Preparation method and application of volatile oil from Chimonanthus chinensis leaves for treating ulcerative colitis

Abstract

The present invention provides a preparation method for extracting volatile oil of Chimonanthus chinensis leaves by ultrasonic-assisted steam distillation and its application in improving ulcerative colitis drugs. The method includes crushing Chimonanthus chinensis leaves to a specific particle size and then performing ultrasonic treatment and steam distillation under optimized conditions, and finally achieving 2.5% to 4% high-efficiency extraction. Volatile oil is rich in phellandrene, α-terpineol and (+)-limonene, accounting for more than 50% of the total mass. Pharmacological experiments show that this volatile oil can significantly reduce the levels of pro-inflammatory factors interleukin 6 (IL-6), interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) in mouse serum, increase anti-inflammatory factor interleukin 10 (IL-10); increase the expression of tight junction protein ZO-1, protect the integrity of mouse intestinal epithelial barrier; and significantly downregulate the expression of proline hydroxylase 3 factor of HIF-1 pathway to inhibit inflammation.

Description

Technical Field

[0001] The invention belongs to the technical field of medicines, and particularly relates to a preparation method and application of volatile oil of Chimonanthus chinensis leaves for treating ulcerative colitis. Background Art

[0002] Ulcerative colitis (UC) is an important clinical subtype of inflammatory bowel disease (IBD). The cause of the disease is currently unknown, and the main manifestation is chronic, diffuse colitis. The disease can occur at any age, but it is mainly seen in 20-40 years old. The lesions are mainly limited to the mucosal layer of the colon, and are mainly ulcers, mostly involving the rectum and distal colon, but can extend proximally and even throughout the entire colon. The main symptoms of patients are diarrhea and constipation. The initial symptoms are mild, with mucus on the surface of the stool, and then the frequency of bowel movements increases. In severe cases, the stool is soft and mushy. Blood in the stool is a common symptom of UC, and its cause is related to local ischemia of the colon mucosa and increased activity of fibrinolytic protein. Patients in the acute exacerbation period may have fever, electrolyte imbalance, protein and vitamin deficiency, anemia, and weight loss. To date, the pathogenesis of UC remains unclear. Current studies have shown that the onset and progression of UC are related to many factors, such as family inheritance, poor eating habits, intestinal microenvironment disorders, intestinal mucosal barrier destruction, and immune response disorders.

[0003] Existing drugs for treating ulcerative colitis are mostly aminosalicylic acid, corticosteroids, immunomodulators, etc., but these drugs have disadvantages such as large toxic side effects and high recurrence rate. Therefore, it is of great significance to seek more effective treatment methods with fewer side effects.

[0004] Chimonanthus chinensis Chimonanthus salicifolius HH Hu) is a plant of the genus Chimonanthus of the family Chimonanthus that is endemic to China. It is mainly distributed in the southeast of China. In 2014, my country recognized Chimonanthus sibiricum as a new food ingredient. Chimonanthus sibiricum is also one of the most widely used Chinese herbal medicines by the She ethnic group. It has antibacterial, antioxidant, anti-inflammatory, immunomodulatory and anti-tumor pharmacological effects.

[0005] In the prior art, the extraction efficiency of volatile oil from Chimonanthus chinensis leaves is low. The present invention improves the extraction process of volatile oil, and the extraction rate of volatile oil from Chimonanthus chinensis leaves is high. It is found that volatile oil from Chimonanthus chinensis leaves can improve the condition of mice with ulcerative colitis and protect the integrity of the intestinal epithelial barrier of mice. Summary of the invention

[0006] The technical field of the present invention is the technical field of medicine. The purpose of the present invention is to provide a preparation method and application of volatile oil of Chimonanthus chinensis leaves for treating ulcerative colitis.

[0007] In order to achieve the above-mentioned invention object, the present invention provides the following technical scheme: after drying the willow-leaf sweet osmanthus leaves in the shade, ultrasonic-assisted steam distillation is used for extraction, which specifically comprises the following steps: ① crushing the willow-leaf sweet osmanthus leaves; step ② ultrasonic treatment in water; step ③ steam distillation, the extraction temperature is 110°C; step ④ water-oil separation; the volatile oil of the willow-leaf sweet osmanthus leaves with an extraction rate of 2.5%~4% is obtained.

[0008] Furthermore, in the step ①, after the leaves of Chimonanthus chinensis are crushed, the particle size is greater than 20 mesh; Preferably, in step ②, the ultrasonic frequency of the ultrasonic treatment is 30-40 kHz, the ultrasonic time is 1-3 h, and the ultrasonic temperature is 30-50° C.; Preferably, in step ②, the mass ratio of water to Chimonanthus chinensis leaves is 1:10-1:30; Preferably, a soaking step is further included between step ② and step ③, and the soaking time is 0 to 4 hours; Preferably, the water vapor extraction time in step ③ is 3 to 7 hours; Furthermore, the volatile oil from the leaves of Chimonanthus chinensis contains phellandrene, α-terpineol and (+)-limonene, and the sum of the mass of phellandrene, α-terpineol and (+)-limonene is greater than 50% of the total mass of the volatile oil; Furthermore, the volatile oil obtained by the above scheme can be used to prepare a drug for treating ulcerative colitis; Furthermore, the medicine includes directly using the volatile oil of Chimonanthus chinensis leaves or mixing the volatile oil of Chimonanthus chinensis leaves with other pharmaceutically acceptable excipients.

[0009] The pharmacological experiments of the present invention show that the volatile oil of Chimonanthus chinensis leaves can protect the integrity of the intestinal epithelial barrier of mice by increasing the expression of tight junction protein ZO-1; (+)-limonene, α-pineneol and phellandrene in the volatile oil of Chimonanthus chinensis leaves significantly downregulate the high expression of proline hydroxylase 3 factor of the HIF-1 pathway, and significantly reduce the expression of inflammatory factors IL-6, IL-1β and TNF-α, significantly reduce the level of inflammatory factors in mouse serum, and thus inhibit the occurrence of inflammation.

[0010] (1) The extraction process of the present invention is different from that of the prior art. The prepared volatile oil of Chimonanthus chinensis leaves has a special composition. Experiments have shown that it has a more significant effect on improving ulcerative colitis.

[0011] (2) The present invention screens and optimizes the relevant factors in the extraction process, such as leaf processing method, distillation time, material-liquid ratio, and soaking time, so the preparation method is simple and the extraction efficiency of volatile oil is improved.

[0012] (3) The volatile oil from Chimonanthus chinensis leaves provided by the present invention can inhibit the high expression of proline hydroxylase 3 factor in the HIF-1 pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : A is the weight change of mice during the construction of ulcerative colitis animal model, and B is the DAI score of mice.

[0014] Figure 2 : A is a picture of mouse colon during the construction of ulcerative colitis animal model, and B is the length of mouse colon.

[0015] Figure 3 :Effects of volatile oil from Chimonanthus chinensis leaves on the coefficients of related organs in mice with colitis.

[0016] Figure 4 : A is the HE staining picture of the colon of each group of mice, B is the AB-PAS staining picture of the colon of each group of mice, and C is the colon pathological score of each group of mice.

[0017] Figure 5 :Levels of related inflammatory factors in mouse serum.

[0018] Figure 6 :Effect of volatile oil from Chimonanthus willowii leaves on mRNA expression of inflammatory factors related to colitis in mice.

[0019] Figure 7 :Effect of essential oil from Chimonanthus willowii leaves on the expression level of tight junction protein ZO-1 in mouse colon.

[0020] Figure 8 : To explore the KEGG analysis of volatile oil from Chimonanthus willowii leaves on colitis mice.

[0021] Fig. 9 :Effect of essential oil from Chimonanthus willowii leaves on the mRNA expression of proline hydroxylase 3 in the HIF-1 pathway.

[0022] Fig.10 :Effects of (+)-limonene, α-terpineol and phellandrene on the mRNA expression of proline hydroxylase 3 in the HIF-1 pathway. DETAILED DESCRIPTION

[0023] The following is a further detailed description of the improvement of ulcerative colitis by the volatile oil of Chimonanthus chinensis leaves provided by the present invention in conjunction with the accompanying drawings and specific examples. The Chimonanthus chinensis leaves used in the present invention are produced in Quzhou, Zhejiang, and the reagents and materials used in the examples are obtained by purchasing commercially available products.

[0024] All statistical analyses were performed using SPSS, Origin, and AI software. Multiple group comparisons were performed using one-way analysis of variance (ANOVA). Data were expressed as the mean ± standard deviation (SD) of independent experimental times. p＜0.05 There was a statistically significant difference compared with the control group. ## p≤0.01 , # p＜0.05 Compared with the model group, ** p≤0.01 , ** p＜0.05 ).

[0025] Example 1 Preparation of Chimonanthus chinensis leaf volatile oil After the leaves of Chimonanthus chinensis were dried in the shade, ultrasonic-assisted steam distillation was used to extract the volatile oil from the leaves of Chimonanthus chinensis, and the leaves were treated with different solid-liquid ratios, leaf crushing degrees, soaking time, and distillation time. The above variables were subjected to single-factor and orthogonal tests.

[0026] (1) Single factor test The shade-dried Chimonanthus chinensis leaves were subjected to the following single factor treatments: distillation time 3, 4, 5, 6, 7 h; solid-liquid ratios were 1:10, 1:15, 1:20, 1:25, 1:30; soaking time was 0, 1, 2, 3, 4 h; the particle size of the medicinal materials was: whole leaf, crushed, and sieved through a 20-mesh sieve; Chimonanthus chinensis leaves were ultrasonically treated for 1-3 h at an ultrasonic frequency of 30-40 kHz, steam distilled for 3-7 h, and the extraction temperature was 110 ° C. After the distillation, the water and oil were separated to obtain the volatile oil of Chimonanthus chinensis leaves. The single factor experiment was carried out, and each group of experiments was repeated three times. The experimental results are shown in Table 1, Table 2, Table 3, and Table 4, respectively.

[0027] Table 1 Effect of distillation time on volatile oil yield

[0028] Table 2 Effect of solid-liquid ratio on volatile oil yield

[0029] Table 3 Effect of soaking time on volatile oil yield

[0030] Table 4 Effect of herbal medicine particle size on volatile oil yield

[0031] There is no simple positive correlation between the particle size of Chimonanthus chinensis leaves and their volatile oil extraction rate. In fact, excessive crushing will lead to a decrease in the volatile oil extraction rate. Different extraction processes and different active substances required may also have different requirements for the particle size of the raw materials, so it is necessary to adjust and optimize the extraction process according to the specific situation.

[0032] (2) Orthogonal test When the distillation time is 5, 6, 7, the material-liquid ratio is 1:15, 1:20, 1:25, the soaking time is 1h, 2h, 3h, and the particle size of the medicinal material is whole leaves, broken leaves, and 20 mesh sieve, the extraction rate of volatile oil is high, and the extraction rate error is small, so these factors are selected for orthogonal experiments. The volatile oil yield of Chimonanthus chinensis leaves is used as the evaluation index, and each test is repeated three times to take the average value. It can be seen from Table 5 that R 药材粒度 >R 浸泡时间 >R 料液比 >R 蒸馏时间 , that is, the particle size of the medicinal material has the greatest impact on the extraction rate of volatile oil, followed by soaking time, solid-liquid ratio, and distillation time. The optimal process conditions for the extraction of volatile oil from Chimonanthus chinensis leaves are distillation time of 7h, solid-liquid ratio of 1:15, soaking time of 3h, and the particle size of the medicinal material is broken leaves. As shown in Table 6, the distillation time, solid-liquid ratio, soaking time, and medicinal material particle size have significant effects on the test results ( p <0.01), which is consistent with the results of the range analysis. To further verify the reliability and repeatability of the orthogonal experimental results, three parallel experiments were carried out according to the optimal process conditions. The extraction rates of volatile oil from Chimonanthus chinensis leaves were 3.85%, 3.875% and 3.90%, and the average extraction rate was 3.875%. It can be seen that the established experimental process conditions have good reproducibility.

[0033] Table 5 Orthogonal experiment results and analysis

[0034] Table 6 Results of variance analysis of orthogonal test

[0035] Example 2 GC-Q / TOF MS analysis of volatile oil from Chimonanthus chinensis leaves GC-Q / TOF MS analysis conditions of volatile oil from Chimonanthus chinensis leaves: HP-5MS capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, USA); programmed temperature process: starting temperature was 50℃, heating to 200℃ at 5℃ / min, and then heating to 300℃ at 20℃ / min; carrier gas: helium, purity 99.999%, flow rate 1.0 mL / min; injection port temperature: 280℃; injection volume: 1 μL; split ratio: 80:1. Standard mode: EI source voltage: 70 eV; ion source temperature: 250℃; GC-MS interface temperature: 300℃; data scanning mode: TOF-Scan full scan, mass scanning range m / z 50~600 amu; acquisition rate 5spectrum / s; solvent delay: 4 min.

[0036] A total of 50 components were identified in the volatile oil of Chimonanthus chinensis leaves, mainly monoterpenes and sesquiterpenes and their derivatives, alcohols, ketones, aldehydes, fatty acids and their esters, in addition to some aldehydes and alkanes. Among them, the components with a relative content greater than 10% include phellandrene, α-terpineol and (+)-limonene, as shown in Table 7.

[0037] Table 7 Chemical composition analysis of volatile oil from Chimonanthus chinensis leaves

[0038] Example 3 Establishment and grouping of ulcerative colitis mouse model S1. Preparation of volatile oil from Chimonanthus chinensis leaves; The leaves of Chimonanthus chinensis were dried in the shade and extracted by ultrasonic-assisted steam distillation, which specifically included breaking the leaves, ultrasonically treating them for 2 hours at a solid-liquid ratio of 1:15, a temperature of 40°C, and an ultrasonic frequency of 30kHz, then soaking them for 3 hours, and steam distilling them for 7 hours. The extraction temperature was 110°C. After the distillation, the water and oil were separated to obtain the volatile oil of Chimonanthus chinensis leaves.

[0039] S2, preparation of aqueous extract of Chimonanthus willowii leaves; Weigh 100 g of Chimonanthus willowii leaves, place them in a round-bottom flask, add 8 times of water for the first time and 6 times of water for the second time, reflux extraction twice in total, each time for 2 h, filter through gauze, combine the two filtrates, rotary evaporate and concentrate into an extract, and store in a 4°C refrigerator for later use.

[0040] S3, model building and grouping; Healthy and mature 6-7 week old Balb / c male mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. After 1 week of adaptive feeding, they were divided into groups.

[0041] The mice were randomly divided into 6 groups: control group, model group, high-dose volatile oil group (200 mg / kg), low-dose volatile oil group (50 mg / kg), Chimonanthus willowii leaf water extract group (200 mg / kg), and mesalazine group (200 mg / kg). Volatile oil, water extract, and mesalazine were dissolved in 1% Tween 80.

[0042] Except for the control group, the other groups drank 3% DSS solution freely. The mice in the volatile oil group were gavaged with volatile oil according to the dose, the mice in the water extract group were gavaged with water extract according to the dose, the mice in the mesalazine group were gavaged with mesalazine, and the mice in the control group and the model group were gavaged with 1% Tween 80 for 8 days. After the model was successfully established, the mice were fasted but not watered for 24 h. During the modeling period, the disease activity index (DAI) and overall condition of the mice were observed. The DAI score results are shown in Table 8; the weight changes of the mice and the DAI scores of the mice are shown in Table 8. Figure 1 shown.

[0043] Table 8 DAI score

[0044] Six days after DSS modeling, compared with the control group, the body weight of mice in the model group, low-dose volatile oil group, high-dose volatile oil group and Chimonanthus willowii leaf water extract group showed a downward trend. On the 8th day, the model group showed a significant decrease compared with the control group. The disease activity index (DAI) is mainly composed of three parts: weight loss rate, stool shape and bleeding, and is often used to evaluate the severity of colitis in patients. During the DSS modeling period, the DAI scores of mice in the model group, low-dose volatile oil group and high-dose volatile oil group gradually increased, and reached the highest value on the 8th day of modeling. Compared with the control group, the DAI scores of mice in the model group, low-dose volatile oil group, high-dose volatile oil group and Chimonanthus willowii leaf water extract group showed a significant increase; the DAI scores of mice in the low-dose volatile oil group, high-dose volatile oil group and Chimonanthus willowii leaf water extract group were significantly better than those in the model group ( Figure 1 ).

[0045] Example 4 Determination of colon length and organ coefficient in mice The mice were killed by cervical dislocation and the colon length was measured and images were collected. Figure 2 As shown. Low-dose and high-dose volatile oil from Chimonanthus chinensis leaves can significantly inhibit the effect of model treatment on colon length. The volatile oil from Chimonanthus chinensis leaves significantly improved the symptoms of colitis and alleviated the shortening of the colon caused by colitis, while the water extract of Chimonanthus chinensis leaves had no significant effect on the shortening of the colon in mice ( Figure 2 ), indicating that the volatile oil of Chimonanthus chinensis leaves can improve the condition of model mice. The viscera were weighed and the organ coefficient was calculated as the weight of the mouse organ / body weight × 100%. The results are as follows Figure 3 shown.

[0046] Example 5 Mouse colon tissue staining and histopathological scoring The mouse colon was fixed with 4% paraformaldehyde, embedded in paraffin, and routinely sectioned. After staining with hematoxylin and eosin (H&E) and Alcian Blue and Periodic Acid-Schiff (AB-PAS), pathological changes of the tissue were observed under an optical microscope. Figure 4 shown.

[0047] HE staining results showed that compared with the control group, the intestinal tissue damage of the model group mice was obvious, mainly manifested as destruction of crypt structure, destruction of colon mucosa, and increased inflammatory infiltration. However, reduced intestinal tissue damage was observed in mice treated with volatile oil. Alcian blue staining was used to detect colonic goblet cells, and the number of goblet cells in the model group mice was significantly reduced compared with the control group. Compared with the model group, the number of goblet cells in the volatile oil-treated mice was significantly increased. These results indicate that volatile oil from the leaves of Chimonanthus chinensis can significantly improve the colon tissue lesions caused by the model.

[0048] Example 6 Detection of related inflammatory factor levels in mouse serum 1.5 mL of blood was collected by eyeball removal, centrifuged at 3500 rpm for 10 min, and stored at -80°C for later use. Then, interleukin 6 (IL-6), interleukin 1β (IL-1β), interleukin 10 (IL-10), and tumor necrosis factor α (TNF-α) detection kits were used for content detection. The determination was performed according to the instructions of the detection kits. The results were as follows: Figure 5 As shown, it can be seen that the volatile oil of Chimonanthus sibiricum leaves can significantly reduce the content of pro-inflammatory factors IL-6, IL-1β and TNF-a, and increase the content of anti-inflammatory factor IL-10. The results show that the volatile oil of Chimonanthus sibiricum leaves can significantly improve the inflammatory response in the serum of model mice, so the volatile oil of Chimonanthus sibiricum leaves was selected for subsequent research.

[0049] Example 7 mRNA expression of inflammatory factors related to colitis in mice Weigh 40 mg of tissue sample accurately into a 1.5 mL centrifuge tube containing 4 sterile steel beads, add 1 mL of RNAiso Plus reagent, and grind at 70 Hz for 3 min in a pre-cooled homogenizer to obtain tissue homogenate. Total RNA was extracted and reverse transcribed, and the obtained cDNA was used for subsequent experiments.

[0050] The reagents were mixed for fluorescence quantitative PCR experiment. The primer sequences were shown in Table 9. GAPDH was used as the internal standard. 2 -△△CT Method to measure gene expression.

[0051] Table 9 Primer sequences Gene <![CDATA[Sequence (5 ， -3 ， )]]> GAPDH F (SEQ ID NO.1) CATCACTGCCACCCAGAAGACTG GAPDH R (SEQ ID NO.2) ATGCCAGTGAGCTTCCCGTTCAG β-actin F (SEQ ID NO.3) TGTCCACCTTCCAGCAGATGT β-actin R (SEQ ID NO.4) AGCTCAGTAACAGTCCGCCTAGA IL-6 F (SEQ ID NO.5) TACCACTTCACAAGTCGGAGGC IL-6 R (SEQ ID NO.6) CTGCAAGTGCATCATCGTTGTTC IL-1β F (SEQ ID NO.7) ACTCATTGTGGCTGTGGAGA IL-1β R (SEQ ID NO.8) AGCCTGTAGTGCAGTTGTCT TNF-α F (SEQ ID NO.9) TGCTTTCTGTGCTCATGGTG TNF-α R (SEQ ID NO.10) GACTAGCCAGGAGGGAGAAC PHD3 F (SEQ ID NO.11) AAGGAGCGGTCCAAGGCAAT PHD3 R (SEQ ID NO.12) ATACAGCGGCCATCACCATT Effect of volatile oil from Chimonanthus chinensis leaves on mRNA expression of inflammatory factors related to colitis in mice Figure 6 As shown in the figure, it can be seen that the volatile oil of Chimonanthus chinensis leaves can significantly downregulate the content of pro-inflammatory factors IL-6, IL-1β and TNF-a in colon tissue, indicating that the volatile oil of Chimonanthus chinensis leaves has significant anti-inflammatory ability.

[0052] Example 8 Detection of the expression level of tight junction protein ZO-1 in mouse colon tissue S1. Sample preparation; Total protein extraction from tissue: Weigh 30 mg of colon tissue, add about 10 times the sample volume of complete lysis buffer (protein lysis buffer RIPA: protease inhibitor: phosphatase inhibitor = 298:1:1), and place in a tissue grinder for homogenization.

[0053] S2, protein concentration determination; In order to accurately determine the protein concentration, we used the BCA protein detection kit and followed the instructions to obtain the actual protein concentration of the sample.

[0054] S3, protein denaturation; Add 5× protein loading buffer (protein sample: loading buffer = 4:1, v:v) to the quantified protein sample, heat at 95°C for 10 min in a PCR instrument, and store in a -80°C refrigerator.

[0055] S4, SDS polyacrylamide gel electrophoresis and membrane transfer; S4.1, glue preparation; Rinse the electrophoresis tank glass plate with clean water, rinse with pure water and dry naturally; select the appropriate concentration of SDS-PAGE lower gel according to the molecular weight of the target protein, let it stand for about 15-30 minutes, wait for the gel to polymerize, pour out the isopropanol; fill the gel chamber with the prepared upper gel solution, and slowly insert the sample comb with the appropriate number of holes. Let it stand for about 15-30 minutes, the gel will polymerize, and the gel preparation is complete.

[0056] Table 10 Preparation of Concentrating Gel and Separating Gel

[0057] S4.2, electrophoresis; After the concentrated gel solidifies, load the sample and perform electrophoresis; stop the electrophoresis when the gel is about 1 cm away from the bottom of the gel.

[0058] S4.3, transfer membrane; Cut the gel according to the marker instructions, cut a mark in the upper left corner, and cover the gel with the PVDF membrane. Place the transfer tank on ice, with the black side of the transfer clip facing the black side of the transfer tank. Use 150mA to transfer the membrane for 1h 15 min-40min. The transfer time is shorter for smaller molecular weight.

[0059] S4.4, primary and secondary antibodies; After transfer, wash the membrane with TBST solution. Prepare 1% skim milk powder solution and incubate at room temperature for 2 hours. After blocking, wash the membrane with TBST. Add primary antibody dilution buffer (antibody diluted according to the instructions) at room temperature for 2 hours or in a refrigerator at 4°C overnight. Wash the membrane with TBST at room temperature. Add secondary antibody (dilution ratio refers to the instructions), incubate at room temperature for 1.5 hours, and then wash the membrane with TBST.

[0060] S4.5, development; Use ECL developer to place the PVDF strip in the development area and drip developer on the strip. After development, use ImageJ software to accurately measure and count the grayscale value of the image. The results are as follows: Figure 7 shown.

[0061] Depend on Figure 7 It can be seen that the tight junction-related protein ZO-1 and content of mice in the model group decreased significantly. The destruction of tight junctions caused the destruction of the paracellular barrier, and the protein content that controlled the barrier decreased, which led to the destruction of the function of controlling the entry and exit of substances. Some bacteria, endotoxins, etc. entered the blood and may cause inflammation and other related diseases. The volatile oil group of Chimonanthus chinensis leaves can upregulate the expression of tight junction ZO-1. This shows that the volatile oil group of Chimonanthus chinensis leaves can inhibit the occurrence of inflammation from the perspective of controlling the integrity of the intestinal barrier.

[0062] Example 9 Mechanism of action of Chimonanthus chinensis leaf volatile oil and ulcerative colitis in colon tissue S1. Screening of active components of volatile oil from Chimonanthus chinensis leaves; The targets of volatile oil from Chimonanthus willowii leaves were screened in the TCMSP, Swiss Target Prediction and SuperPerd databases.

[0063] S2. Target screening for ulcerative colitis; In the disease target database (OMIM, Genecards), "Ulcerative colitis" was used as a keyword to search for candidate targets for ulcerative colitis. Then, the intersection mapping was performed with the component action targets obtained in S1 to obtain the component-disease intersection target genes, that is, the anti-ulcerative colitis action targets of the volatile oil of Chimonanthus chinensis leaves. S3, GO and KEGG analysis; The common targets were imported into the DAVID database to obtain GO and KEGG data. The results are as follows Figure 8 As shown. Figure 8 It can be seen that through network pharmacology analysis, the pathway related to volatile oil from Chimonanthus willowii leaves and ulcerative colitis may be the HIF-1 pathway.

[0064] Fig. 9The results showed that the expression of proline hydroxylase 3 factor was increased in the model group, while the volatile oil from Chimonanthus chinensis leaves group could downregulate the expression of proline hydroxylase 3 factor, indicating that proline hydroxylase 3 may be the key factor for Chimonanthus chinensis leaves volatile oil to improve ulcerative colitis.

[0065] Example 10 Detection of the expression of proline hydroxylase 3 in the HIF-1 pathway of phellandrene, α-terpineol and (+)-limonene in cells RAW264.7 cells in the logarithmic growth phase were taken and 5×10 5 The cells were seeded at a density of 10 cells / well in a 6-well plate and placed in a 5% CO2 constant temperature incubator. After the cells adhered to the wall, they were divided into a control group, a model group (lipopolysaccharide), a phellandrene group (lipopolysaccharide + phellandrene), an α-terpineol group (lipopolysaccharide + α-terpineol), and a (+)-limonene group (lipopolysaccharide + (+)-limonene). The control group was added with culture medium, the model group was added with 125 ng / mL lipopolysaccharide and cultured for 24 h, the phellandrene group was pretreated with 12.5, 25, and 50 μM phellandrene solutions for 1 h, the α-terpineol group was pretreated with 12.5, 25, and 50 μM α-terpineol solutions for 1 h, and the (+)-limonene group was pretreated with 12.5, 25, and 50 μM (+)-limonene solutions for 1 h, and then 125 ng / mL lipopolysaccharide was added and cultured for 24 h.

[0066] According to the method of Example 6, the expression of inflammatory factors and HIF-1 pathway related genes in mouse colon tissue was analyzed by cDNA for fluorescence quantitative PCR experiment. The primer sequences are shown in Table 9. β-actin was used as the internal standard and 2 -△△CT Method to measure gene expression.

[0067] Fig.10 The results showed that the expression of proline hydroxylase 3 factor was increased in the lipopolysaccharide model group, while phellandrene, α-terpineol and (+)-limonene treatments could downregulate the expression of proline hydroxylase 3 gene.

[0068] Under different extraction processes and extraction conditions, the composition and content of volatile oil are different, and the inhibitory effect on mouse colitis is also different. Experiments have shown that the DAI scores of mice in the low-dose and high-dose volatile oil groups of Chimonanthus chinensis leaves are significantly better than those in the water extract group of Chimonanthus chinensis leaves. The volatile oil of Chimonanthus chinensis leaves significantly improves the symptoms of colitis and alleviates the shortening of the colon caused by colitis, while the water extract group of Chimonanthus chinensis leaves has no significant effect on the shortening of the mouse colon. In the present invention, the components of volatile oil are mainly phellandrene, α-terpineol and (+)-limonene, and the main component of the volatile oil of the water extract is flavonoids. The components of volatile oil are different, and the effects on mouse colitis are also different. The active ingredients of the volatile oil extracted in the process of the present invention can inhibit the occurrence of inflammation by inhibiting the proline hydroxylase 3 factor of the HIF-1 pathway, reducing the pro-inflammatory factors interleukin 6 (IL-6), interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) in mouse serum, increasing the anti-inflammatory factor interleukin 10 (IL-10), and increasing the expression of the tight junction protein ZO-1.

[0069] It can be seen from the above examples that the volatile oil of Chimonanthus chinensis leaves has a significant effect of improving ulcerative colitis. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. It is not necessary and impossible to list all the embodiments here. The obvious improvements and modifications derived from this should also be regarded as the protection scope of the present invention.

Claims

1. A method for preparing volatile oil from Chimonanthus chinensis leaves with high extraction rate, characterized in that: Specifically include: Step 1: crush the leaves of Chimonanthus chinensis; Step 2: ultrasonic treatment in water; Step 3: steam distillation at an extraction temperature of 110°C; Step 4: water-oil separation; Obtain volatile oil from Chimonanthus chinensis leaves.

2. The preparation method according to claim 1, characterized in that: After the leaves of Chimonanthus chinensis in the step ① are crushed, the particle size is greater than 20 meshes.

3. The preparation method according to claim 1, characterized in that: The ultrasonic frequency of the ultrasonic treatment in step ② is 30-40 kHz, the ultrasonic time is 1-3 h, and the ultrasonic temperature is 30-50° C.

4. The preparation method according to claim 1, characterized in that: In the step ②, the mass ratio of Chimonanthus willowii leaves to water is 1:10-1:

30.

5. The preparation method according to claim 1, characterized in that: A soaking step is also included between step ② and step ③, and the soaking time is 0 to 4 hours.

6. The preparation method according to claim 1, characterized in that: In step ③, the extraction time is 3 to 7 hours.

7. A volatile oil from Chimonanthus willowii leaves prepared by the preparation method according to any one of claims 1 to 6, characterized in that: The volatile oil comprises phellandrene, α-terpineol and (+)-limonene, and the total mass of phellandrene, α-terpineol and (+)-limonene is greater than 50% of the total mass of the volatile oil.

8. Use of the volatile oil from Chimonanthus chinensis leaves according to claim 7 in the preparation of a medicine for treating ulcerative colitis.

9. The use according to claim 8, characterized in that: The volatile oil from the leaves of Chimonanthus willowii can inhibit the expression of proline hydroxylase 3 in the HIF-1 pathway, reduce the levels of serum proinflammatory factors interleukin 6, interleukin 1β and tumor necrosis factor α, increase the level of anti-inflammatory factor interleukin 10, increase the expression of tight junction protein ZO-1, and protect the integrity of the intestinal epithelial barrier to inhibit inflammation.

10. The use according to claim 8, characterized in that: The volatile oil of Chimonanthus chinensis leaves is directly used or mixed with other pharmaceutically acceptable excipients before use.

Images