Schizochytrium limacinum and application thereof as well as method and product for producing omega-3 polyunsaturated fatty acid

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to schizochytrium limacinum and application thereof as well as a method and a product for producing omega-3 polyunsaturated fatty acid. The schizochytrium sp. SKA-2 is preserved in the China Center for Type Culture Collection on October 23, 2024, and the preservation number of the schizochytrium sp. SKA-2 is CCTCC (China Center for Type Culture Collection) NO: M 20242314. The Schizochytrium sp. SKA-2 can grow well under the low-salt condition, and when the Schizochytrium sp. SKA-2 is used for fermentation to obtain the omega-3 polyunsaturated fatty acid, the production speed is high, the fermentation time is short, and the content of the omega-3 polyunsaturated fatty acid is high.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganism preparation, in particular to schizochytrium and application thereof, as well as a method and product for producing ω-3 polyunsaturated fatty acids. Background Art

[0002] Long Chain Polyunsaturated Fatty Acids (LC-PUFA) are a class of straight-chain fatty acids with two or more double bonds and a carbon chain length of 18-22 carbon atoms. This type of fatty acid plays an important role in human health, especially in the development of the brain and nervous system and optic nerves of infants and young children. LC-PUFA is mainly divided into two categories: omega-3 and omega-6. Among them, the omega-3 series mainly includes α-linolenic acid, DHA (docosahexaenoic acid) and EPA (eicosapentaenoic acid), which are usually found in fish and seafood, such as fatty fish oil, squid, krill oil, egg oil and seaweed. The omega-6 series mainly includes linoleic acid and arachidonic acid, which are distributed in a variety of vegetable oils and foods.

[0003] Docosahexaenoic acid (DHA), as a key omega-3 long-chain polyunsaturated fatty acid, has shown excellent physiological effects in promoting the healthy development of infant brain cells, regulating blood lipid levels, maintaining healthy vision, showing anti-cancer potential, and enhancing the body's immune function. Therefore, it has been widely and deeply used in the infant food and pharmaceutical industries, becoming one of the indispensable nutrients for promoting health.

[0004] Eicosapentaenoic acid (EPA) is an omega-3 long-chain polyunsaturated fatty acid that is extremely important to the human body. It has important physiological functions in preventing and treating cardiovascular diseases, assisting in the management of schizophrenia and depression, and playing anti-inflammatory and anti-cancer roles. At present, EPA is gradually expanding its commercial application areas in many industries such as health foods, pharmaceutical preparations, and animal feed, and has shown extremely broad market prospects and potential. The traditional source of EPA is fish oil. However, with the increasing depletion of marine resources and the intensification of environmental pollution problems, the quality and output of fish oil have been seriously affected, making it difficult to meet the growing demand for EPA in the market. Therefore, exploring and developing a sustainable and environmentally friendly EPA production route has become a key issue that needs to be urgently addressed in the current scientific research and industry. This is not only related to ensuring the nutritional supply required for human health, but also an inevitable requirement for maintaining ecological balance and sustainable development.

[0005] Schizochytrium sp. is a heterotrophic marine fungus belonging to the Chromophyta kingdom, Heterokonta phylum, Thraustochytriales order, Thraustochytriaceae family, and Schizochytrium genus. Schizochytrium has a strong characteristic of accumulating polyunsaturated fatty acids, and the unsaturated fatty acid composition is concentrated, containing a large amount of DHA (40-60%). EPA is also present in its fatty acids, although the percentage of EPA in its total fatty acids is usually no more than 1%. This unique fatty acid composition makes Schizochytrium a potential candidate for research and development of DHA and other polyunsaturated fatty acid sources.

[0006] In the traditional culture process of Schizochytrium, in order to simulate the seawater environment, a large amount of artificial sea salt needs to be added to the culture medium. The use of high-concentration salt not only increases the cost of fermentation raw materials, but also increases the difficulty and cost of wastewater treatment in the later stage. In addition, the presence of high-concentration salt in the fermentation liquid will cause chloride ions to corrode the tank, thereby accelerating the loss of fermentation equipment, increasing the depreciation rate of the equipment, and increasing the fermentation cost.

[0007] Therefore, a new low-salinity Schizochytrium that can stably supply specific fatty acids at high levels has great industrial value, and therefore, it is necessary to develop such Schizochytrium. Summary of the invention

[0008] The purpose of the present invention is to provide a Schizochytrium that can produce DHA and EPA in view of the shortcomings of the current existing technology. The strain can grow well under low-salt conditions. When the strain is used for fermentation to obtain ω-3 polyunsaturated fatty acids, the production speed is fast, the fermentation time is short, and the ω-3 polyunsaturated fatty acid content is high.

[0009] In order to achieve the above invention object, the technical solution of the present invention is as follows: A strain of Schizochytrium sp. SK-1 was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO:M 20242313. The depository address is Wuhan University, Wuhan, China.

[0010] Furthermore, the nucleotide sequence of Schizochytrium sp. SK-1 is shown in SEQ ID NO:1.

[0011] A strain of Schizochytrium sp. SKA-2 was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO:M 20242314. The depository address is Wuhan University, Wuhan, China.

[0012] The present invention protects Schizochytrium sp. SKA-2 to produce high levels of EPA and DHA under low-salt conditions (fermentation broth), and the EPA and DHA produced by the strain are 266.67% and 73.81% higher than those of the wild-type strain. When the screened Schizochytrium sp. strain is used for high-density fermentation to produce EPA and DHA, the EPA and DHA yields are 5.25% and 43.35%, respectively.

[0013] The present invention also protects an isolated microorganism, an isolated microorganism containing the polynucleotide sequence of SEQ ID NO: 1 or an 18S rDNA containing a polynucleotide sequence having at least 94% identity with SEQ ID NO: 1.

[0014] The present invention also protects a Schizochytrium biomass, which comprises the Schizochytrium SK-1, Schizochytrium SKA-2, isolated microorganisms or mixtures thereof described in 1 above. Further, the isolated Schizochytrium biomass, wherein at least about 18% of the dry cells of the biomass by weight are fatty acids, and wherein at least about 20% of the fatty acids are ω-3 fatty acids.

[0015] Furthermore, in the isolated biomass, at least 20% by weight of the fatty acids are docosahexaenoic acid and less than 10% by weight of eicosapentaenoic acid.

[0016] The present invention also protects the use of the Schizochytrium sp. SK-1, Schizochytrium sp. SKA-2 or an isolated microorganism containing a polynucleotide sequence of SEQ ID NO: 1 or an 18S rDNA containing a polynucleotide sequence having at least 94% identity with SEQ ID NO: 1 in the preparation of ω-3 polyunsaturated fatty acids.

[0017] The total fatty acids in the material produced by Schizochytrium sp. SK-1, Schizochytrium sp. SKA-2, or an isolated microorganism comprising a polynucleotide sequence of SEQ ID NO: 1, or an 18S rDNA comprising a polynucleotide sequence having at least 94% identity to SEQ ID NO: 1, comprise less than 10% eicosapentaenoic acid by weight.

[0018] Furthermore, in the application, the ω-3 polyunsaturated fatty acids are EPA and DHA.

[0019] The present invention also protects a method for producing ω-3 polyunsaturated fatty acids, which uses the product containing ω-3 polyunsaturated fatty acids obtained by fermenting Schizochytrium sp. SK-1 or Schizochytrium sp. SKA-2 as described above.

[0020] Furthermore, in the method for producing ω-3 polyunsaturated fatty acids, the method for obtaining a product containing ω-3 polyunsaturated fatty acids by fermentation with Schizochytrium sp. SKA-2 comprises the following steps: 1) Activating Schizochytrium sp. SKA-2, and then subjecting the activated strain to primary culture to obtain a primary seed solution; then subjecting the primary seed solution to secondary culture to obtain a secondary seed solution, and obtaining a pre-culture seed solution; 2) Fermentation tank culture: Inoculate the secondary seed liquid into the fermentation tank for two-stage fermentation culture.

[0021] Furthermore, in step 1) of the method for producing ω-3 polyunsaturated fatty acids, during the primary culture, the inoculation amount of the activated strain is 10%; during the secondary culture, the inoculation amount of the primary seed liquid is 10%; the conditions of the Schizochytrium SKA-2 during the primary and secondary culture are: temperature 25-28°C, rotation speed 180-200rpm; the primary culture time is 12-36h, and the secondary culture time is 12-48h.

[0022] Furthermore, in step 2) of the method for producing ω-3 polyunsaturated fatty acids, the conditions for the two-stage fermentation culture are: a rotation speed of 300-500 rpm, a ventilation volume of 1-3 L / min, a dissolved oxygen content of 10%-50%, and a culture time of 72-120 h; a two-stage temperature control is adopted, with the first stage of 36-60 h being 28° C. and the second stage being 25° C.

[0023] The present invention also protects a product containing ω-3 polyunsaturated fatty acids, wherein the raw materials of the product include the product containing ω-3 polyunsaturated fatty acids obtained by fermenting the aforementioned Schizochytrium sp. SK-1, the aforementioned Schizochytrium sp. SKA-2, or at least one of the products obtained by any of the aforementioned methods or combinations of method steps.

[0024] Furthermore, in the product containing ω-3 polyunsaturated fatty acids, by weight percentage, it contains less than 10% eicosapentaenoic acid and / or at least 20% of the fatty acids are docosahexaenoic acid; the product includes non-human animal or human food, cosmetics or pharmaceutical compositions.

[0025] Compared with the prior art, the present invention has the following beneficial effects: (i) A Schizochytrium sp. SK-1 and a Schizochytrium sp. SKA-2 are provided, wherein the Schizochytrium sp. SKA-2 strain has a fast growth rate and a short fermentation time, and can be used to prepare ω-3 polyunsaturated fatty acids.

[0026] (ii) Schizochytrium sp. SKA-2 can produce high levels of EPA and DHA in low-salt fermentation broth. During shake flask fermentation, the EPA and DHA produced by the low-salt Schizochytrium strain screened out were 266.67% and 73.81% higher than those of the wild-type strain; when the screened Schizochytrium strain was used for high-density fermentation to produce EPA and DHA, the EPA and DHA yields were 5.25% and 43.35%, respectively, with significant economic effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a bacterial morphology diagram of Schizochytrium SK-1 in the present invention; Figure 2 This is a bacterial morphology diagram of Schizochytrium SKA-2 in the present invention. DETAILED DESCRIPTION

[0028] All features disclosed in this specification, or steps in all methods or processes disclosed, except mutually exclusive features and / or steps, can be combined in any manner.

[0029] Any feature disclosed in this specification (including claims and abstract), unless otherwise stated, may be replaced by other alternative features that are equivalent or have similar purposes. That is, unless otherwise stated, each feature is only an example of a series of equivalent or similar features.

[0030] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0031] The Schizochytrium sp. SKA-2 in the following examples was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO: M 20242314.

[0032] Schizochytrium sp. SK-1, also known as wild fungus, was screened from Qingdao seawater and was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO:M 20242313.

[0033] Unless otherwise specified, the % in this application refers to the mass percentage.

[0034] Embodiment 1: Screening and identification of Schizochytrium sp. SK-1 Sediment, rotten wood, rotten leaves and seawater were collected from the Qingdao seaside and collected into sterile tubes. The pine pollen fishing method was used for separation. The specific steps were as follows: a small amount of collected samples were placed in a sterile tube, and 5 mL of sterile seawater was added. A small amount of sterile pine pollen was added as bait, and then cultured at 28°C for 4 days. The enriched pine pollen was picked and placed on a solid plate culture medium, cultured at 28°C for 4 days, and then single colonies were isolated by streaking.

[0035] The isolated bacteria were morphologically identified. The remarkable characteristic of Schizochytrium sp. was that it reproduced by binary fission, and after a large number of reproduction, multiple cells accumulated and formed sporangia, which was similar to the growth characteristics of Schizochytrium sp. (see colony morphology for details). Figure 1 ), so the bacteria was judged to be of the genus Schizovibrio and named Schizochytrium sp. SK-1.

[0036] In order to further identify the strains obtained by screening, molecular biological methods were used to identify the isolated strains. The bacterial genome was extracted and its 18S rDNA sequence was compared. It was found that the homology between the strain and the 18S rDNA sequence of Schizochytrium was greater than 99%, so it was determined that the strain belonged to Schizochytrium. The gene sequence of the strain is shown in SEQ ID NO.1.

[0037] SEQ ID NO. 1: 1 TCCCTTCAATGATCTTATTACGTGTTAGAATGTTTTGGTGTTGGGTTGTT GTTTTTGTTT 61 TCTATTTCTTTTTAATTAAATACAAAAAATCAGTCATGACTTTCCCGAT GGATGTCTAG 121 GCTCTCGTAACGATGAAAAACGCAGCGAAATGCGATACGT AGTGTGAATT GCAAAATTAG 181 CGACCCTCAACTCTTTGAACGCACATTGCG CTTCCGTGTGATGCGGGAGCATTCCTGCTT 241 GAGTGTTTGTACCTTTGCT CATTGTCGCT TGGCGATGATGGCCTGTAGA TGGATCCATG 301 TAATTTGATTGATCAGATTG GCCTGAAGAAGCGCGCTATA AGAGCAAAGGGTTGCTTGAT 361 TGCAAATGACCCAAGCATCCGATAGAATCACACCTCAAGT TGGAAAGAACACCTGCTGAA 421TTTAAGCATATCAATAAGCGGAGGAAA. Embodiment 2: Screening of Schizochytrium sp. SKA-2: (1) Seed solution preparation: In a sterile clean bench, use an inoculation loop to pick a single colony (Schizochytrium sp. SK-1) from fresh normal salt solid medium, inoculate it into 30 mL normal salt seed medium, and culture it in a shaker at 28°C and 180 rpm for 24 h. Then take 3 mL of the bacterial solution and add it to 30 mL of new normal salt seed medium and culture it for another 24 h. (2) Preparation of bacterial suspension: Centrifuge at 4°C, 6000 rpm to collect the bacteria, add appropriate amount of physiological saline, and adjust the cell OD 600 The value is between 0.7 and 1, which is used for ARTP mutagenesis treatment; (3) ARTP mutagenesis: Take 10uL of the above bacterial suspension and evenly spread it on a sterile slide. The radiation time of the ARTP mutagenizer is 0s, 10s, 20s, 30s, 40s, 50s, 60s, 70s, 80s, 90s, 100s, 110s, the power is set to 120W, and the gas volume is set to 10SLM. After the mutagenesis is completed, the slide is placed in an EP tube containing 1mL of physiological saline, shaken for 1min, so that the bacteria on the slide are completely resuspended in the EP tube, 30uL of the resuspended liquid is taken and spread on a malonic acid low-salt solid plate (culture medium), and placed in a 28°C incubator for 2.5d. Count the number of single colonies grown, calculate the lethality at different treatment times of the ARTP mutagenizer, select colonies with a lethality of about 95%, and use this time as the basis for subsequent mutagenesis treatments, select single colonies with large morphology and high potential for yield and inoculate them into low-salt seed culture medium, subculture them to new low-salt seed culture medium every 24 hours, and subculture them three times in a row.

[0038] (4) Take 1 mL of the mutagenic seed solution in a 1 mL centrifuge tube, add 10 μL of 0.1 g / L Nile red, stain in the dark for 30 min, detect the fluorescence intensity under the conditions of excitation light of 515 nm and emission light of 574 nm, screen out mutant strains with higher fluorescence intensity, and perform fermentation detection on the mutant strains.

[0039] (5) The selected mutagenic strains and original bacteria were activated with low-salt and normal-salt seed culture media, respectively, and then inoculated into low-salt fermentation medium and normal-salt fermentation medium at an inoculum rate of 10%, respectively. The fermentation volume was 1 L and the culture was continued for 4 days. After the end, the biomass, fatty acid content, EPA and DHA content of the strains were measured.

[0040] The normal salt seed culture medium formula is: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115°C for 30 min.

[0041] The low-salt seed culture medium formula is: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115°C for 30 min. The basic formula of the normal salt fermentation medium is: 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115°C for 30 min.

[0042] The basic formula of the low-salt fermentation medium is: 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115°C for 30 min.

[0043] The preparation method of the normal salt solid culture medium is as follows: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, 15 g / L agar powder, natural pH, sterilization at 115°C for 30 min.

[0044] The formula of the malonic acid low-salt solid culture medium is: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, 1 g / L malonic acid, 1.5 g / L agar, natural pH, sterilized at 115°C for 30 min.

[0045] EPA and DHA content detection: The fermentation broth was centrifuged to separate the bacterial cells, which were then freeze-dried and stored in a refrigerator at 4°C. 8 mg of each bacterial powder was weighed and placed in a 4 mL white-cap bottle. After ultrasonication for a few minutes, 0.75 mL of sulfuric acid: methanol = 5:95 (V / V) solution and 20 μL of C21:0 (1 mg / ml) internal standard were added. The mixture was mixed with a vortex until no larger particles were visible. The white-cap bottle was placed in a metal bath and heated at 90°C for 1.5 h. After the reaction was completed, the white-cap bottle was cooled to room temperature, 500 μL of 0.9% sodium chloride (W / V) and 300 μL of n-hexane were added, and the mixture was mixed again with an oscillation, and centrifuged at 3000 rpm for 10 min. The supernatant was taken out with a longer and finer tip and placed in a new 1.5 mL EP tube. The tube was centrifuged at 12000 rpm for 5 min, and 300 μL of the supernatant was taken for sample analysis of EPA and DHA content.

[0046] Detection of strain biomass: Take 2 mL of the fermented bacterial solution, dry it, and weigh it to determine the biomass.

[0047] Detection of fatty acid content: Take 100mL of fermentation broth, adjust the pH to 10-12 with NaOH, then add 0.3% of cell wall breaking enzyme, shake the flask at 50℃ and 170rpm for 24h, then use a high-pressure homogenizer to break it 2-4 times at a pressure of 1000bar, and check the breaking efficiency under a microscope; after success, add 100mL of anhydrous ethanol and mix well to precipitate protein, then add 100mL of n-hexane, shake well and centrifuge. After stratification, absorb the n-hexane in the upper layer and evaporate it in a 40℃ water bath, collect the oil, and then dry it in an oven for ten minutes to volatilize the remaining n-hexane, and finally weigh the fatty acid weight.

[0048] The lethality curve of Schizochytrium sp. after mutagenesis is shown in Table 1. As shown in Table 2, a high-yield EPA and DHA mutant strain (named Schizochytrium sp.) SKA-2 was obtained by screening with malonate low-salt plates and Nile red, and its biomass, total oil content, EPA and DHA production were increased by 9.52%, 17.02%, 266.67% and 73.81% respectively compared with the original strain.

[0049] Table 1 The lethality of wild-type Schizochytrium sp. SK-1 in ARTP mutagenizer at different treatment times.

[0050]

[0051] Table 2 Biomass, lipid content, EPA and DHA content of wild-type Schizochytrium sp. SK-1 and mutant Schizochytrium sp. SKA-2.

[0052]

[0053] Classification and identification of mutant strains: 1) Morphological identification and phenotypic characterization; Schizochytrium forms milky white colonies on the surface of the culture medium, with a diameter of 11-12 mm and a viscous texture. The vegetative cells are single-celled, nearly spherical, with a diameter of 5-12 μm. The proliferation method is typical binary fission, and at the end of the fission, sporangium is formed to release zoospores. The bacteria generally aggregate into large aggregates, and the colony morphology is as follows: Figure 2 shown.

[0054] 2) Chemical property identification; The total protein content of Schizochytrium SKA-2 was 10.28%, the total fat was 50.07%, the total sugar was 5.39%, and the ash was 4.31%. The fatty acid composition is shown in Table 3.

[0055] Table 3 Fatty acid composition of Schizochytrium SKA-2.

[0056]

[0057] Preservation of strains: Schizochytrium SKA-2 was deposited in the China Center for Type Culture Collection on October 23, 2024, with the preservation number CCTCC NO:M 20242314.

[0058] Embodiment 3: The preserved Schizochytrium sp. SKA-2 was cultured in a low-salt medium; Schizochytrium sp. SK-1 was cultured in low-salt and normal-salt medium, respectively, to verify the effect of salt content on Schizochytrium sp. SKA-2 and SK-1.

[0059] The specific operation is as follows: Schizochytrium sp. SK-1 and Schizochytrium sp. SKA-2 are transferred to 100 mL of low-salt primary seed culture medium at a 10% inoculation rate, and cultured at 28°C and 180 rpm for 24 hours to obtain low-salt primary seed solution; then, the low-salt primary seed solution is inoculated into 100 mL of low-salt secondary seed culture medium at a 10% inoculation rate, and cultured again at 28°C and 180 rpm for 48 hours to obtain low-salt secondary seed solution, i.e., pre-cultured seed solution.

[0060] Transfer Schizochytrium sp. SK-1 to 100 mL normal salt primary seed culture medium at a 10% inoculation rate, and culture at 28°C, 180 rpm for 24 h to obtain normal salt primary seed solution; then inoculate the obtained normal salt primary seed solution into normal salt secondary seed culture medium again at a 10% inoculation rate, and culture again at 28°C, 180 rpm for 48 h to obtain normal salt secondary seed solution.

[0061] The low-salt primary seed culture medium comprises: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115° C. for 30 min, and is mainly used for the culture of Schizochytrium sp. SKA-2.

[0062] The positive salt-producing primary seed culture medium includes: 30 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, natural pH, and is mainly used for the culture of Schizochytrium sp. SK-1.

[0063] The low-salt secondary seed culture medium includes: 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, natural pH, and is mainly used for the culture of Schizochytrium sp. SKA-2 secondary seeds.

[0064] The positive salt-producing secondary seed culture medium includes: 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, natural pH, and is mainly used for the culture of Schizochytrium sp. SK-1 secondary seeds.

[0065] Fermentation tank culture: The secondary seed liquid (including Schizochytrium sp. SKA-2 low-salt secondary seed liquid, Schizochytrium sp. SK-1 low-salt secondary seed liquid, Schizochytrium sp. SK-1 normal salt secondary seed liquid) was inoculated into low-salt and normal salt fermentation medium respectively. The total volume of the fermentation tank was 5L, the working volume was 3L, the ventilation volume was 1.5L / min, the rotation speed was 400rpm, and the dissolved oxygen was controlled at 25%. The culture temperature of the whole fermentation process was divided into two stages. The temperature was 28℃ for the first 48h; the temperature was adjusted to 25℃ for the next 48h. The fermentation was carried out by adding carbon source to keep the glucose concentration in the fermentation tank between 15g / L. The fermentation culture was carried out for 96h, and the cell weight, EPA and DHA content were detected at 48h, 72h and 96h, and the tank was released after 96h. The fermentation results are shown in Table 4-6.

[0066] The low-salt fermentation medium has a formula of 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 2.1 g / L magnesium chloride hexahydrate, 4.5 g / L sodium sulfate, 0.4 g / L potassium chloride, 0.4 g / L sodium chloride, 0.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, 0.05%-0.1% defoamer addition, natural pH, sterilization at 115°C for 30 min; The normal salt fermentation medium: 50 g / L glucose, 2 g / L peptone, 4 g / L yeast powder, 18 g / L sodium glutamate, 4.2 g / L magnesium chloride hexahydrate, 18 g / L sodium sulfate, 0.8 g / L potassium chloride, 1 g / L sodium chloride, 1.5 g / L magnesium sulfate, 3 g / L potassium dihydrogen phosphate, natural pH, sterilized at 115° C. for 30 min; The feed medium has a formula of 400 g / L glucose, 20 g / L peptone, 40 g / L yeast powder, natural pH, and is sterilized at 115° C. for 30 minutes.

[0067] Table 4 Detection results of the culture process of Schizochytrium sp. SKA-2 mutant strain.

[0068]

[0069] Table 5 Detection results of the culture process of Schizochytrium sp. SK-1 in normal salt medium.

[0070]

[0071] Table 6 Detection results of the culture process of Schizochytrium sp. SK-1 in low-salt medium.

[0072]

[0073] As shown in Table 4-6, the cell dry weight of Schizochytrium sp. SKA-2 reached 74.52 g / L (water ≤ 10%), the oil content was 38.69 g / L, and the EPA and DHA contents were 5.25% and 43.35%, respectively, which were significantly better than those of Schizochytrium sp. SK-1 under normal salt culture. However, the growth of Schizochytrium sp. SK-1 was inhibited under low salt conditions, and the bacterial content was low.

[0074] Embodiment 4: Preparation of Schizochytrium sp. SKA-2 algae oil: According to the fermentation method in Example 3, a 1000L tank was fermented, and the fermentation volume was 600L. After the fermentation was completed, the cells and the fermentation liquid were centrifuged by a disc centrifuge, and an equal volume of clean water was added to wash twice, centrifuged, and then an equal volume of clean water was added, and high-pressure homogenization was crushed 3 times, and the pressure was 1300bar. Then, n-hexane of one-half of the fermentation volume was added to the crushed liquid, stirred and mixed, and the upper organic phase was statically separated. The organic phases obtained by the two separations were mixed, and the n-hexane was evaporated by a reduced pressure evaporator, and the solvent was recovered to obtain 21.62kg of crude algae oil containing EPA and DHA. Phosphoric acid was added to the crude algae oil containing EPA and DHA for degumming, NaOH was added to neutralize the free fatty acids in the oil, 10% of the weight of the oil by white clay and 1% of activated carbon were added to remove the pigment and other impurities in the oil, and supersaturated steam was used to remove the odor in the oil to obtain 13.47 kg of high-quality essential oil containing EPA and DHA.

[0075] The obtained essential oil containing EPA and DHA can be used as an additive in food or animal feed.

[0076] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

[0077] This background section is provided to generally present the context of the invention, and the work of the presently named inventors, the work to the extent described in this background section, and aspects of this section that did not constitute prior art at the time of application are neither explicitly nor implicitly admitted to be prior art to the present invention.

Claims

1. A strain of Schizochytrium sp. SK-1, characterized in that: It was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO:M 20242313.

2. A strain of Schizochytrium sp. SKA-2 was deposited in the China Center for Type Culture Collection on October 23, 2024, with the deposit number CCTCC NO:M 20242314.

3. Use of the Schizochytrium sp. SKA-2 according to claim 2 in the preparation of EPA and DHA in ω-3 polyunsaturated fatty acids.

4. A method for producing ω-3 polyunsaturated fatty acids, characterized in that The product containing ω-3 polyunsaturated fatty acids obtained by fermentation of Schizochytrium sp. SK-1 according to claim 1 or Schizochytrium sp. SKA-2 according to claim 2 is used.

5. The method for producing ω-3 polyunsaturated fatty acids according to claim 4, characterized in that: The method for obtaining a product containing ω-3 polyunsaturated fatty acids by fermentation of Schizochytrium sp. SKA-2 comprises the following steps: 1) Activating Schizochytrium sp. SKA-2, and then subjecting the activated strain to primary culture to obtain a primary seed solution; then subjecting the primary seed solution to secondary culture to obtain a secondary seed solution, and obtaining a pre-culture seed solution; 2) Fermentation tank culture: Inoculate the secondary seed liquid into the fermentation tank for two-stage fermentation culture.

6. The method for producing ω-3 polyunsaturated fatty acids according to claim 5, characterized in that In step 1), during the primary culture, the inoculation amount of the activated strain is 10%; during the secondary culture, the inoculation amount of the primary seed liquid is 10%; the conditions for the primary and secondary culture of the Schizochytrium SKA-2 are: temperature 25-28°C, rotation speed 180-200rpm; the primary culture time is 12-36h, and the secondary culture time is 12-48h.

7. The method for producing ω-3 polyunsaturated fatty acids according to claim 5, characterized in that In step 2), the conditions for the two-stage fermentation culture are: rotation speed of 300-500rpm, ventilation volume of 1-3L / min, dissolved oxygen content of 10%-50%, and culture time of 72-120h; the two-stage fermentation culture is divided into two stages of temperature control, the first stage is 28°C for 36-60h, and the second stage is 25°C.

8. A product containing ω-3 polyunsaturated fatty acids, characterized in that The product raw materials include at least one of the products containing ω-3 polyunsaturated fatty acids obtained by fermenting Schizochytrium sp. SK-1 as described in claim 1, Schizochytrium sp. SKA-2 as described in claim 2, or the products obtained by the method according to any one of claims 5 to 7.

9. The product containing ω-3 polyunsaturated fatty acids according to claim 8, characterized in that The product comprises, by weight percentage, less than 10% eicosapentaenoic acid and / or at least 20% of the fatty acids are docosahexaenoic acid; the product comprises non-human animal or human food, cosmetic or pharmaceutical composition.

Images