A kit for detecting LINC01480 gene expression and a preparation method and application thereof

The kit for detecting LINC01480 gene expression has solved the problems of low sensitivity and high cost in MM MRD monitoring, realizing non-invasive and accurate MRD monitoring, guiding the treatment and prognosis of MM, and reducing the testing cost.

CN119710009BActive Publication Date: 2025-11-04SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510101388.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-11-04
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

Existing methods for monitoring minimal residual disease (MRD) in multiple myeloma (MM) suffer from low sensitivity, high cost, high invasiveness, and difficulty in continuous monitoring. In particular, current technologies are unable to accurately predict progression-free survival (PFS) and overall survival (OS).

Method used

By detecting LINC01480 gene expression, a non-invasive kit for monitoring MM MRD was developed using specific primer pairs and the internal reference gene GAPDH, combined with RT-qPCR technology. The kit includes specific primer pairs, positive and negative control lentiviral vectors, and an RT-qPCR reaction system to achieve quantitative analysis of LINC01480 gene expression levels.

Benefits of technology

It provides a more accurate, specific, and convenient non-invasive monitoring method that can dynamically monitor the MRD of MM patients, guide treatment decisions, reduce costs, and is suitable for widespread clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119710009B_ABST
    Figure CN119710009B_ABST
Patent Text Reader

Abstract

The application discloses a kit for detecting LINC01480 gene expression and a preparation method and application thereof, relates to the field of gene expression kits, and is used for detecting LINC01480 gene expression and comprises a specific primer pair for the LINC01480 gene, a specific primer pair for a reference gene GAPDH, a positive control lentivirus vector containing a LINC01480 gene segment, a negative control lentivirus vector and an RT-qPCR reaction system. The application non-invasively monitors MRD of MM patients after treatment by detecting LINC01480 gene expression, so as to improve the convenience and accuracy of index monitoring of MRD of the MM patients after treatment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene expression kits, in particular to a kit for detecting LINC01480 gene expression and a preparation method and application thereof. BACKGROUND

[0002] Multiple myeloma (MM) is a malignant hematological tumor characterized by the abnormal proliferation of clonal plasma cells, accounting for 10% of hematological malignancies and 1% of all malignancies. So far, MM is still incurable, with an effective chemotherapy rate of 40%-60% and a complete remission rate of less than 5%. The course of MM patients varies greatly, from a few months to several decades. Although new drugs such as lenalidomide and bortezomib have shown significant efficacy in recent years, MM is still incurable, and all patients will eventually relapse. The main reason is that there are still minimal residual diseases (MRD) in MM patients after conventional treatment, and MRD is considered to be one of the sources of relapse. MRD monitoring after treatment is related to treatment outcomes, including progression-free survival (PFS) and overall survival (OS). MRD directly guides treatment and prognosis, so it is of great significance to monitor MRD.

[0003] The current clinical MRD monitoring method is to collect bone marrow samples for cell morphology detection and multi-parameter flow cytometry (MFC), but there are some shortcomings: ①MM has a unique tissue distribution characteristic, i.e., tumor cells infiltrate and proliferate in the marrow in different degrees, showing focal distribution, and multiple punctures are often needed to detect positive results, and the results of multiple detections vary greatly. ②Cell morphology is highly subjective and difficult to distinguish between benign and malignant plasma cells. And after chemotherapy, the number of myeloma cells decreases sharply, even if the number of cells classified by hand exceeds the daily detection number, it is still difficult to accurately count the number of tumor cells. ③Due to the large differences in instrument status and personnel technical level among laboratories, it is difficult to unify the detection scheme and monitoring indicators of flow cytometry, and even the sensitivity of the current high-end multi-color flow cytometry (eight to ten colors) is still 10 -4 . ④The prediction accuracy of MFC for PFS and OS is not perfect, and according to the index (C-statistic) for measuring the discriminant ability of the prediction model, the C-statistic of PFS is only about 0.67, and the C-statistic of OS is 0.76, and a C-statistic exceeding 0.7 is considered to be a model with good prediction ability.

[0004] Currently, the monitoring indicators of MM MRD mainly include the expression pattern of myeloma cell surface molecules and clonal rearrangement of immunoglobulin genes. The plasma cells with abnormal surface molecule expression pattern cannot be equated with malignant tumor plasma cells, and this indicator can only be detected by flow cytometry, which is limited by the sensitivity of the technology. The clonal rearrangement of immunoglobulin genes is currently mainly detected by second-generation sequencing, which is high in cost, about 10 times that of flow detection. In addition, this detection method cannot detect extramedullary lesions, cannot fully reflect the disease status of MM, and as an invasive operation, is not suitable for continuous sampling and dynamic monitoring, which is not conducive to clinical application. Therefore, more accurate and more specific methods are needed to predict PFS and OS, especially more convenient non-invasive monitoring means.

[0005] In view of this, the present application is proposed. SUMMARY

[0006] The purpose of the present application is to provide a kit for detecting LINC01480 gene expression and its preparation method and application, which non-invasively monitors MM MRD by detecting LINC01480 gene expression, and the kit and method provide more accurate, more specific, and more convenient non-invasive monitoring means to predict PFS and OS.

[0007] Firstly, the present application provides a kit for detecting LINC01480 gene expression, which comprises a specific primer pair for LINC01480 gene, a specific primer pair for internal reference gene GAPDH, a positive control lentivirus vector containing LINC01480 gene fragment, a negative control lentivirus vector, and an RT-qPCR reaction system.

[0008] Specifically, LINC01480 is a long-chain non-coding RNA, based on the expression difference of LINC01480 in MM, the MRD of MM patients after treatment is monitored by quantifying the expression level of LINC01480 in peripheral blood plasma, and the expression amount of LINC01480 is accurately measured by RT-qPCR technology using specific primer pairs for LINC01480 gene and internal reference gene GAPDH. The internal reference gene GAPDH is used for standardizing the experimental results to reduce the influence of sample differences; the positive control lentivirus vector contains LINC01480 gene fragment, which is used to verify the detection ability of the experimental system; the negative control lentivirus vector does not contain LINC01480 gene fragment, which is used to verify the specificity of the experimental system, and the RT-qPCR reaction system is used to extract RNA from the sample, reverse it into cDNA, and detect the expression of LINC01480 gene by qPCR quantification.

[0009] Alternatively, the specific primer pair for LINC01480 gene comprises:

[0010] Upstream primer LINC01480-F: 5'-CCACAAGGGAGTCAGAGCAG-3', complementary to the positive strand (template strand) of LINC01480 gene, for initiating cDNA synthesis and DNA chain amplification in qPCR reaction;

[0011] Downstream primer LINC01480-R: 5'-ACGCATGACAAAATCAGCCG-3', complementary to the negative strand (complementary strand of template strand) of LINC01480 gene, for completing cDNA synthesis and DNA chain amplification in qPCR reaction. In general, the primers are used to be complementary to specific sequences of LINC01480 gene, ensuring that only the target gene is specifically amplified in qPCR reaction, improving detection sensitivity and accuracy, and at the same time can be used to monitor the fluorescence signal generated during DNA synthesis, so as to realize quantitative analysis of LINC01480 gene expression level.

[0012] Optionally, the specific primer pair for the reference gene GAPDH includes:

[0013] Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', complementary to the positive strand (template strand) of GAPDH gene, for initiating cDNA synthesis and DNA chain amplification in qPCR reaction;

[0014] Downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3', complementary to the negative strand (complementary strand of template strand) of GAPDH gene, for completing cDNA synthesis and DNA chain amplification in qPCR reaction. The primers are used to be complementary to specific sequences of GAPDH gene, ensuring that only the GAPDH gene is specifically amplified in qPCR reaction, and can be used to monitor the fluorescence signal generated during DNA synthesis, so as to realize quantitative analysis of GAPDH gene expression level.

[0015] Optionally, the RT-qPCR reaction system includes the following components:

[0016] RNA extraction component, which is arranged to extract RNA from cells and extract free RNA from plasma;

[0017] Reverse transcription component, for reverse transcription of RNA into cDNA;

[0018] qPCR component, arranged to perform quantitative analysis of cDNA using a qPCR kit.

[0019] Secondly, in order to better solve the above problems, the embodiment of the present application also provides a preparation method of a kit for detecting LINC01480 gene expression, comprising the following steps:

[0020] Select a specific primer pair for LINC01480 gene and a specific primer pair for the internal reference gene GAPDH;

[0021] Prepare a negative control lentivirus vector and a positive control lentivirus vector containing a LINC01480 gene fragment;

[0022] Prepare an RT-qPCR reaction system;

[0023] Assemble the specific primer pair for LINC01480 gene, the specific primer pair for the internal reference gene GAPDH, the negative control lentivirus vector, the positive control lentivirus vector containing the LINC01480 gene fragment, and the RT-qPCR reaction system into a kit.

[0024] Alternatively, the preparation of the negative control lentivirus vector comprises using GV367 vector as a basic vector, and preparing by cloning or not cloning a non-functional LINC01480 gene fragment into the GV367 vector;

[0025] The preparation of the positive control lentivirus vector containing the LINC01480 gene fragment comprises using GV367 vector as a basic vector, and preparing by cloning the LINC01480 gene fragment into the GV367 vector.

[0026] Alternatively, the preparation of the RT-qPCR reaction system comprises:

[0027] Using SteadyPure rapid RNA extraction kit to extract total RNA in the sample;

[0028] Using lnRcute lncRNA First-Strand cDNA Kit to reverse transcribe the extracted RNA into cDNA;

[0029] Using lnRcute lncRNA fluorescent quantitative detection kit to prepare qPCR reaction system.

[0030] Alternatively, the RT-qPCR reaction system comprises:

[0031] 2xInR IncRNA PreMix, set to provide the premixed reagent required for qPCR reaction;

[0032] 50xROX Reference Dye, used for standardizing the fluorescence signal;

[0033] RNase-Free ddH2O, for preparing and or diluting reaction system.

[0034] Optionally, the total RNA in the sample is extracted by using the SteadyPure rapid RNA extraction kit also includes purifying the RNA;

[0035] Finally, in order to better achieve the purpose of the present application, the application also provides an application of a kit for detecting LINC01480 gene expression, comprising using the above-mentioned kit for monitoring MRD of MM patients after treatment.

[0036] Compared with the prior art, the embodiments of the present application have the following advantages and beneficial effects:

[0037] 1、The kit is specifically designed, which can non-invasively monitor the MRD of MM patients after treatment, reduce the pain and risk of patients, improve the accuracy and reliability of LINC01480 gene expression monitoring through the standardization of specific primers and internal reference genes, and the monitoring results can be used for assisting in the diagnosis, treatment effect evaluation and prognosis of MM, guiding clinical treatment decision, dynamically monitoring the progression and recurrence of the disease by continuously monitoring the expression change of LINC01480, and the present application has lower cost compared with other molecular biology detection methods, such as second-generation sequencing, and is more suitable for wide application in clinic.

[0038] 2、The expression level of GAPDH gene is relatively stable under different samples or conditions, and by comparing the expression level of the target gene (such as LINC01480) with the expression level of GAPDH, the experimental results can be standardized, and the influence of sample difference can be reduced. BRIEF DESCRIPTION OF DRAWINGS

[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced below, and it should be understood that the following drawings only show some embodiments of the present application, and should not be regarded as limiting the scope, and other related drawings can also be obtained by those skilled in the art without creative labor on the premise of not paying creative labor.

[0040] Figure 1 Schematic diagram for monitoring MRD of MM patients by circulating free nucleic acid LINC01480;

[0041] Figure 2 Lentiviral vector construction map, wherein Figure 2 a is a vector map, Figure 2 b is an enzyme digestion result electrophoresis map, Figure 2 c is a PCR product electrophoresis map, Figure 2 d is a CR identification result map;

[0042] Figure 3 Graph of RT-qPCR amplification curve for positive lentiviral vector;

[0043] Figure 4 Graph of standard curve for positive lentiviral vector;

[0044] Figure 5 Graph of specificity detection results of kit;

[0045] Figure 6 Graph of comparison of expression levels of LINC01480 in normal control group and newly diagnosed MM patients;

[0046] Figure 7 Graph of expression levels of LINC01480 in four multiple myeloma cell lines (RPMI-8226, MM.1S, U266, NCI-H929) compared with normal human plasma cells;

[0047] Figure 8 Graph of correlation analysis of LINC01480 expression in bone marrow plasma cells of MM patients and IL-6 expression in peripheral blood serum;

[0048] Figure 9 Graph of expression of LINC01480 in R-ISS stage I (n=6), R-ISS stage II (n=21), and R-ISS stage III (n=33) MM patients;

[0049] Figure 10 Graph of comparison of progression-free survival rates of LINC01480 high expression group (n=33) and LINC01480 low expression group (n=27);

[0050] Figure 11 Graph of correlation analysis of LINC01480 expression in bone marrow plasma cells and peripheral blood plasma of MM patients;

[0051] Figure 12 Graph of survival analysis of patients in different R-ISS stages;

[0052] Figure 13 Graph of survival analysis of patients higher than and lower than the mean value of circulating plasma free LINC01480 in R-ISS stage I patients, with the mean value as the limit;

[0053] Figure 14 Graph of survival analysis of patients higher than and lower than the mean value of circulating plasma free LINC01480 in R-ISS stage II patients, with the mean value as the limit;

[0054] Figure 15Survival analysis plot of patients with higher mean than the mean and lower mean than the mean of circulating plasma free LINC01480 in R-ISS phase III patients as the boundary;

[0055] Figure 16 Schematic diagram of the stable change of circulating plasma free LINC01480 expression of 7 patients who have reached complete remission MM during the follow-up period;

[0056] Figure 17 Schematic diagram of the significant change of circulating plasma free LINC01480 expression of the first patient who has reached complete remission MM during the follow-up period;

[0057] Figure 18 Schematic diagram of the significant change of circulating plasma free LINC01480 expression of the second patient who has reached complete remission MM during the follow-up period;

[0058] Figure 19 Schematic diagram of the significant change of circulating plasma free LINC01480 expression of the third patient who has reached complete remission MM during the follow-up period;

[0059] Figure 20 Schematic diagram of the significant change of circulating plasma free LINC01480 expression of the fourth patient who has reached complete remission MM during the follow-up period. DETAILED DESCRIPTION

[0060] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. The components of the embodiments of the present application described and shown in the drawings can be arranged and designed in various different configurations.

[0061] Therefore, the following detailed description of the embodiments of the present application provided in the drawings is not intended to limit the scope of the claimed present application, but only represents selected embodiments of the present application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present application without creative labor are within the scope of protection of the present application.

[0062] It should be noted that: similar reference numerals and letters represent similar items in the following drawings, so once an item is defined in one drawing, it does not need to be further defined and explained in subsequent drawings.

[0063] In the description of the present application, it should be noted that the terms "first", "second", "third" and the like are only used to distinguish description, and cannot be understood as indicating or implying relative importance.

[0064] Embodiment

[0065] Liquid biopsy of free nucleic acid is a non-invasive technique that can be used for diagnosis, evaluation and / or monitoring of various tumors. Among them, free long-chain non-coding RNA (LncRNA) has a stable secondary structure, and is expected to become a non-invasive monitoring indicator in plasma. Long-chain non-coding RNA LINC01480 is located at position 41535498-41536904 on chromosome 19. LINC01480 can respond to the stimulation of myeloma growth survival factor IL-6. After IL-6 stimulates myeloma cells, the expression level of LINC01480 is significantly up-regulated. LINC01480 presents very low level expression in normal plasma cells, but abnormally high expression in MM cell lines, MM patient bone marrow plasma cells and plasma. More importantly, the expression amount of LINC01480 is consistent with the current clinical prognosis stratification standard R-ISS system, that is, the worse the R-ISS staging of MM patients, the higher the expression amount of LINC01480. The progression-free survival of patients with high expression of LINC01480 is significantly lower. LINC01480 is an important indicator of early relapse and significantly decreased survival rate. The high frequency and continuous expression of LINC01480 make it a very likely effective MM prognosis and efficacy monitoring indicator, especially a new target with high sensitivity and high specificity for non-invasive detection.

[0066] The purpose of the embodiment of the present application is to find a new index and a new method for MRD detection of MM patients after treatment, that is, sensitive, specific, non-invasive, etc. At the same time, the method can not only be applied to qualitative detection of MRD of MM patients after treatment, but also can be used to quantitatively determine the tumor burden in the patient's body through the internal reference gene. The specific idea includes establishing inclusion and exclusion criteria, following up and collecting samples (bone marrow, peripheral blood) of active MM patients at different treatment stages, in-depth analysis of the correlation between circulating plasma free LINC01480 and bone marrow plasma cell LINC01480, serum IL-6 level, tumor burden, efficacy prognosis, comparison of the advantages and disadvantages of circulating plasma free LINC01480 and existing monitoring methods, and research on whether circulating plasma free LINC01480 can sensitively monitor MRD and early predict relapse at human level.

[0067] Embodiment 1

[0068] A preparation method of a kit for detecting LINC01480 gene expression is provided, comprising the following steps:

[0069] Step one: selection of specific primer pair

[0070] 1. The specific primer pair for LINC01480 gene is as follows:

[0071] Upstream primer LINC01480-F: 5'-GGAGCGAGATCCCTCCAAAAT-3';

[0072] Downstream primer LINC01480-R: 5'-GGCTGTTGTCATACTTCTCATGG-3'.

[0073] 2, Specific primer pair for internal reference gene GAPDH:

[0074] Upstream primer LINC01480-F: 5'-GGAGCGAGATCCCTCCAAAAT-3';

[0075] Downstream primer LINC01480-R: 5'-GGCTGTTGTCATACTTCTCATGG-3'.

[0076] Step two: Preparation of lentiviral vector

[0077] 1, Preparation of positive control lentiviral vector containing LINC01480 gene fragment:

[0078] Gene name: LINC01480 (NR_110724).

[0079] Species: Human.

[0080] Main reagents: as shown in Table 1 below:

[0081] Table 1

[0082] Reagent name Reagent source cat. No. 1kp DNA ladder Marker Fermentas company #SM0311 250bp DNA ladder Marker Jier company DL250+, 100T Agarose Sainsbury company GA4-100 In-Fusion TM PCR Cloning Kit clontech 639626 Taq polymerase SinoBio E001-02B dNTP Takara D4030A Primer Jier biological Restriction endonuclease NEB Plasmid extraction Kit Promega A1460 Agarose gel DNA recovery kit Tiangen biochemical DP209-03

[0083] Main instruments and materials: as shown in Table 2 below:

[0084] Table 2

[0085] Instrument name Instrument source cat. No. PCR instrument Applied Biosystems company 2720 thermal cycler Positive clone sequencing Meiji biotechnology ABI3730 type Stable voltage DNA electrophoresis instrument BioRad company Gel imaging instrument Tian Neng company Bacterial shaker Huawida experimental equipment company HI-9211K Bacterial incubator Shanghai Yiheng scientific instrument Co., LTD Gilson pipette Gilson company High speed centrifuge Hitachi company TGL-16G-A Disposable flat plate Hunan Changsha Tiandiren biological technology Co., LTD 1L flask Jintan crystal glass experimental instrument factory 1111.1115 50ml Polypropylene tube Shanghai Wu chemical Co., LTD

[0086] Vector enzyme digestion information: the vector name is GV367, the element order is Ubi-MCS-SV40-EGFP-IRES-puromycin, the cloning site is AgeI / NheI, the vector map is as shown in Figure 2 a, and the vector specification is from the website:

[0087] (http: / / www.genechem.com.cn / index / supports / tool_search.html?keywords).

[0088] Enzyme digestion results: as shown in Figure 2Marker bands from top to bottom are: 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp; 1 is the vector digestion product; 2 is the uncut vector.

[0089] Obtaining of the target gene fragment: the primers are shown in Table 3 below:

[0090] Table 3

[0091]

[0092] Primer description: containing exchange pairing base, enzyme digestion site, and containing 5' end partial sequence of the target gene for PCR fishing of the target gene.

[0093] PCR result: the PCR product size is 518 bp, and the result is shown in the electrophoretogram of Figure 2 Marker bands from top to bottom are: 5 kb, 3 kb, 2 kb, 1.5 kb, 1 Kb, 750 bp, 500 bp, 250 bp, 100 bp; the PCR product size is 512 bp.

[0094] Recombinant plasmid construction: the product is exchanged into linearized expression vector, and the PCR identification primers are shown in Table 4 below:

[0095] Table 4

[0096] ID seq LINC01480(72181-1)-p3 GGGTCAATATGTAATTTTCAGTG LINC01480(72181-1)-p4 CGTCGCCGTCCAGCTCGACCAG

[0097] PCR identification result: the positive transformant PCR product size is 1139 bp, and the negative transformant PCR product size is 661 bp, and the result is shown in the electrophoretogram of Figure 2 Marker bands from top to bottom are: 5 kb, 3 kb, 2 kb, 1.5 kb, 1 Kb, 750 bp, 500 bp, 250 bp, 100 bp; 5-12 are No. 1-8 transformants.

[0098] Positive clone sequencing result and result analysis: the alignment result is shown in Sequence 1 below:

[0099] TGGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATC

[0100] CCCGGGTACCGGTATGTTAGTGGAATTAACATATGCCCCACCCCAAGTGACTTCTAAAGG

[0101] GCTAACTCACCACAAGGGAGTCAGAGCAGATCTTGGACTGAGACCTACAGGACACAGC

[0102] GACTCTTAAATAGGTGGCTCACCAGGAGAAAGGCATAGCAGAACCTGGACTGAGACCT

[0103] ACGGGAGACAGGCAGACACACAGGAGGTTGGACGTCGAGAGGAGCACATCAGTGCAA

[0104] GAACACATGGGTGGCTGCCACTTCTCTCCCTTTCCTGAGAGGGAAAAACTCTCGACGCT

[0105] GAGAGGAATCCACCAACAGGCACCAGCACTCTGGCAGGCCACCGACCAATGGATTGAC

[0106] ATAGAGTTTGGCTGGGGCAGCCAGAGGAGAGCCTGGGCCGCTGAATAACCCGACTTCA

[0107] GGGGAAAACTATTCTCCCTTTTGGCTCCCCCATCTGCTGAGAGCTACTTCCACTCAATAA

[0108] AACCTTGCACTCATTCTCCAAGAGCTAGCCTGTGGAATGTGTGTCAGTTAGGGTGTGGA

[0109] AAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGC

[0110] AACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCAT

[0111] CTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCG

[0112] CCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCT, the alignment result is correct.

[0113] 2. Preparation of negative control lentiviral vector, which is prepared by cloning or not cloning non-functional LINC01480 gene fragments into GV367 vector.

[0114] Step three: preparation of RT-qPCR reaction system

[0115] 1. Cell RNA extraction

[0116] The SteadyPure rapid RNA extraction kit (Aikuerui Biology, AG21023) is used to extract cell RNA, which specifically includes:

[0117] Cell lysis: add 500uL Buffer QLS lysis solution to the cell precipitate, immediately mix well at high speed or repeatedly blow with a pipette gun until the homogenate is clear and not viscous, and the homogenate is placed at room temperature for 2min;

[0118] Add an equal volume of 100% ethanol to the above homogenate and mix well with a pipette gun. If there is obvious viscosity or precipitate, blow and disperse the precipitate with the pipette gun several times. (Note: If the precipitate is not dispersed, it will cause the Quick RNA Mini Column to be blocked, affecting the yield and purity)

[0119] Immediately transfer the above mixture to the Quick RNA Mini Column, centrifuge at 12,000rpm at room temperature for 2min, and discard the filtrate;

[0120] Add 700uL of Buffer QWB to the Quick RNA Mini Column, centrifuge at 12,000rpm at room temperature for 1min, and discard the filtrate. (Note: Before first use, add 35ml of 100% ethanol to Buffer QWB (Buffer QWB and anhydrous ethanol volume ratio is 3:7), mix well, and mark the bottle, and store at room temperature)

[0121] Place the Quick RNA Mini Column adsorption column on a new 2.0ml Collection Tube, centrifuge at 12,000rpm at room temperature for 2min. (Note: This step needs to be taken vertically to avoid the adsorption column head touching the collection tube wall; installation on a new 2.0ml Collection Tube is beneficial to improve RNA purity)

[0122] Put the Quick RNA Mini Column into a new RNase Free Tube, add 50uL RNase Free Water at the center of the membrane, stand at room temperature for 3min, then centrifuge at 12,000rpm for 2min to elute the RNA, detect the total RNA concentration, and store at -80℃.

[0123] 2. Plasma RNA extraction

[0124] To enrich the free RNA in the plasma, after the plasma is separated, 10% PEG8000 is added, and then the circulating plasma free RNA is extracted by QIAamp RNA Blood Mini Kit, which specifically includes:

[0125] Take 1.0mL plasma in a 15ml centrifuge tube, add 300uL RPI buffer, shake vigorously for 5s, stand at room temperature for 3min;

[0126] Add 100uL RPP buffer, shake vigorously for 20s, stand on ice for 3min, centrifuge at room temperature and 3000rmp for 10min;

[0127] Transfer the upper liquid to a new centrifuge tube, add 1 volume of ice isopropyl, mix thoroughly, then transfer to a 15mL collection column, centrifuge at room temperature and 3000rpm for 3min, discard the filtrate in the collection tube;

[0128] Add 4ml RWT buffer to the collection column, centrifuge at room temperature and 3000rpm for 3min, discard the filtrate in the collection tube;

[0129] Add 2.5mL RPE buffer to the collection column, centrifuge at room temperature and 3000rpm for 5min, replace the new collection tube;

[0130] Add 30uL of RNase-free water to the collection column, stand at room temperature for 1min, centrifuge at 3000rmp for 2min to elute the RNA;

[0131] Detect the total RNA concentration.

[0132] 3. Reverse transcription reaction

[0133] Use lnRcute lncRNA First-Strand cDNA Kit (Tiangen, KR202) to perform reverse transcription reaction, which specifically includes the following steps:

[0134] Thaw 5x gDNA Buffer, lnR-RT Primer Mix, 10x lnR RT Buffer, RNase-Free ddH2O at room temperature (15-25℃), and place on ice immediately after thawing. Vortex each solution to mix well, and centrifuge briefly to collect any liquid remaining on the tube wall before use;

[0135] Prepare the gDNA removal system mixture: RNA template 2 μL, 5x gDNA Buffer 2 μL, RNase-Free ddH2O 6 μL, and mix well. Centrifuge briefly, and incubate at 42℃ for 3 min. Then place on ice;

[0136] Prepare the reverse transcription reaction mixture: 10x lnR RT Buffer 2 μL, lnR RT Enzyme Mix 1 μL, lnR-RT Primer Mix 2 μL, RNase-Free ddH2O 5 μL. Add 10 μL of the mixture to the gDNA removal reaction, mix well, and complete the 20 μL reaction system. Incubate at 42℃ for 15 min, and then at 95℃ for 3 min. Place on ice, and obtain the cDNA for subsequent experiments or store at low temperature.

[0137] 4. qPCR reaction

[0138] Use the lnRcute lncRNA fluorescent quantitative detection kit (SYBR Green) (Tiangen, FP402) to prepare the reaction system, and perform qPCR on the fluorescent real-time quantitative PCR instrument (7500-FAST, ABI, USA). The specific steps include the following:

[0139] qPCR reaction system (20 μL): 0.5 μL of the upstream primer shown in step one, 0.5 μL of the downstream primer shown in step one, 2x InR IncRNA PreMix 10 μL, reverse transcription product 1 μL, 50x ROX Reference Dye 0.4 μL, RNase-Free ddH2O 7.6 μL;

[0140] qPCR reaction: Perform the reaction using the two-step PCR reaction program, pre-denaturation at 95℃ for 3 min, PCR reaction (40 cycles): denaturation at 95℃ for 5 sec, annealing / extension at 60℃ for 32 sec, and finally perform melting curve analysis.

[0141] Test results:

[0142] One: Sensitivity detection of the kit

[0143] One: Assembly of the kit

[0144] The kit consists of the following components: specific primer pair A for LINC01480 gene prepared in Example 1, specific primer pair B for internal reference gene GAPDH, positive control lentiviral vector and negative control lentiviral vector, RT-qPCR reaction system.

[0145] II. Sensitivity detection of the kit

[0146] 1. The positive control lentiviral vector was diluted by 10 times gradient to contain 10 6 , 10 5 , 10 4 , 10 3 , 10 2 copies of LINC01480 gene fragment, respectively.

[0147] 2. Reverse transcription reaction

[0148] The reverse transcription reaction step was the same as that in step three of Example 1.

[0149] 3. qPCR reaction

[0150] The qPCR reaction step was the same as that in step three of Example 1.

[0151] Results: The qPCR amplification curves of the positive control lentiviral vector with 10 6 , 10 5 , 10 4 , 10 3 , 10 2 copies are shown in Figure 3 , and the standard curve is shown in Figure 4 . The sensitivity of detecting LINC01480 gene fragment can reach 100 copies, indicating that the kit has high sensitivity.

[0152] II. Specificity detection of the kit

[0153] 1. Assembly of the kit

[0154] The kit consists of the following components: specific primer pair A for LINC01480 gene prepared in Example 1, specific primer pair B for internal reference gene GAPDH, positive control lentiviral vector and negative control lentiviral vector, RT-qPCR reaction system.

[0155] 2. Specificity detection

[0156] The positive control lentiviral vector, negative control lentiviral vector and bone marrow plasma cell RNA of 4 MM patients were subjected to RT-PCR, and the PCR products were subjected to agarose gel electrophoresis, which included the following steps:

[0157] Bone marrow plasma cell separation: take 2 mL bone marrow sample, anticoagulate with EDTA-K2, add 20 uL of magnetic bead coupled CD138 antibody (Miltenyi Biotec), mix well, incubate at 4°C for 15 minutes. After incubation, filter the bone marrow sample with a 70 um sterile filter. Wet the sorting column with PBS, transfer the filtered bone marrow into the sorting column, wash with PBS for 3 times, remove the sorting column, elute the adsorbed plasma cells on the sorting column with PBS. The separated plasma cells are stored at -80°C for RNA extraction.

[0158] Reverse transcription reaction: the same as the reverse transcription reaction step in step three of example 1.

[0159] PCR reaction: PCR reaction was performed using 2x Taq Master Mix (Vazyme, P111). ① PCR reaction system (20 uL): 0.8 uL of the upstream primer shown in example 1, 0.8 uL of the downstream primer shown in example 1, 10 uL of 2x Taq Master Mix, 1 uL of reverse transcription product, 7.4 uL of RNase-Free ddH2O. ② PCR reaction: pre-denaturation at 95°C for 3 min, PCR reaction (35 cycles): denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 60°C for 32 sec, complete extension at 72°C for 5 min. The PCR product was subjected to agarose gel electrophoresis.

[0160] Results: After PCR amplification, the specific primer pair prepared in example 1 for LINC01480 gene can specifically amplify LINC01480 gene (as shown in Figure 5 the agarose gel electrophoresis results of the PCR products of 4 cases of MM, positive lentiviral vector control and negative lentiviral vector control. The marker bands from top to bottom are: 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp). The negative control group has no band; the positive control group only amplifies a single concentrated band, and the size of the band is consistent with the preset size (512 bp); the 4 cases of MM patients only amplify a single concentrated band, and the size of the band is consistent with the preset size (512 bp), indicating that the kit has high specificity.

[0161] Example 2: provides an application of a kit for detecting the expression of LINC01480 gene, specifically the kit detects the expression of LINC01480 in MM, exemplarily:

[0162] I. Assembly of the kit

[0163] The kit consists of the following components: specific primer pair A for LINC01480 gene prepared in Example 1, specific primer pair B for internal reference gene GAPDH, positive control lentiviral vector and negative control lentiviral vector, RT-qPCR reaction system.

[0164] II. Detection of LINC01480 expression in MM by the kit

[0165] 1. The kit was used to detect the expression levels of LINC01480 in bone marrow plasma cells and plasma of 60 newly diagnosed MM patients and 20 healthy controls.

[0166] ① Case selection: 60 MM patients treated in the Department of Hematology of Sichuan People's Hospital from January 2021 to December 2022 were selected as the research group, including 35 males and 25 females; the median age was 66 years [(46-88) years]; among them, 6 cases were in R-ISS I stage, 21 cases were in R-ISS II stage, and 33 cases were in R-ISS III stage. Inclusion criteria: those who met the diagnostic criteria of MM in the International Myeloma Working Group (IMWG); age >= 18 years; diagnosed as MM by bone marrow smear or bone marrow biopsy; patients signed informed consent. Exclusion criteria: other blood system plasma cell tumors (including plasma cell leukemia, monoclonal gammopathy, POMES syndrome, systemic amyloidosis, etc.); reactive plasma cell proliferation; non-first diagnosis and relapsed refractory MM patients; lack of complete data for previous treatment in other hospitals. Another 20 healthy bone marrow donors in our hospital were selected as the control group, including 10 males and 10 females; the median age was 37 years [(21-56) years].

[0167] ② Research method: staging and prognosis stratification according to R-ISS. Newly diagnosed patients were sampled at the time of initial diagnosis, and patients after chemotherapy or transplantation were sampled according to the review cycle. Termination criteria: patients who require not to participate in the study. Patients were followed up for 24 months by telephone follow-up and outpatient review, once a month, and the survival of MM patients was recorded. The survival period of the patient started from the date of diagnosis, and the follow-up ended in December 2024.

[0168] Progression-free survival (PFS) and complete response (CR) are used as tumor efficacy standards and are commonly used to judge the prognosis of malignant tumors. PFS refers to the time between the start of treatment for tumor patients and the observation of disease progression or death due to any reason. Complete remission of MM: serum and urine immunofixation electrophoresis negative, soft tissue plasmacytoma disappeared, and bone marrow plasma cells <5%; for patients who rely only on serum FLC levels as measurable lesions.

[0169] ③Sample collection:

[0170] Plasma: Collect fasting peripheral blood from MM patients and healthy donors into EDTA-K2 anticoagulant tubes. Centrifuge at 3000 rpm for 5 min, and then take 1.5 mL of the supernatant plasma. Store the isolated plasma at -80℃, for circulating nucleic acid extraction and IL-6 level determination.

[0171] Bone marrow: Take 2 mL bone marrow sample, and add 20 uL of magnetic bead coupled CD138 antibody (Miltenyi Biotec) for anticoagulation. Mix well, and incubate at 4℃ for 15 min. After incubation, filter the bone marrow sample using a 70 um sterile filter membrane. Wet the sorting column with PBS, and transfer the filtered bone marrow into the sorting column. Wash the sorting column with PBS for 3 times, and then take out the sorting column. Elute the adsorbed plasma cells from the sorting column with PBS. Store the isolated plasma cells at -80℃, for RNA extraction.

[0172] ④Sample detection:

[0173] Serum IL-6 level determination: Use AuthentiKine TM Human IL-6 ELISA Kit (Proteintech) to detect human serum IL-6 level according to the instructions. Add the corresponding standard and sample to be tested into each well of the enzyme-labeled plate, and then incubate at 37℃ for 1 h after adding enzyme conjugate. Wash the plate for 3 times, and then add color developing agent. Develop color at 37℃ for 15 min in the dark, and then add stop solution. Detect OD450 value within 10 min after reaction termination using an enzyme-labeled instrument.

[0174] Bone marrow plasma cell RNA extraction: The same as the cell RNA extraction step in step three of Example 1.

[0175] Plasma RNA extraction: The same as the plasma RNA extraction step in step three of Example 1.

[0176] Reverse transcription reaction: The same as the reverse transcription reaction step in step three of Example 1.

[0177] qPCR reaction: The same as the qPCR reaction step in step three of Example 1.

[0178] Set positive control (use an equal volume of 10-fold gradient diluted positive control lentivirus vector instead of sample), negative control (use an equal volume of negative control lentivirus vector instead of sample), and no template blank control (use an equal volume of H 2 O instead of sample) for each batch of RT-qPCR experiment. Each sample is repeated for 3 times. The relative expression of LINC01480 in bone marrow plasma cells and plasma is calculated using 2 -△△Ct method.

[0179] 2. The expression level of LINC01480 in four multiple myeloma cell lines (RPMI-8226, MM.1S, U266, NCI-H929) was detected by using the kit.

[0180] RNA extraction: the cell RNA extraction procedure in step three of Example 1.

[0181] Reverse transcription reaction: the plasma RNA extraction procedure in step three of Example 1.

[0182] qPCR reaction: the qPCR reaction procedure in step three of Example 1.

[0183] The results showed that the expression level of LINC01480 in bone marrow plasma cells of 60 MM patients was 34.41 ± 10.03 times that of the normal control group (P = 0.0010, as shown in Figure 6 LINC01480 was significantly highly expressed in RPMI-8226, MM.1S, U266, NCI-H929 cells compared with the normal control group of plasma cells (P < 0.0001, as shown in Figure 7 At the same time, the expression level of LINC01480 in bone marrow plasma cells of MM patients was positively correlated with serum IL-6 level (R 2 = 0.8187, P < 0.0001, as shown in Figure 8 The worse the R-ISS stage of MM patients was, the higher the expression level of LINC01480 in bone marrow plasma cells was (P < 0.0001, as shown in Figure 9 The Kaplan Meier analysis was used to evaluate the relationship between LINC01480 and the prognosis of MM patients, and the results showed that the higher the expression level of LINC01480 was, the shorter the progression-free survival (PSF) of MM patients was (P = 0.0074, as shown in Figure 10 The progression-free survival rate of the high expression group of LINC01480 (n = 33) and the low expression group of LINC01480 (n = 27), Log-rank (Mantel-Cox) test). At the time of initial diagnosis, the expression level of circulating plasma free LINC01480 was strongly positively correlated with the expression level of LINC01480 in bone marrow plasma cells (R 2 = 0.9518, P < 0.0001, as shown in Figure 11The above results show that the expression level of LINC01480 is related to the clinical stage, the worse the R-ISS stage of the MM patient is, the higher the expression level of LINC01480 is, which shows that LINC01480 is related to the poor prognosis of the MM patient. In addition, the level of LINC01480 in bone marrow plasma cells is positively correlated with the serum IL-6 level of the MM patient, and the circulating plasma free LINC01480 is correlated with the level of LINC01480 in bone marrow plasma cells, which shows that LINC01480 can reflect the tumor burden of the MM patient, and the circulating plasma free LINC01480 is a potential new target for MM liquid biopsy.

[0184] Example 3: The application of a kit for detecting the expression of the LINC01480 gene is provided, specifically the application of the kit for detecting circulating plasma free LINC01480 in different R-ISS stages, exemplarily:

[0185] I. Assembly of the kit

[0186] The kit consists of the following components: the specific primer pair for the LINC01480 gene prepared in Example 1, the specific primer pair for the internal reference gene GAPDH, the positive control lentivirus vector and the negative control lentivirus vector, and the RT-qPCR reaction system.

[0187] II. Application of circulating plasma free LINC01480 in different R-ISS stages: same as step two of Example 2.

[0188] The results show that the progression-free survival (PFS) of the 60 MM patients in different R-ISS stages is different. The PFS of the R-ISS I stage patients is (21.77±1.23) months; the PFS of the R-ISS II stage patients is (15.32±1.81) months; and the PFS of the R-ISS III stage patients is only (6.53±1.52) months, and the PFS of the R-ISS III stage patients is the worst (as shown in Figure 12 Further analysis of the difference in the expression level of circulating plasma free LINC01480 within each R-ISS group. Within the same R-ISS group, the expression level of circulating plasma free LINC01480 is different, and the PFS of the patients higher than the mean and lower than the mean is different. The mean of circulating plasma free LINC01480 in the I stage patients is 3.45, and the PFS of the patients higher than the mean in the same group is worse (X 2 =5.49, P=0.019, as shown in Figure 13 The mean of circulating plasma free LINC01480 in the II stage patients is 5.04, and the PFS of the patients higher than the mean in the same group is worse (X 2 =15.96, P=0.00006451, as shown inFigure 14 In the stage III patients, the average of circulating plasma free LINC01480 was 6.45, and the patients with higher average had worse PFS (X 2 = 0.021, P = 0.88, as shown in the table. Figure 15 The above indicates that LINC01480 can be used as an index for judging the prognosis of MM.

[0189] Example 4: Application of a kit for detecting LINC01480 gene expression, specifically, application of the kit in monitoring MRD after complete remission, exemplarily:

[0190] I. Assembly of the kit

[0191] The kit consists of the following components: specific primer pair a for LINC01480 gene prepared in Example 1, specific primer pair b for internal reference gene GAPDH, positive control lentivirus vector and negative control lentivirus vector, and RT-qPCR reaction system.

[0192] II. Application of circulating plasma free LINC01480 in monitoring MRD after complete remission: see Figure 1 , same as step two of Example 2.

[0193] The results show that after induction chemotherapy, 11 out of 60 MM patients achieved complete remission. Among them, 7 MM patients were detected by MFC to be MRD negative, and their circulating plasma free LINC01480 remained at a low level during the follow-up period (as shown in Figure 16 ). While the other 4 patients who have achieved complete remission have gradually increased expression of circulating LINC01480 during the follow-up period. When MFC is negative, the expression of LINC01480 gradually increases, and at a certain stage, there is a significant increase, and the inflection point of the trend change is 4 to 8 weeks earlier than MFC (as shown in Figure 17-20 respectively). This indicates that LINC01480 can detect the recurrence of MM patients in advance and sensitively.

[0194] III. Technical effects: The example of the present application develops circulating plasma free LINC01480 as a new index for monitoring MRD of MM patients after treatment, and creates a non-invasive, high-sensitivity and high-specificity MM MRD detection kit.

[0195] Overall, the kit prepared in Example 1 of the present application can be applied as follows:

[0196] ①The worse the R-ISS stage of MM patients is, the higher the expression of LINC01480 is, and LINC01480 indicates poor prognosis of MM patients. ②The level of LINC01480 in bone marrow plasma cells is positively correlated with the serum IL-6 level of MM patients, the level of circulating plasma free LINC01480 is correlated with the level of LINC01480 in bone marrow plasma cells, and LINC01480 can reflect the tumor burden of MM patients. ③The median progression-free survival of MM patients with high expression of LINC01480 is shorter. ④Compared with traditional MFC detection of MRD, the kit can more early and sensitive monitor the disease recurrence of MM patients, accurately evaluate the prognosis of MM patients, and help to quickly identify high-risk MM patients.

[0197] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application. It should be noted that the structures or components illustrated in the drawings are not necessarily drawn to scale, and the present application omits the description of well-known components and processing techniques and processes to avoid unnecessary limitation of the present application.

Claims

1. The application of a kit for detecting LINC01480 gene expression in the preparation of a product for monitoring minimal residual disease in patients with multiple myeloma after treatment, characterized in that, The kit includes specific primer pairs for the LINC01480 gene, specific primer pairs for the internal reference gene GAPDH, a positive control lentiviral vector containing the LINC01480 gene fragment, a negative control lentiviral vector, and an RT-qPCR reaction system. The specific primer pair targeting the LINC01480 gene includes: Upstream primer LINC01480-F: 5'-CCACAAGGGAGTCAGAGCAG-3'; Downstream primer LINC01480-R: 5'-ACGCATGACAAAATCAGCCG-3'.

2. The application of the kit for detecting LINC01480 gene expression according to claim 1 in the preparation of a product for monitoring minimal residual disease in patients with multiple myeloma after treatment, characterized in that, The specific primer pairs targeting the internal reference gene GAPDH include: Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3'; Downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3'.

3. The application of the kit for detecting LINC01480 gene expression according to claim 2 in the preparation of a product for monitoring minimal residual disease in patients with multiple myeloma after treatment, characterized in that... The RT-qPCR reaction system comprises the following components: RNA extraction components, wherein the RNA extraction components are configured to extract RNA from cells and extract free RNA from plasma; Reverse transcription component, used to reverse transcribe RNA into cDNA; The qPCR component was set up to perform qPCR quantitative analysis of cDNA using a qPCR kit.

4. The application of the kit for detecting LINC01480 gene expression according to claim 1 in the preparation of a product for monitoring minimal residual disease in patients with multiple myeloma after treatment, characterized in that, The preparation method of the kit includes the following steps: Specific primer pairs for the LINC01480 gene and specific primer pairs for the internal reference gene GAPDH were selected. Prepare negative control lentiviral vectors and positive control lentiviral vectors containing the LINC01480 gene fragment; Preparation of RT-qPCR reaction system; The kit was assembled from the specific primer pair for the LINC01480 gene, the specific primer pair for the internal reference gene GAPDH, the negative control lentiviral vector, the positive control lentiviral vector containing the LINC01480 gene fragment, and the RT-qPCR reaction system.

5. The application of the kit for detecting LINC01480 gene expression according to claim 4 in the preparation of a product for monitoring minimal residual disease in patients with multiple myeloma after treatment, characterized in that... The preparation of the negative control lentiviral vector involves using the GV367 vector as the base vector and preparing it by inserting a non-cloned or cloned non-functional LINC01480 gene fragment into the GV367 vector. The preparation of the positive control lentiviral vector containing the LINC01480 gene fragment involves using the GV367 vector as the base vector and cloning the LINC01480 gene fragment into the GV367 vector.

Citation Information

Patent Citations

  • A hepatitis C virus one-step-method genotype RT-PCR detection kit

    CN104745720A

  • Molecular marker for clinical prognosis of pancreatic cancer and application thereof

    CN106755344A