An InDel molecular marker tightly linked to the sterile trait of cabbage ecotype and its application

By developing InDel molecular markers closely linked to the ecotype sterility trait of Chinese cabbage, the problems of low parental reproduction coefficient and high seed production cost in Chinese cabbage breeding were solved, realizing the self-reproduction and efficient propagation of sterile lines, and improving the purity and production efficiency of hybrids.

CN119753224BActive Publication Date: 2025-10-28INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510087851.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-10-28
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

Existing male-sterile systems for Chinese cabbage and other similar vegetables suffer from problems such as low parental reproduction coefficients, high seed production costs, and difficulty in ensuring hybrid purity. In particular, when applied under specific temperature conditions, sterility recovery or micro-powdering occurs, affecting the production efficiency and quality of hybrids.

Method used

We developed InDel molecular markers closely linked to ecotype sterility in Chinese cabbage, and identified sterile and fertile plants by PCR amplification and gel electrophoresis analysis using specific primers. By utilizing the ecotype sterility trait controlled by the BRVMS5 site, we achieved self-reproduction and efficient propagation of sterile lines.

Benefits of technology

It simplifies the cabbage breeding process, reduces seed production costs, and improves the purity and production efficiency of hybrids. In particular, it exhibits excellent fertility characteristics in cabbage varieties at different growth stages in autumn and spring, avoiding the shortcomings of existing systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119753224B_ABST
    Figure CN119753224B_ABST
Patent Text Reader

Abstract

This invention provides four InDel molecular markers closely linked to the ecotype sterility trait in Chinese cabbage, as follows: Molecular Markers Brvms5 -5216342, nucleotide sequence as shown in SEQ ID NO.1; molecular marker Brvms5 -6164784, nucleotide sequence as shown in SEQ ID NO.2; molecular marker Brvms5 -6315378, nucleotide sequence as shown in SEQ ID NO.3; molecular marker Brvms5 -6648913, nucleotide sequence as shown in SEQ ID NO.4. This invention focuses on the genetic locus mapping of the newly discovered ecotype sterile material LY25 in Chinese cabbage, revealing that its sterility characteristic is influenced by a single-gene recessive genetic locus. Brvms5 Compared to the existing inheritance patterns of temperature-sensitive male sterility and multiple alleles in Chinese cabbage, this method has simpler genetic rules and is more convenient to use. When producing hybrids, it is only necessary to... Brvms5 The site can be imported into the parent material.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of vegetable breeding and molecular genetics technology, specifically involving an InDel molecular marker closely linked to the ecotype sterility trait of Chinese cabbage and its application. Background Technology

[0002] Cabbage, a type of vegetable, belongs to the Brassicaceae family, genus Brassica, species Brassica. Brassica rapa ), including Chinese cabbage ( B. rapa ssp. pekinensis ), bok choy ( B. rapa ssp. chinensis ), Tatsoi ( B. rapa ssp. narinosa More than ten different subspecies, varieties, and new types of interspecific hybrids have been identified. Chinese cabbage exhibits strong hybrid vigor, with self-incompatibility and male sterility being the main pathways for hybrid seed production. Self-incompatibility is a mechanism in which plants resist their own pollen during flowering and instead accept pollen from single plants with different haplotypes. Breeders create self-incompatible parent materials that, under natural conditions, only accept pollen from another parent to achieve hybrid seed production. However, the self-incompatibility method suffers from low parental reproduction coefficients and a certain self-pollination rate during seed production. Male sterility, on the other hand, utilizes pollenless female parents to naturally accept pollen from male parents, offering advantages such as high hybridization rates and low female parent propagation costs. It has now become the main method for hybrid seed production in Chinese cabbage.

[0003] The male sterility system for Chinese cabbage was first applied in the 1970s, and has since evolved into several types, including cytoplasmic male sterility (CMS) and dual-purpose nuclear sterility. The utilization of different male sterility systems in Chinese cabbage varieties also varies. Ogura The CMS type is highly effective at causing sterilization and is currently widely used on Chinese cabbage, but... Ogura When CMS is applied to certain types of products such as red cabbage and Chinese cabbage, the buds wither and turn yellow at low temperatures, affecting their marketability. Polima CMS (Centralized Malignant Male Infection) is prone to powdery mildew during seed production due to genetic background and low-temperature induction. Currently, it is mainly used in some Chinese cabbage varieties with milder powdery mildew and red cabbage varieties. Dual-purpose nuclear male sterility refers to sterility controlled by a recessive nuclear gene. The sterile line is propagated through testcrosses between a heterozygous female parent and the sterile line. This method requires removing 50% of fertile plants in the seed production field, increasing seed production costs. Currently, a number of recessive mutant genes that can be used for dual-purpose nuclear male sterility seed production have been reported, such as... Bra2ms , ftms However, due to the reasons mentioned above, dual-purpose nuclear male sterility is generally less used in breeding.

[0004] Temperature-sensitive male sterility and multi-allelic male sterility systems have also attracted the attention of breeders of Chinese cabbage. Temperature-sensitive male sterility refers to the restoration of fertility in sterile lines under specific temperature conditions, enabling self-reproduction of the sterile line without the need for a maintainer line. In rapeseed and rice breeding, temperature-sensitive male sterility is often referred to as eco-sterility. Zhang Lugang et al. discovered the temperature-sensitive male sterility line TsCMS7311 for Chinese cabbage, whose temperature-sensitive male sterility is regulated by two genetic loci. This sterility system has been used in the production of hybrid Chinese cabbage varieties. A set of systems derived from the male-sterile dual-purpose line AB01 of Chinese cabbage, using restorer genes... Ms f Infertility genes Ms and near-protected genes ms This is one of the earliest applied multi-allelic male sterility systems in Chinese cabbage varieties. It allows for the generation of 100% sterile maternal parents through hybridization of a reserve line and a sterile line. Utilizing linkage markers of the corresponding genes, this system has also been applied to other Chinese cabbage varieties such as bok choy and flowering cabbage. Hong Xiaoru et al. also discovered a dual-gene recessive epistatic male sterility system in Chinese cabbage, which can produce fully sterile populations in production, potentially solving the current problems of low sterile line propagation and low hybridization seed setting rates in Chinese cabbage seed production. Therefore, male sterility systems with advantages in sterile line propagation or sterile plant rate have received increasing attention in Chinese cabbage breeding in recent years. Summary of the Invention

[0005] In view of this, the present invention provides an InDel molecular marker closely linked to the ecotype sterility trait of Chinese cabbage and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] One objective of this invention is to provide an InDel molecular marker closely linked to the ecotype sterility trait of Chinese cabbage. The invention comprises four InDel molecular markers, as detailed below:

[0008] Molecular markers Brvms5 -5216342, nucleotide sequence as shown in SEQ ID NO.1;

[0009] Molecular markers Brvms5 -6164784, nucleotide sequence as shown in SEQ ID NO.2;

[0010] Molecular markers Brvms5 -6315378, nucleotide sequence as shown in SEQ ID NO.3;

[0011] Molecular markers Brvms5 -6648913, the nucleotide sequence is shown in SEQ ID NO.4.

[0012] The second objective of this invention is to provide a primer for amplifying the aforementioned InDel molecular marker, the primer being as follows:

[0013] Amplifying molecular markers Brvms5 The primer sequence for -5216342 is shown in SEQ ID NO.5;

[0014] Amplifying molecular markers Brvms5 The primer sequence for -6164784 is shown in SEQ ID NO.6;

[0015] Amplifying molecular markers Brvms5 The primer sequence for -6315378 is shown in SEQ ID NO.7;

[0016] Amplifying molecular markers Brvms5 The primer sequence for -6648913 is shown in SEQ ID NO.8.

[0017] The third objective of this invention is to provide a method for detecting ecotype sterility traits in Chinese cabbage, the method being as follows:

[0018] S1. Extract genomic DNA from the plant to be tested;

[0019] S2. Using the DNA in S1 as a template, amplification is performed using the primers described in claim 2.

[0020] S3. The amplification products in S2 were analyzed by gel electrophoresis, and the results are as follows:

[0021] If the primers shown in SEQ ID NO.5 produce a 542bp DNA band, the plant is sterile; if they produce a 483bp DNA band, the plant is fertile.

[0022] If the primers shown in SEQ ID NO.6 produce a DNA band of 359 bp, the plant is sterile; if they produce a DNA band of 316 bp, the plant is fertile.

[0023] If the primers shown in SEQ ID NO.7 produce a 307bp DNA band, the plant is sterile; if they produce a 246bp DNA band, the plant is fertile.

[0024] If the primers shown in SEQ ID NO.8 produce a 332bp DNA band, the plant is sterile; if they produce a 297bp DNA band, the plant is fertile.

[0025] In some specific embodiments, preferably, the PCR reaction system is the same for all PCR amplification processes, specifically as follows: total volume 10 μL, including: 5.0 μL of 2X Magic green Taq super Mix, 0.4 μL each of forward and reverse primers (10 μM), 2 μL of DNA template (50~200 ng / μL), and 2.2 μL of ddH2O.

[0026] In some specific embodiments, preferably, the PCR reaction procedure is basically the same when performing PCR amplification, as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ / 52℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; 72℃ extension for 5 min, and storage at 4℃ for 10 min.

[0027] The primers shown in SEQ ID NO.5 and SEQ ID NO.7 were annealed at 55℃ during amplification; the primers shown in SEQ ID NO.6 and SEQ ID NO.8 were annealed at 52℃ during amplification.

[0028] In some specific embodiments, preferably, the gel electrophoresis detection steps are as follows: PCR products are electrophoresed on a 3% agarose gel at 110V for 1 hour, and the results are displayed on a gel imaging system.

[0029] The fourth objective of this invention is to provide the application of the aforementioned InDel molecular marker in Chinese cabbage breeding.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] (1) This invention performs genetic locus mapping on the newly discovered ecotype sterile material LY25 of Chinese cabbage and finds that its sterility characteristic is affected by a single gene recessive genetic locus. Brvms5 Compared to the existing inheritance patterns of temperature-sensitive male sterility and multiple alleles in Chinese cabbage, this method has simpler genetic rules and is more convenient to use. When producing hybrids, it is only necessary to... Brvms5 The site can be imported into the parent material.

[0032] (2) Brvms5 Sterile lines can be used as maintenance lines for the organism itself. Brvms5 The ecotype of sterility is characterized by partial fertility in autumn. Therefore, this locus has greater application value in cabbage-type vegetables such as Chinese cabbage and early-maturing Chinese cabbage scapes, which can complete the normal flowering and seed-setting process in autumn. This characteristic can be utilized to achieve... Brvms5 Self-pollination propagation of sterile lines, and the existing cytoplasmic sterility types used in Chinese cabbage and Chinese broccoli, such as... Ogura Type CMS PolimaCompared to the CMS type, no additional maintainer line needs to be created. Furthermore, this male-sterile line exhibits complete sterility after the small plants bolt in spring, unlike the nuclear male-sterile dual-purpose line which requires the removal of 50% of fertile plants from testcross progeny. Polima The appearance of micro-powdered fertile plants after low temperatures in spring in CMS type affects the purity of hybrids, but has a significant advantage. Attached Figure Description

[0033] Figure 1 Images show the characteristics of fertility conversion that occurred in the middle and late stages of the parent plant LY25; where a is an inflorescence that has not undergone fertility conversion; b is an inflorescence that has partially undergone fertility conversion, with pollen indicated by the red arrows; c is an inflorescence that has completely converted to fertile; and d shows the basic morphology of the anthers and nectaries of sterile and fertile flowers.

[0034] Figure 2 The Δ-SNP index distribution is shown in the mixed pool of sterile and fertile populations in the F2 group; where gray represents the 99% confidence interval threshold line and green represents the 95% confidence interval threshold line.

[0035] Figure 3 This is a Δ-SNP index distribution diagram for chromosome A05; where the dashed line represents... Brvms5 The interval where the site is located.

[0036] Figure 4 and Brvms5 Figure 1 shows the detection results of four InDel-labeled PCR products linked together; where a, b, c, and d are InDel-labeled products, respectively. Brvms5 -5216342、 Brvms5 -6164784、 Brvms5 -6315378、 Brvms5 -6648913, M represents DNA marker, SJ37 is the fertile parent, LY25 is the sterile parent, F1 is the hybrid generation of the two, B1-B9 are sterile plants randomly selected from the F2 population; K1-K9 are fertile plants randomly selected from the F2 population. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0038] Key experimental material sources and physicochemical parameters:

[0039] The Chinese cabbage parent plant LY25 is a heterophyte identified from the commercial variety of Chinese cabbage 'Qiuxiang 828'. Its traits are significantly different from 'Qiuxiang 828'. After two consecutive generations of self-pollination, no agronomic traits segregation occurred, but fertility segregation occurred (fertile:sterile ratio of 3:1). LY25 is the sterile line number in the self-pollination progeny population of this heterophyte.

[0040] The male parent plant of Chinese cabbage, SJ37, is an inbred line purified through three generations of self-pollination from the conventional Chinese cabbage variety "Sijiu Huangye".

[0041] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0042] Example 1

[0043] This embodiment provides a method for obtaining InDel molecular markers closely linked to the ecotype sterility trait in Chinese cabbage, as detailed below:

[0044] 1. Genetic population construction

[0045] Material information:

[0046] Chinese cabbage sterile line LY25: LY25 is a new type of eco-friendly sterile material. When cultivated in autumn, it exhibits male sterility at the initial flowering stage, but undergoes varying degrees of fertility conversion during the mid-to-late growth stages, with 40% of the plants completely transforming into fertile plants. Figure 1 LY25 exhibits bolting in small plants during spring cultivation and is strictly sterile throughout its entire growth period.

[0047] Chinese cabbage inbred line SJ37: SJ37 is an inbred line separated from the conventional Chinese cabbage variety "Sijiu Huangye". It is normal and fertile in both spring and autumn.

[0048] Using LY25 as the female parent and SJ37 as the male parent, F1 generation seeds were obtained; F1 generation seeds were sown, and F1 generation seeds were self-pollinated during the flowering period to obtain F2 generation seeds; F2 generation seeds were sown in autumn, and F2 segregating populations of 500 plants were established.

[0049] 2. Locating the male sterility genetic locus in LY25

[0050] After the F2 segregating population flowered, the fertility characteristics of the flowers were investigated from the initial flowering stage to the end of the flowering stage. 381 plants were fertile at the initial flowering stage, while 119 plants were sterile. Chi-square test showed that the fertility segregation conformed to a 3:1 characteristic, indicating that the sterility characteristic of LY25 is controlled by a recessive nuclear gene. Twenty fully fertile F2 plants throughout their entire growth period were selected, and DNA was extracted from them. The DNA from each plant was mixed in equal amounts to form a fertile pool DNA sample. Similarly, 20 sterile F2 plants at the flowering stage were selected, and DNA was extracted from them. The DNA from each plant was mixed in equal amounts to form a sterile pool DNA sample. DNA was extracted from the parental lines LY25 and SJ37. Next-generation sequencing (NGS) was used to re-sequencing the DNA from LY25, SJ37, and the mixed pool of fertile and sterile individuals at 10X, 10X, 20X, and 20X, respectively. After obtaining whole-genome resequencing data, the Chinese cabbage T2T genome (ChifuV4.0) was used as a reference genome. vcf genotype files were obtained using Samtool, BWA, and GATK software. Then, genetic mapping of sterility loci was performed using QTL-seq to obtain the Δ-SNP index distribution characteristics of the whole genome. Figure 2 The distribution of Δ-SNP indexes showed that multiple Δ-SNP index values ​​exceeding the 99% confidence interval (CI) appeared on chromosome A05. Among these, a series of Δ-SNP index values ​​with small fluctuations and extremely significant (CI>99) appeared consecutively within the 5.1-7.5 Mb interval at the anterior end of chromosome A05, consistent with typical linkage disequilibrium characteristics. Therefore, this interval was initially identified as the linkage interval containing the LY25 ecotype sterility locus. Figure 3 The located infertility site was named Brvms5 .

[0051] 3. Development of InDel-linked molecular markers for ecotype sterility genes

[0052] Based on the VCF genotype files obtained in step 2, the genotypes of InDel (insertion / deletion mutant molecular markers) in the linkage region A05: 5.1-7.5Mb for LY25 and SJ37 were analyzed. The selection criteria for InDel were: 1. Nucleic acid sequence >30bp; 2. Polymorphism in LY25 and SJ37; 3. Both LY25 and SJ37 genotypes were homozygous. Four InDel molecular markers were finally selected, and their details are as follows:

[0053] The first InDel is located at A05:5216342 and is named Brvms5-5216342, LY25 here has the nucleotide sequence: TGAAAGAACATTCTATGCCGCCGTTTTAGCTGCACCTAAGGCTAAGCCCTTCAAAACATA (SEQ ID NO.1), SJ37 here is: T;

[0054] The second InDel is located at A05:6164784 and is named Brvms5 -6164784, LY25 here has the nucleotide sequence: GCCCATAAAATCTAGTCCTTCGCAAATTATCCGGATATGAAGTC (SEQ ID NO.2), SJ37 here is: G;

[0055] The third InDel is located at A05:6315378 and is named Brvms5 -6315378, the nucleotide sequence of LY25 here is: GGTTGGATAATAAAGAACATGATAATTCTGTAAATGATTTTCCAATTACTCATAACGCTTAT (SEQ ID NO.3), and the nucleotide sequence of SJ37 here is: G;

[0056] The fourth InDel is located at A05:6648913 and is named... Brvms5 -6648913, LY25 here has the nucleotide sequence: ATCAATAAGATTATTGTCTTAATTGTTTTTTCTTTG (SEQ ID NO.4), and SJ37 here is: A.

[0057] Example 2

[0058] This embodiment further verifies the linkage of the four InDel molecular markers obtained in Example 1. The specific steps are as follows:

[0059] 1. Primer design

[0060] Primers were designed based on the four InDel molecular markers obtained in Example 1. The specific primer sequences are as follows:

[0061] Amplifying molecular markers Brvms5 The primer sequence for -5216342 is SEQ ID NO.5:

[0062] Brvms5 -5216342-F: TGAGGAGTTCAGAAGACTCAATTTG;

[0063] Brvms5 -5216342-R:GTGTCTGAACTACCTTACTAAAACAAA;

[0064] Amplifying molecular markers Brvms5 The primer sequence for -6164784 is SEQ ID NO.6:

[0065] Brvms5 -6164784-F:AGGAAGCACAACGAAGGTACTAG;

[0066] Brvms5 -6164784-R:TTGGTTCGGTTCGTTTATCGACT;

[0067] Amplifying molecular markers Brvms5 The primer sequence for -6315378 is SEQ ID NO.7:

[0068] Brvms5 -6315378-F:ACCAAAAGCTCTCTATGAAAACA;

[0069] Brvms5 -6315378-R: GGTAAACATATCCTGAATGTGATAACT;

[0070] Amplifying molecular markers Brvms5 The primer sequence for -6648913 is SEQ ID NO.8:

[0071] Brvms5 -6648913-F:AGCTTAGGATCCAAGCAACTTC;

[0072] Brvms5 -6648913-R:AATGCAGAGCAGCAACTTCA.

[0073] 2. PCR amplification and product detection

[0074] Genomic DNA was extracted from the parental lines LY25, SJ37, F1, and nine randomly selected sterile and nine fertile plants from the F2 generation. Using the extracted DNA as templates, PCR amplification was performed using the primers designed in step 1 above. The amplification products were then detected by gel electrophoresis (see results below). Figure 4 ).

[0075] The PCR reaction system was the same for all PCR amplification processes, as follows: total volume 10 μL, including: 5.0 μL of 2X Magicgreen Taq super Mix, 0.4 μL each of forward and reverse primers (10 μM), 2 μL of DNA template (50-200 ng / μL), and 2.2 μL of ddH2O.

[0076] The PCR reaction procedure is basically the same when performing PCR amplification, as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ / 52℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; 72℃ extension for 5 min, and storage at 4℃ for 10 min.

[0077] The primers shown in SEQ ID NO.5 and SEQ ID NO.7 were annealed at 55℃ during amplification; the primers shown in SEQ ID NO.6 and SEQ ID NO.8 were annealed at 52℃ during amplification.

[0078] The gel electrophoresis detection steps are as follows: PCR products are electrophoresed on a 3% agarose gel at 110V for 1 hour, and the results are displayed on the gel imaging system.

[0079] Depend on Figure 4 The results show that there are four InDel markers. Brvms5 -5216342, Brvms5 -6164784, Brvms5 -6315378, Brvms5 -6648913 was completely linked to the sterility locus in the F2 segregating population, which also verified the conclusion in Example 1 that the sterility locus... Brvms5 These four InDel markers are located within a significant region of 5.1-7.5 Mb at the anterior end of chromosome A05. Furthermore, these four InDel markers can also serve as nuclear sterility sites. Brvms5 Linkage markers are used to backcross and convert sterile loci from LY25 during breeding. Brvms5 .

[0080] Through the above investigation, this invention successfully screened four InDel molecular markers closely linked to the ecotype sterility trait in Chinese cabbage, and validated them, providing a basis for their utilization in subsequent Chinese cabbage breeding. Brvms5 It provides a valid chain tag.

[0081] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for detecting ecotype sterility traits in Chinese cabbage using InDel molecular marker primers, characterized in that, There are four InDel molecular markers, as follows: Molecular markers Brvms5 -5216342, nucleotide sequence as shown in SEQ ID NO.1; Molecular markers Brvms5 -6164784, nucleotide sequence as shown in SEQ ID NO.2; Molecular markers Brvms5 -6315378, nucleotide sequence as shown in SEQ ID NO.3; Molecular markers Brvms5 -6648913, nucleotide sequence as shown in SEQ ID NO.4; The primers are as follows: Amplifying molecular markers Brvms5 The primer sequence for -5216342 is shown below: Brvms5 -5216342-F:TGAGGAGTTCAGAAGACTCAATTTG; Brvms5 -5216342-R:GTGTCTGAACTACCTTACTAAAACAAA; Amplifying molecular markers Brvms5 The primer sequence for -6164784 is shown below: Brvms5 -6164784-F:AGGAAGCACAACGAAGGTACTAG; Brvms5 -6164784-R: TTGGTTCGGTTCGTTTATCGACT; Amplifying molecular markers Brvms5 The primer sequence for -6315378 is shown below: Brvms5 -6315378-F:ACCAAAAGCTCTCTATGAAAACA; Brvms5 -6315378-R:GGTAAACATATCCTGAATGTGATAACT; Amplifying molecular markers Brvms5 The primer sequence for -6648913 is shown below: Brvms5-6648913-F:AGCTTAGGATCCAAGCAACTTC; Brvms5-6648913-R:AATGCAGAGCAGCAACTTCA; The method is as follows: S1. Extract genomic DNA from the plant to be tested; S2. Using the DNA from S1 as a template, amplify the DNA using the primers described above. S3. The amplification products in S2 were analyzed by gel electrophoresis, and the results are as follows: Using molecular markers Brvms5 If the primer -5216342 produces a 542bp DNA band, it indicates a sterile plant; if it produces a 483bp DNA band, it indicates a fertile plant. Using molecular markers Brvms5 If the primer -6164784 produces a 359bp DNA band, it indicates a sterile plant; if it produces a 316bp DNA band, it indicates a fertile plant. Using molecular markers Brvms5 If the primer -6315378 produces a 307bp DNA band, it indicates a sterile plant; if it produces a 246bp DNA band, it indicates a fertile plant. Using molecular markers Brvms5 If the primer -6648913 produces a 332bp DNA band, the plant is sterile; if it produces a 297bp DNA band, the plant is fertile.

2. The method according to claim 1, characterized in that, The PCR reaction system was the same for all PCR amplification processes, as follows: total volume 10 μL, including: 5.0 μL of 2X Magic green Taq super Mix, 0.4 μL each of forward and reverse primers (both at 10 μM), 2 μL of DNA template (at a concentration of 50~200 ng / μL), and 2.2 μL of ddH2O.

3. The method according to claim 1, characterized in that, The PCR reaction procedure for PCR amplification is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ / 52℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 5 min, 4℃ storage for 10 min. Among them, molecular markers Brvms5 -5216342, Molecular markers Brvms5 The primers corresponding to -6315378 require an annealing temperature of 55℃ for amplification; molecular markers Brvms5 -6164784, Molecular Marker Brvms5 The primer corresponding to -6648913 requires an annealing temperature of 52℃ for amplification.

4. The method according to claim 1, characterized in that, The gel electrophoresis detection steps are as follows: PCR products are electrophoresed on a 3% agarose gel at 110V for 1 hour, and the results are displayed on the gel imaging system.

5. The application of the method described in claim 1 in the breeding of ecotype sterile traits in Chinese cabbage.

Citation Information

Patent Citations

  • Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof

    CN103981177A

  • Capsicum cytoplasmic male sterility fertility restoration molecular marker, typing primer and use thereof

    WO2024139283A1