium (10% serum to remove extracellular vesicles and 1% double antibody) for 60 hours, and the culture medium was collected. The collected cell culture supernatant was centrifuged at 3000g for 20 minutes at 4°C to remove cell debris. The supernatant after centrifugation was taken out with a pipette and centrifuged at 4°C, 16500g, 45min to remove large vesicles. The supernatant was then centrifuged at 100,000g, 4°C for 2 hours, and the precipitate after centrifugation was harvested. Finally, the precipitate obtained in the previous step was suspended in PBS, centrifuged at 4°C, 100000g, 2h, the supernatant was removed, and the U251 extracellular vesicle sample was resuspended with 200μL PBS.

[0043] Verify the expression of PD-L1 and EpCAM in U251 extracellular vesicles obtained by ultracentrifugation. The total protein concentration of A375 extracellular vesicles was detected using a BCA kit. 10 μg of extracellular vesicle sample was incubated with 4 μL of latex aldehyde beads at room temperature for 2 h and blocked with 100 mM glycine and 0.5% BSA for 30 min. Wash twice with PBS (containing 0.5% BSA) and suspend in 50 μL of PBS containing 0.5% BSA to prepare latex aldehyde beads-extracellular vesicle complexes. Take 5 μL of latex aldehyde beads-extracellular vesicle complex and 200nM FAM-PD-L1-L / FAM-EpCAM-L / FAM labeled 59 bases random sequence in binding buffer (PBS containing 10mMMgCl2, 0.5% BSA) at room temperature for 30min, wash twice with 0.5% BSA centrifugation (5500rpm, 3min), characterize the fluorescence of FITC channel on flow cytometer, and characterize the expression of PD-L1 and EpCAM of U251 extracellular vesicles. The flow cytometry verification results showed that U251 extracellular vesicles were PD-L1 positive and EpCAM negative ( Figure 5 ), which can be used to verify the feasibility of the dual switch strategy for detecting extracellular vesicles derived from immune cells.

[0044] Then flow cytometry was used to verify the feasibility of the dual switch strategy for detecting PD-L1-positive and EpCAM-negative extracellular vesicles. The latex aldehyde bead-extracellular vesicle complex was prepared according to the above method. 5 μL of the latex aldehyde bead-extracellular vesicle complex was incubated with 200 nM Cy5-PD-L1-L aptamer and 200 nM EpCAM-L aptamer in binding buffer (PBS containing 10 mM MgCl2 and 0.5% BSA) at room temperature for 40 min, washed twice by centrifugation (5500 rpm, 3 min) with 0.5% BSA, and then 1 μM Connector was added, incubated in binding buffer at room temperature for 20 min, washed 3 times, and resuspended in binding buffer. The control group was incubated with latex aldehyde bead-extracellular vesicle complex and Cy5-labeled 59-base random sequence / Cy5-PD-L1-L aptamer / EpCAM-L aptamer for 40 min, and then incubated with Connector at room temperature for 20 min. After incubation, the fluorescence of the FITC channel and the Cy5 channel were characterized on the flow cytometer to characterize the applicability of the DNA probe. The results showed that when U251 extracellular vesicles were incubated with PD-L1-L aptamer and EpCAM-L aptamer at the same time, the fluorescence intensity of the linker arm was comparable to that of the control DNA, the addition of PD-L1-L or EpCAM-L aptamer ( Figure 6A), this is because U251 extracellular vesicles only bind to the PD-L1-L aptamer, and the PD-L1-L aptamer cannot open the hairpin structure of the connecting arm. Characterization of the fluorescence intensity of the Cy5-PD-L1-L aptamer showed that the fluorescence intensity of the Cy5-PD-L1-L aptamer when U251 extracellular vesicles were incubated with the PD-L1-L aptamer, EpCAM-L aptamer and the connecting arm was comparable to other control conditions ( Figure 6 B), this is because the hairpin structure of the connecting arm is not opened, so the quenching group BHQ on the connecting arm cannot quench the fluorescence of the Cy5-PD-L1-L aptamer. The above results show that this strategy can be used for the detection of U251 extracellular vesicles.

[0045] Finally, the feasibility of detecting U251 extracellular vesicles using laser confocal microscopy was investigated. U251 extracellular vesicles were coupled to latex aldehyde beads according to the above method and then incubated with the corresponding probes. After incubation, the feasibility of laser confocal microscopy imaging was investigated. The results showed that after U251 extracellular vesicles were incubated with Cy5-PD-L1-L aptamer, EpCAM-L aptamer and tether, the fluorescence intensity of the tether was consistent with that of the control group, and the fluorescence intensity of the Cy5-PD-L1-L aptamer was also consistent with that of U251 incubated only with Cy5-PD-L1-L aptamer and tether ( Figure 7 ), indicating that the method of the present invention can be used to identify PD-L1-positive, EpCAM-negative U251 extracellular vesicles.

[0046] Analysis of mixed extracellular vesicle samples

[0047] Tumor tissue and blood contain extracellular vesicles secreted by tumor cells and immune cells. Tumor cells can secrete PD-L1 + EpCAM + Extracellular vesicles, immune cells can secrete PD-L1 + EpCAM - Extracellular vesicles. Distinguishing these two types of PD-L1-positive extracellular vesicles helps to study the biological significance of extracellular vesicle PD-L1. Therefore, it is necessary to investigate PD-L1 + EpCAM + Extracellular vesicles and PD-L1 + EpCAM - The feasibility of distinguishing two types of extracellular vesicles in an extracellular vesicle mixed system to simulate the extracellular vesicles secreted by tumor cells and immune cells in tumor tissue and blood.

[0048] A375 EVs and U251 EVs were mixed in a ratio of 1:1 or 1:5 and then coupled to latex aldehyde beads to investigate the feasibility of mixed EV sample typing analysis. Based on previous flow cytometry and confocal imaging results, A375 EVs were identified as Connector + , PD-L1 + / - ; U251 extracellular vesicles identified as Connectors - , PD-L1 + The results showed that as the ratio of A375 to U251 increased, confocal imaging results showed that Connector - , PD-L1 + The proportion of positive extracellular vesicles increased, that is, the proportion of identified U251 extracellular vesicles increased ( Figure 8 ), so this method can identify A375 extracellular vesicles (PD-L1 + EpCAM + ) and U251 extracellular vesicles (PD-L1 + EpCAM - ).

[0049] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for analyzing the typing of extracellular vesicles secreted by tumor cells and immune cells, comprising the following steps: Step 1: providing two aptamer probes and a linker arm, wherein: The two aptamer probes are respectively an aptamer probe PD-L1-L for recognizing PD-L1 protein and an aptamer probe EpCAM-L for recognizing EpCAM protein. The two aptamers respectively have a sequence that binds to the target protein and a DNA extension chain. The DNA extension chains on the two aptamers are respectively complementary to a DNA sequence of a connecting arm. The connecting arm is a hairpin structure and is modified with a quenching group and a first luminescent group. The PD-L1-L aptamer probe is modified with a second luminescent group. Step 2, obtaining extracellular vesicles, incubating with two aptamer probes, washing to remove unbound probes, and then incubating with the connecting arm; Step 3. Using fluorescence identification, a dual-switch mode in which the first fluorescence of the connecting arm is restored and the second fluorescence of PD-L1-L is quenched is used to identify the extracellular vesicles as derived from tumor cells; the first fluorescence of the connecting arm is quenched and the second fluorescence of PD-L1-L is maintained, which is used to identify the extracellular vesicles as derived from immune cells.

2. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 1, characterized in that: In step 1, the first sequence on the connecting arm that is complementary to the aptamer probe PD-L1-L and the second sequence on the connecting arm that is complementary to the aptamer probe EpCAM-L do not overlap.

3. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 1, characterized in that: In step 2, methods for obtaining extracellular vesicles include methods based on physical separation or immune capture.

4. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 3, characterized in that: The physical separation method comprises at least one of ultracentrifugation, filtration, and size exclusion chromatography.

5. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 3, characterized in that: The immune capture method includes using at least one of antibodies, polypeptides, and nucleic acid aptamers to capture.

6. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 1, characterized in that: The first fluorescent species includes at least one of organic small molecules, quantum dots, and fluorescent proteins.

7. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 1, characterized in that: The second fluorescent species includes at least one of organic small molecules, quantum dots, and fluorescent proteins.

8. The method for analyzing extracellular vesicles secreted by tumor cells and immune cells according to claim 1, characterized in that: The quenching group type includes at least one of BHQ, Tamra, and Dabcyl.

9. Use of the method for typing and analyzing extracellular vesicles secreted by tumor cells and immune cells according to any one of claims 1 to 8 in typing and analyzing extracellular vesicles secreted by tumor cells and immune cells.

Images