Scylla paramamosain carapace length related SNP (Single Nucleotide Polymorphism) molecular marker, detection primer pair, kit and application

Abstract

The invention discloses a scylla paramamosain carapace length related SNP (Single Nucleotide Polymorphism) molecular marker, a detection primer pair, a kit and application. According to the SNP molecular marker, the 179th basic group from the 5'end of a nucleotide sequence shown in SEQ ID NO: 1 is G or T. The SNP molecular marker can predict the carapace length character of an individual in the early breeding stage, and is used for molecular marker-assisted selective breeding, improving the breeding efficiency and accuracy of scylla paramamosain, shortening the breeding period, reducing the breeding cost and improving the economic benefit.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and relates to a SNP molecular marker related to carapace length of mud crab, a detection primer pair, a kit and uses. Background Art

[0002] As an important product of aquaculture in my country, Scylla paramamosain has become the main species of farmed blue crab in the southeast coastal areas due to its high economic value and fast growth rate. In recent years, with the continuous improvement of people's living standards, people have a deeper understanding of the deliciousness and nutrition of Scylla paramamosain. The scale of Scylla paramamosain farming has gradually expanded, and consumers have also put forward higher requirements for the quality and traits of blue crabs, often hoping that the blue crabs have larger and better body shapes. Among the many biological characteristics of Scylla paramamosain, carapace length, as an important morphological indicator, is not only directly related to the body shape and appearance of Scylla paramamosain, but also proportional to body weight. Therefore, it has important application value in the improvement of blue crab varieties and the selection of high-quality seedlings.

[0003] In traditional breeding, phenotypic data can often only be obtained after the individual reaches adulthood, making it difficult to evaluate and select the individual's phenotype at an early stage. However, with the development of high-throughput sequencing technology, genome-wide association study (GWAS) based on whole-genome genetic variation has been effective in the genetic analysis of complex traits. The genetic analysis and genetic improvement methods of important economic traits of farmed animals have also gradually evolved from the traditional breeding method based on phenotypic selection to the breeding method using molecular markers for marker-assisted selection. By performing high-throughput sequencing on the target population, developing genome-wide molecular markers, and combining phenotypic trait data for genome-wide association analysis, the collected traits can be efficiently located and analyzed. This method is increasingly being used in genetic breeding and trait improvement of economic species.

[0004] Among many molecular marker technologies, single nucleotide polymorphism (SNP) marker technology has become the first choice for molecular marker-assisted breeding due to its high abundance, automated detection, low cost and rapidity. Using resequencing technology to obtain SNP variation information on the mud crab genome, combined with whole genome association analysis, it is expected to directly identify the quantitative trait locus (QTL) and key mutation sites that affect the carapace length of the mud crab. At present, there are no public reports at home and abroad showing that GWAS analysis using whole genome resequencing technology has successfully identified SNP markers directly related to the carapace length trait of the mud crab. Therefore, using the above technology to analyze the genetic mechanism of the carapace length of the mud crab, applying molecular markers with positive effects to the genomic selection of the mud crab, and establishing efficient and accurate genetic breeding technology will greatly accelerate the genetic progress of the carapace length trait of the mud crab, thereby improving the economic benefits of the mud crab aquaculture industry. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the deficiencies and shortcomings of the prior art and provide a SNP molecular marker located on chromosome 4 of the mud crab and associated with carapace length.

[0006] To achieve the above object, the present invention provides a SNP molecular marker related to carapace length of mud crab, characterized in that the SNP marker is a nucleotide sequence shown in SEQ ID NO: 1, and the 179th base from the 5' end is G or T. That is, the 31207983rd (31207983bp) nucleotide position on chromosome 4 of the mud crab reference genome (National Center for Biotechnology Information retrieval number: GCA_035594125.1) is G>T mutation;

[0007] Furthermore, the carapace length of individuals with the TT genotype and GT genotype of the SNP molecular marker is significantly longer than that of individuals with the GG genotype.

[0008] Furthermore, the mud crab includes mud crab and its hybrid varieties or strains.

[0009] The present invention also provides a primer pair for detecting the SNP molecular marker, characterized in that the primer pair has a nucleotide sequence shown in SEQ ID NO: 2-3.

[0010] The present invention also provides a kit for detecting the SNP molecular marker, characterized in that it comprises the primer pair.

[0011] The SNP molecular marker, the primer pair or the kit are used in the breeding of mud crabs and their hybrid varieties or strains.

[0012] The present invention also provides a method for detecting the carapace length trait of the mud crab, characterized in that the carapace length trait of the mud crab is determined by detecting the SNP marker on the mud crab to be tested; preferably, the mud crab includes the mud crab and its hybrid varieties or strains.

[0013] Furthermore, the carapace length trait of the mud crab to be tested is determined by detecting the SNP marker on the mud crab to be tested, including: extracting the genomic DNA of the mud crab to be tested; using the primer pair to perform PCR amplification on the genomic DNA of the mud crab to be tested to obtain a PCR amplification product; sequencing the PCR amplification product to obtain a sequencing result; determining the genotype of the SNP marker of the mud crab to be tested based on the sequencing result; and determining the carapace length trait of the mud crab to be tested based on the genotype of the SNP molecular marker of the mud crab to be tested.

[0014] Furthermore, the carapace length of individuals with the TT genotype and GT genotype of the SNP molecular marker is significantly longer than that of individuals with the GG genotype.

[0015] The present invention also provides a genetic improvement method for mud crabs, characterized in that the method comprises: selecting parent mud crab individuals whose genotypes of the SNP molecular marker are TT and GT genotypes in the parent mud crab population, and eliminating parent mud crab individuals whose genotypes of the SNP molecular marker are GG genotypes, so as to increase the frequency of the allele T at the site generation by generation, thereby improving the carapace length trait of offspring mud crabs, and the SNP molecular marker is a nucleotide sequence shown in SEQ ID NO: 1, and the 179th base from the 5' end is G or T.

[0016] The mud crab described in the present invention includes mud crab and its hybrid varieties or strains.

[0017] The present invention obtains a SNP site significantly associated with the carapace length trait of the mud crab through whole genome association analysis. The SNP can be used as a genetic marker and applied to marker-assisted selection, thereby accelerating the genetic improvement process of the carapace length trait of the mud crab. The present invention verifies the relationship between different SNP allele types and the carapace length phenotype of the mud crab, confirms the effect of the SNP marker on the carapace length, and provides a theoretical basis for the breeding application of the SNP marker. Among them, the present invention confirms that the carapace length of individuals with TT and GT genotypes is significantly higher than that of individuals with GG genotype. The present invention designs a pair of primers that can be used to detect and identify different allele types of the SNP site. The application of the primer pair provides convenience for SNP typing.

[0018] The present invention provides a variety of breeding methods and application schemes based on the SNP marker, including using the SNP to perform genotyping screening on the population, retaining individuals with excellent genotypes for seed preservation, and performing continuous seed selection and matching aimed at increasing the frequency of the target allele. This provides an operational scheme for breeding the carapace length trait using the SNP marker. The application of the SNP marker can enable the carapace length trait to obtain a controllable genetic improvement direction, which is conducive to the rapid breeding of new strains of excellent blue crabs with long carapaces. This will directly increase the commodity value of a single blue crab, which is of great significance for expanding the breeding scale of the mud crab and increasing economic output. The application of the SNP marker will also promote the development of technologies related to molecular breeding and genetic improvement of the mud crab, which is conducive to promoting the standardization and large-scale breeding of the mud crab, and improving the overall benefits and competitiveness of my country's coastal fisheries. The SNP marker of the present invention and its breeding application can provide genetic analysis strategies and technical references for molecular breeding of other economic traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the Manhattan plot of the genome-wide association analysis on chromosome 4 of the mud crab about the carapace length trait; wherein: the horizontal axis represents the chromosome number of the mud crab; the vertical axis represents the -log10 (P) value. DETAILED DESCRIPTION

[0020] Embodiments of the present invention are described in detail below, and the examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals represent the same or similar elements or elements with the same or similar functions from beginning to end. The embodiments described below by reference to the accompanying drawings are exemplary, are intended to be used to explain the present invention, and are not to be construed as limitations of the present invention. Those who do not indicate specific techniques or conditions in the embodiments are carried out according to the techniques or conditions described in the documents in this area or according to the product specification. Those who do not indicate the manufacturer of reagents or instruments used are all conventional products that can be obtained commercially.

[0021] Example 1: Determination of SNP molecular markers associated with carapace length trait

[0022] (1) Experimental animals: The mud crab population was 367 mud crabs from a cultured population in Fuzhou, Fujian. The carapace length phenotypic data of each individual was recorded.

[0023] (2) DNA extraction: Genomic DNA was extracted from the muscle tissue of each individual. The Takara genomic extraction kit was used to extract genomic DNA from the samples of the group. The specific operation method was referred to the instruction manual. The DNA quality and concentration were detected by a spectrophotometer, and the DNA samples were stored at -80°C for future use.

[0024] (3) Whole genome resequencing of mud crab:

[0025] DNA samples were sent to Beijing Novogene Technology Co., Ltd., and the whole genome of the blue crab was sequenced at 9× depth using the paired-end sequencing method on the Illumina platform according to the company's standard process. The sequencing data was aligned by BWA software, and the GATK software was used to mine high-density SNP markers and short fragment insertion / deletion mutations (Indels) of the whole genome, and the number of SNPs obtained was 45,874,945. The above-obtained SNPs were quality controlled using plink, with the conditions of --mind 0.1--geno 0.1--maf 0.05--hwe 0.000001, and the number of SNPs obtained after quality control was 2,051,575.

[0026] (4) Genome-wide association (GWAS) analysis: In order to eliminate the population stratification effect, the present invention uses the linear mixed model single-point regression analysis of the GCTA software to perform GWAS analysis on the above-mentioned quality-controlled data. The Bonferroni method is used to determine the significance threshold of the degree of association between SNP and carapace length traits. The genome-level significance threshold is 0.05 divided by the number of effective SNP sites (the number of SNPs after filtering by the plink software indep-pairwise 50 10 0.2 parameters), that is, the genome-level significance threshold is 5.58e-8, that is, 0.05 / 896055 (effective number of SNPs); the chromosome-level significance threshold is 1 divided by the number of effective SNP sites, that is, the chromosome-level significance threshold is 1.12e-6, that is, 1 / 896055 (effective number of SNPs). The GWAS analysis results are as follows. Figure 1 As shown, there is a site on chromosome 4 of blue crab that significantly affects the carapace length. The strongest associated SNP is the G>T mutation at position 31207983 on chromosome 4, with a P value of 4.81e-08.

[0027] (5) Correlation analysis between different genotypes and carapace length traits: According to Table 1 and Figure 1 It can be seen that the SNP site 31207983 G>T of the molecular marker is extremely significantly correlated with the carapace length trait (P<0.001), indicating that this molecular marker significantly affects the carapace length trait of the mud crab. Therefore, through auxiliary selection of the SNP site 31207983 G>T of the mud crab, the carapace length of this group can be gradually improved, thereby accelerating the breeding process.

[0028] In addition, according to Table 1, the carapace length of TT and GT types is longer than that of GG type, indicating that TT and GT are beneficial to carapace length. Eliminating GG genotype mud crabs can bring more economic benefits. In the process of breeding, we need to eliminate GG type mud crabs for breeding, so as to increase the proportion of TT and GT type individuals in the population generation by generation.

[0029] Table 1 Correlation between molecular marker SNP site g.31207983G>T and carapace length

[0030]

[0031] Example 2: Amplification and sequencing of target DNA sequences

[0032] (1) Design the primer DNA sequence as follows:

[0033] P001-F:5'-GAGGCGGCTTGGCAGAGAAATG-3'SEQ ID NO:2;

[0034] P002-R:5'-GGTCGTTAAGGAATCATGGAGGGAAG-3'SEQ ID NO:3.

[0035] (2) PCR amplification

[0036] 2 μL of DNA template was added to the 25 μL reaction system. The DNA template came from 16.5 μL of double distilled water, 2 μL of dNTP, 2.5 μL of 10×Extaq, 0.1 μL of Extaq, and 1 μL each of primers P001-F and P002-R.

[0037] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 10 min.

[0038] (3) DNA sequence determination

[0039] DNA sequence identification: It was carried out at Sangon Biotech (Shanghai) Co., Ltd., and the gene fragment was tested for a single positive reaction. The measured sequence was compared with the genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0040] GAGGCGGCTTGGCAGAGAAATG ACTCCAGTGCGAGGCAGCGACAGGCGGTGAGAAGCTTCTGCCCCAGACTCTCGACGACAGCTCTGAAGCCTCATCTTGATTACCGAGGCATATGAATTAAGACAGACACACAAGACAGAGTTAACATGAACAATTCAATCTCACTGTCAAGCTGGAK(G>T)GTTCATTTAAGCAATAGACACAAACGAATGCTACGCTGTATATTTTC ATCTCTTTCATT CTTCCCTCCATGATTCCTTAACGACC SEQ ID NO:1.

[0041] Note: The K marked in the sequence table is the mutation site, which is displayed in bold font (the mutated base in brackets is the allele mutation), and the double underline at the beginning and end of the sequence indicates the position of the designed primer sequence.

[0042] Example 3: Analysis of the effect of molecular marker SNP site g.31207983G>T

[0043] According to Table 1, the dominant allele TT type of SNP site g.31207983 can increase the carapace length by 7.56 mm compared with the inferior allele GG type. Therefore, by molecular marker-assisted selection or genomic selection, the TT type of blue crabs in the population are gradually selected and retained, which can significantly increase the frequency of the dominant allele T allele, thereby increasing the carapace length trait of blue crabs, accelerating the genetic improvement process of blue crabs, and ultimately effectively improving the economic benefits of blue crab breeding.

[0044] Example 4: Farming Group Verification

[0045] Using the above primer pair P001-F and P002-R, 49 mud crabs (six months old) from Fuzhou, Fujian were cultured for molecular markers. The SNP site g.31207983G>T was determined. 6 cases were GG, 21 cases were GT, and 22 cases were TT. The carapace length of TT and GT individuals was 11.80mm and 4.09mm longer than that of GG individuals, respectively, and the results were consistent with the actual results.

[0046] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A SNP molecular marker associated with carapace length in Scylla pseudoburrowing, characterized in that: The SNP molecular marker is a nucleotide sequence shown in SEQ ID NO: 1, wherein the 179th base from the 5' end is G or T.

2. The SNP marker according to claim 1, characterized in that The carapace length of individuals with the TT genotype and GT genotype of the SNP molecular marker is significantly longer than that of individuals with the GG genotype.

3. The SNP molecular marker according to claim 1 or 2, characterized in that: The mud crab includes mud crab and its hybrid varieties or strains.

4. A primer pair for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that: The primer pair has the nucleotide sequence shown in SEQ ID NO: 2-3.

5. A kit for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that: Comprising the primer pair described in claim 4.

6. Use of the SNP molecular marker according to any one of claims 1 to 3, the primer pair according to claim 4 or the kit according to claim 5 in the breeding of mud crabs and their hybrid varieties or strains.

7. A method for detecting the carapace length of a mud crab, characterized in that: The carapace length trait of the mud crab to be tested is determined by detecting the SNP molecular marker of any one of claims 1 to 3; preferably, the mud crab includes the mud crab and its hybrid varieties or strains.

8. The method according to claim 7, characterized in that: include: Extracting genomic DNA of the tested mud crab; Using the primer pair described in claim 4, the extracted genomic DNA is subjected to PCR amplification to obtain a PCR amplification product; Sequencing the PCR amplification product to obtain a sequencing result; Based on the sequencing results, the genotype of the SNP molecular marker of the mud crab to be tested is determined; and based on the genotype of the SNP molecular marker of the mud crab to be tested, the carapace length trait of the mud crab to be tested is determined.

9. The method according to claim 7, characterized in that: The carapace length of individuals with the TT genotype and GT genotype of the SNP molecular marker is significantly longer than that of individuals with the GG genotype.

10. A method for genetic improvement of mud crab, characterized in that: The method comprises: selecting parent mud crab individuals whose genotypes of the SNP molecular marker are TT and GT genotypes in the parent mud crab population, and eliminating parent mud crab individuals whose genotypes of the SNP molecular marker are GG genotypes, so as to increase the frequency of the allele T at the site generation by generation, thereby improving the carapace length trait of the offspring mud crabs, wherein the SNP molecular marker is a nucleotide sequence shown in SEQ ID NO: 1, and the 179th base from the 5' end is G or T.

Images