Kluyveromyces marxianus engineering bacterium for synthesizing eicosapentaenoic acid and application of kluyveromyces marxianus engineering bacterium

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to kluyveromyces marxianus engineering bacteria for synthesizing eicosapentaenoic acid and application of the kluyveromyces marxianus engineering bacteria. According to the engineering bacterium, pyruvate decarboxylase PDC1 genes, alcohol dehydrogenase ADH1 genes and alcohol dehydrogenase ADH2 genes are sequentially knocked out from a kluyveromyces marxianus FIM1 delta ura3 strain; meanwhile, a citrate lyase ACL gene, a pyruvate oxidase PO gene and a phosphate transacetylase PTA gene are inserted into the loci respectively, so that synthesis of acetyl coenzyme A is enhanced; then a plurality of genes are sequentially inserted into a Kluyveromyces marxianus genome, and then a vector of a delta 8 desaturase delta 8D gene is transferred into the Kluyveromyces marxianus genome. The invention also provides a method for efficiently preparing the EPA, namely the Kluyveromyces marxianus engineering strain is used as a fermentation strain, glucose, a yeast extract, peptone and other components are used as a culture medium, and the yield of the EPA produced by culturing and fermenting reaches 8.71 mg / g of dry cell weight.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to an engineering bacterium of Kluyveromyces marxianus for synthesizing eicosapentaenoic acid (EPA) and an application thereof. Background Art

[0002] In recent years, polyunsaturated fatty acids (PUFA) have been considered as active substances that are beneficial to health (Fereidoon Shahidi et al., Annu Rev Food Sci T, 2018, 9: 345-381), but humans cannot synthesize PUFA from scratch, making it an essential nutrient (Castro et al., Prog Lipid Res, 2016, 62: 25-40). Among them, the derivatives of three ω-3 fatty acids, namely docosahexaenoic acid (DHA, 22: 6), eicosapentaenoic acid (EPA, 20: 5) and α-linolenic acid (ALA, 18: 3), are the most valuable. The intake of EPA and DHA required by the human body mainly depends on marine oily fish, such as salmon, sardines, herring and mackerel (Innes et al., Int J Mol Sci, 2020, 21). However, with the growth of population, human factors such as overfishing of marine fish have led to a year-on-year decrease in the supply of EPA and DHA in marine animals. According to statistics, the available amount of EPA and DHA is expected to have a gap of 1 million tons (Salem et al., Curr Opin Clin Nutr Metab Care, 2015, 18: 147-154).

[0003] For this reason, how to increase the available amount of EPA and DHA has attracted widespread attention, and various strategies have been proposed to increase the production of PUFA. Among them, the most concerned is the use of microorganisms to produce PUFA. One of the main strategies is to synthesize PUFA using natural microorganisms and their mutants. Among natural microorganisms, the most representative is marine microalgae, which are unicellular species including eukaryotic and prokaryotic organisms (Wen et al, Biotechnol Adv, 2003, 21: 273-294). It is the only organism in nature that can efficiently synthesize ω-3 fatty acids from scratch. It contains high lipid levels, and the total lipid content in dry cell weight is between 20% and 70% (Sun et al., Bioresource Technol, 2017, 228: 227-234). At the same time, microalgae can synthesize ω-3 fatty acids from CO2 in a photoautotrophic way, but the demand for light leads to high requirements for the design of photobioreactors, which limits its development (Qin et al., Front Microbiol, 2023, 14).

[0004] Another research direction is to use microorganisms to heterologously express PUFA synthesis genes and construct engineered strains that efficiently synthesize EPA. Usually, in some conventional microorganisms such as Yarrowia lipolytica, Saccharomyces cerevisiae, Escherichia coli, etc., PUFA synthesis pathway genes from different species are introduced to achieve the biosynthesis of EPA or DHA. The biosynthesis of PUFA in nature is divided into two major pathways: aerobic and anaerobic, and synthetic. Aerobic synthesis starts with acetyl-CoA to assemble saturated acyl intermediates, extending to the saturated C16 fatty acid palmitic acid, and then the main chain is modified and extended by alternating action of desaturases and elongases, and finally EPA or DHA is produced (Li-Beisson, et al., Prog Lipid Res, 2019, 74: 31-68). The anaerobic synthesis pathway uses PUFA synthase, an enzyme complex similar to polyketide synthase (PKS). This route involves iterative cycles of condensation, dehydration, and ketone reduction to achieve de novo synthesis of PUFA (Harwood et al., Biomolecules, 2019, 9). In heterologous expression systems, bacterial expression systems, such as Escherichia coli, lactic acid bacteria, and Pseudomonas putida, can produce PUFA, but the output does not exceed the milligram level, and it is considered that they do not have significant advantages in PUFA synthesis. In contrast, fungal expression systems, especially yeast expression systems, have potential (Sofija Jovanovic et al., Curr Opin Biotech, 2021, 69: 199-211).

[0005] As a GRAS organism, Kluyveromyces marxianus has been identified as a food safety strain by the Ministry of Health of my country (Wu et al., J Biotechnol, 2020, 320: 11-16). It has excellent temperature resistance, a wide range of substrate spectrum, and can utilize a variety of carbon sources such as inulin, xylose, and lactose (Fonseca et al., Appl Microbiol Bioechnol, 2008, 79: 339-354), so that it can adapt to the needs of various industrial production. It is also possible to conduct diversified synthetic biology research, and has broad application prospects. To this end, the present invention utilizes the advantages of food safety and fast growth of the strain, and constructs an engineered strain that synthesizes EPA using glucose as a carbon source through metabolic engineering design and synthesis. Compared with the prior art, the synthetic eicosapentaenoic acid EPA Kluyveromyces marxianus engineered bacteria provided by the present invention has the advantages of short fermentation cycle, high yield and low cost. Summary of the invention

[0006] The invention aims to provide a metabolic engineering strain of Kluyveromyces marxianus for synthesizing eicosapentaenoic acid EPA with short fermentation period, high yield and low cost and application thereof.

[0007] The metabolic engineering strain of Kluyveromyces marxianus for efficiently synthesizing eicosapentaenoic acid EPA provided by the present invention is constructed by the following steps:

[0008] (1) Using Crispr gene editing technology, the pyruvate decarboxylase PDC1 gene (Genbank accession number: QGN17490.1) was knocked out in the genome of Kluyveromyces marxianus FIM1Δura3 strain, and the citrate lyase ACL gene from Yarrowia lipolytica was inserted into the PDC1 locus to construct a Kluyveromyces marxianus strain, which was named FIM1Δura3Δpdc1::acl;

[0009] The citrate lyase ACL gene is codon-optimized and has a nucleotide sequence shown in SEQ ID No.1 and an amino acid sequence shown in SEQ ID No.2.

[0010] (2) The alcohol dehydrogenase ADH1 gene (Genbank accession number: QGN15858.1) was knocked out in the Kluyveromyces marxianus strain FIM1Δura3Δpdc1::acl, and the pyruvate oxidase PO gene from Lactobacillus plantarum was inserted into the ADH1 locus to construct the Kluyveromyces marxianus strain, which was named FIM1Δura3Δpdc1::aclΔadh1::po;

[0011] The pyruvate oxidase PO gene has a nucleotide sequence of SEQ ID No.3 and an amino acid sequence shown in SEQ ID No.4.

[0012] (3) The alcohol dehydrogenase ADH2 gene (Genbank accession number: QGN15976.1) was knocked out in the Kluyveromyces marxianus strain FIM1Δura3Δpdc1::aclΔadh1::po, and the phosphotransacetylase PTA gene from Azotobacter vinelandii was inserted into the ADH2 locus to construct a Kluyveromyces marxianus strain, denoted as FIM1Δura3Δpdc1::aclΔadh1::poΔadh2::pta, and the strain was named Kluyveromyces marxianus NE6;

[0013] The phosphotransacetylase PTA gene is codon-optimized and has a nucleotide sequence shown in SEQ ID No.5 and an amino acid sequence shown in SEQ ID No.6.

[0014] (4) The Saccharomyces cerevisiae PDC1 gene promoter Ppdc1 and terminator Tpdc1 were used to construct the Chlamydomonas-derived Δ8-desaturase Δ8D gene expression cassette PDC8D. The Saccharomyces cerevisiae TEF gene promoter Ptef and terminator Ttef were used to construct the Chlamydomonas-derived desaturase Δ5D gene expression cassette TEF5D. The PDC8D expression cassette and the TEF5D expression cassette were concatenated using overlap PCR technology to construct the co-expression desaturase Δ8D gene and desaturase Δ5D gene expression cassette PDC8D-TEF5D. The Δ9 elongase Δ9E gene from Chlamydomonas was constructed using the promoter Pfba and terminator Tfba of the Saccharomyces cerevisiae FBA1 gene, denoted as FBA9E; the Δ17 desaturase Δ17D gene from Rhizopus achromatus was constructed using the promoter Pgpd and terminator Tgpd of the Saccharomyces cerevisiae GPD1 gene, denoted as GPD17D; the FBA9E expression frame and the GPD17D expression frame were connected in series by overlap PCR technology to construct an expression frame for co-expressing the elongase Δ9E gene and the desaturase Δ17D gene, denoted as FBA9E-GPD17D; the Δ9 desaturase Δ9D gene expression frame from Mortierella alpina was constructed using the promoter Ptpi and terminator Ttpi of the Saccharomyces cerevisiae TPI1 gene, denoted as TPI9D.

[0015] The Δ8 desaturase Δ8D gene derived from Chlamydomonas is codon-optimized, and the nucleotide sequence is shown in SEQ ID No.7, and the amino acid sequence is shown in SEQ ID No.8; the Δ5 desaturase Δ5D gene derived from Chlamydomonas is codon-optimized, and the nucleotide sequence is shown in SEQ ID No.9, and the amino acid sequence is shown in SEQ ID No.10; the Δ9 elongase Δ9E gene derived from Chlamydomonas is codon-optimized, and the nucleotide sequence is shown in SEQ ID No.11, and the amino acid sequence is shown in SEQ ID No.12; the Δ17 desaturase Δ17D gene derived from Rhizopus achromatus is codon-optimized, and the nucleotide sequence is shown in SEQ ID No.13, and the amino acid sequence is shown in SEQ ID No.14; the Δ9 desaturase Δ9D gene derived from Mortierella alpina is codon-optimized, and the nucleotide sequence is shown in SEQ ID No.15, and the amino acid sequence is shown in SEQ ID No.16.

[0016] (5) In the Kluyveromyces marxianus strain NE6 described in step (3), the PDC8D-TEF5D tandem expression cassette is inserted into the 101 chromosome interface site downstream of the pyruvate decarboxylase PDC1 gene in the genome by gene editing technology, recorded as NE6101::85, and named as Kluyveromyces marxianus NE6-EPA0.5.

[0017] (6) In the Kluyveromyces marxianus strain NE6-EPA0.5 described in step (5), the FBA9E-GPD17D tandem expression cassette was inserted into the 702 chromosome interface site downstream of the genomic cell wall protein CCW12 gene by gene editing technology, recorded as NE6 101::85 702::917, and named as Kluyveromyces marxianus NE6-EPA1.

[0018] (7) In the Kluyveromyces marxianus strain NE6-EPA1 described in step (6), the TPI9D expression cassette was inserted into the 201 chromosome interface site downstream of the genomic heat shock protein HSP60 gene by gene editing technology, recorded as NE6 101::85702::917 201::9D, and named as Kluyveromyces marxianus NE6-EPA1.5.

[0019] (8) The Δ8 desaturase Δ8D gene from Pavolova salina was inserted into the expression vector pUKDN115 to construct the expression plasmid pUKDN115-Pinu-PsΔ8D-Tinu.

[0020] The Δ8 desaturase Δ8D gene from the salina algae is codon-optimized, and its nucleotide sequence is shown in SEQ ID No.17, and its amino acid sequence is shown in SEQ ID No.18.

[0021] (9) The constructed expression plasmid pUKDN115-Pinu-PsΔ8D-Tinu was transformed into the Kluyveromyces marxianus strain NE6-EPA1.5 described in step (7), and the Kluyveromyces marxianus engineered strain was obtained by screening, recorded as NE6-EPA1.5 / pUKDN115-Pinu-PsΔ8D-Tinu, and named as Kluyveromyces marxianus NE6-EPA2;

[0022] The Kluyveromyces marxianus FIM1Δura3 strain is obtained by knocking out the uracil synthase gene URA3 on the genome of the Kluyveromyces marxianus FIM1 strain (accession number: CGMCC No. 10621) deposited in the China General Microbiological Culture Collection Center.

[0023] The Kluyveromyces marxianus expression vector pUKDN115 described in step (3) contains Kluyveromyces marxianus autonomous replication sequence, inulinase promoter, inulinase terminator and selection marker gene URA3 and other elements.

[0024] In the Kluyveromyces marxianus strain FIM1Δura3, the pyruvate decarboxylase PDC1 gene and the alcohol dehydrogenase ADH1 and ADH2 genes were knocked out, the purpose of which is to block the ethanol metabolism of the cell and prevent glucose from being converted into ethanol.

[0025] While knocking out the above three genes, the citrate lyase ACL gene was inserted into the PDC1 locus, the pyruvate oxidase PO gene was inserted into the ADH1 locus, and the phosphotransacetylase PTA gene was inserted into the ADH2 locus, with the aim of reconstructing the acetyl-CoA synthesis pathway to supply fatty acid synthesis.

[0026] In order to synthesize eicosapentaenoic acid (EPA) in Kluyveromyces marxianus cells, the present invention provides a method for integrating and expressing a Δ8 desaturase Δ8D gene, a Δ5 desaturase Δ5D gene, a Δ9 elongase Δ9E gene, a Δ17 desaturase Δ17D gene, and a Δ9 desaturase Δ9D gene at a genomic chromosome interface, comprising: integrating a tandem expression frame PDC8D-TEF5D of a Δ8D gene and a Δ5D gene at a 101 chromosome interface site downstream of a pyruvate decarboxylase PDC1 gene, integrating a tandem expression frame FBA9E-GPD17D of a Δ9E gene and a Δ17D gene at a 702 chromosome interface site downstream of a cell wall protein CCW12 gene, and integrating a Δ9D gene expression frame TPI9D at a 201 chromosome interface site downstream of a heat shock protein HSP60 gene.

[0027] In order to further improve the synthesis efficiency of EPA, the present invention constructs the Δ8 desaturase Δ8D gene from Pavolova salina on the pUKDN115 vector and then introduces it into Kluyveromyces marxianus to enhance the conversion efficiency of the rate-limiting step.

[0028] The present invention also provides a method for efficiently synthesizing EPA using the above-mentioned Kluyveromyces marxianus metabolic engineering strain NE6-EPA2, specifically, using the Kluyveromyces marxianus metabolic engineering strain as a fermentation strain, using glucose, yeast extract, peptone and other components as a culture medium, and producing EPA through culture and fermentation.

[0029] The specific operation is as follows: the metabolically engineered strain of Kluyveromyces marxianus is inoculated into 50-150 mL of YPD medium, cultured at 30-35°C and 200-300 rpm for 24-48 h, inoculated into a fermenter of YPD medium at a 5-10% inoculum amount, 50-70% glucose is fed as a carbon source, 5-10% ammonia water is fed to maintain the pH at 5.0-6.0, and continuous fed-batch fermentation is carried out. Under the conditions of continuous fed-batch fermentation, the strain is fermented at a high density for 48-72 h to obtain an EPA yield of 8.71 mg / g cell dry weight.

[0030] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0031] (1) The engineered strain provided by the present invention is constructed by introducing the EPA synthesis pathway into the food safety strain Kluyveromyces marxianus. It is also the first time that EPA synthesis is achieved in Kluyveromyces marxianus, and is suitable for the production of food EPA.

[0032] (2) The EPA-synthesizing Kluyveromyces marxianus engineered strain of the present invention can ferment glucose to synthesize EPA, with a fermentation cycle of only 48 hours, an EPA content of 8.71 mg / g cell dry weight, and a yield of 958.1 mg / L fermentation liquid. The EPA yield of the oil-producing fungus Mortierella alpina provided by invention patent CN 105296368 A is 588.5 mg / L.

[0033] (3) The existing technologies all use non-food safety strains to produce EPA. Invention patent CN 105296368 A provides an EPA-producing Yarrowia lipolytica strain, while invention patent CN117604046A provides an alpine Mortierella strain that overexpresses the Δ-6 desaturase gene MpFADS6 in Microcystis, and increases EPA production by adding 1% peony seed oil or 50g / peony seed meal juice. Compared with the existing technology, the engineered strain of Kluyveromyces marxianus provided by the present invention has a simple fermentation process, a short cycle, and high safety, and can be applied in the fields of food and medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Metabolic modification roadmap of engineered bacteria for synthesizing EPA in Kluyveromyces marxianus.

[0035] Figure 2 Schematic diagram of the integration of EPA biosynthesis pathway genes at the chromosome interface of Kluyveromyces marxianus.

[0036] Figure 3 Fatty acid composition of Kluyveromyces marxianus strain NE6-EPA1.

[0037] Figure 4 Fatty acid composition of Kluyveromyces marxianus strain NE6-EPA1.5.

[0038] Figure 5 Schematic diagram of the Δ8 desaturase expression plasmid from Pavolova algae.

[0039] Figure 6 Fatty acid composition of Kluyveromyces marxianus strain NE6-EPA2. DETAILED DESCRIPTION

[0040] Example 1, Construction of Kluyveromyces marxianus FIM1Δura3Δpdc1::aclΔadh1::poΔadh2::pta strain

[0041] The biosynthesis of EPA is based on the fatty acid synthesis pathway, where carbon chain extension and desaturation are performed. Acetyl-CoA is converted to malonyl-CoA by acetyl-CoA carboxylase. Malonyl-CoA and acetyl-CoA are combined with palmitic acid (C16:0) or stearic acid (C18:0) under the catalysis of fatty acid synthase. Afterwards, stearic acid (C18:0) is converted to EPA (C20:5) under the action of desaturase and elongase. Acetyl-CoA in yeast cells is mainly converted from pyruvate. In order to prevent the diversion of pyruvate by ethanol metabolism, the synthesis of cytoplasmic acetyl-CoA is also strengthened. Therefore, the present invention utilizes CRISPR Cas9 gene editing technology to sequentially knock out the pyruvate decarboxylase PDC1 gene, alcohol dehydrogenase ADH1, and ADH2 genes of the Kluyveromyces marxianus FIM1Δura3 strain, and simultaneously insert the citrate lyase ACL gene derived from Yarrowia lipolytica into the PDC1 locus, the pyruvate oxidase PO gene derived from Lactobacillus plantarum into the ADH1 locus, and the phosphotransacetylase PTA gene derived from Azotobacter vinelandii into the ADH2 locus.

[0042] To knock out the PDC1 gene and insert the ACL gene, the gRNA primers PDCg-F (tcagcaatgtctgaaattactct) and PDCg-R (aacagagtaatttcagacattgc) were synthesized, the gRNA targeted the PDC1 cds region -3-17bp position, and the gRNA plasmid and donor sequence were constructed, wherein the donor sequence consisted of 500bp upstream of the PDC1 gene cds, ACLcds, and 500bp downstream of the PDC1 gene cds, a total of 2953bp. At the same time, the gRNA plasmid and donor sequence were simultaneously transformed into the FIM1Δura3 strain, and clones with successful knockout of the PDC1 gene and insertion of the ACL gene were obtained by uracil deficiency plate screening and PCR verification, and then the strains that lost the gRNA plasmid were screened on 5-fluoroorotic acid plates to obtain the strain FIM1Δura3Δpdc1::acl.

[0043] Based on the strain FIM1Δura3Δpdc1::acl, the alcohol dehydrogenase ADH1 gene was further knocked out, and the pyruvate oxidase PO gene from Lactobacillus plantarum was inserted into the ADH1 locus. The gRNA primers ADH1g-F (tcacgacaattctaccaatgatt) and ADH1g-R (accaatcattggtagaattgtcg) were synthesized. The gRNA targeted the 1008-1027bp position of the ADH1 cds region, and the gRNA plasmid and donor sequence were constructed. The donor sequence consisted of 500bp upstream of the ADH1 gene cds, PO cds, and 500bp downstream of the ADH1 gene cds, totaling 2812bp. The gRNA plasmid and donor sequence were simultaneously transformed into the FIM1Δura3Δpdc1::acl strain. The clones with successful ADH1 gene knockout and PO gene insertion were obtained through uracil-deficient plate screening and PCR verification. The strains that lost the gRNA plasmid were then screened on 5-fluoroorotic acid plates to obtain the strain FIM1Δura3Δpdc1::aclΔadh1::po.

[0044] Based on the strain FIM1Δura3Δpdc1::aclΔadh1::po, the alcohol dehydrogenase ADH2 gene was further knocked out, and the pyruvate oxidase PTA gene from brown nitrogen-fixing bacteria was inserted into the ADH2 locus. The gRNA primers ADH2g-F (tcacggtggtcaattgtactaca) and ADH2g-R (acctgtagtacaattgaccaccg) were synthesized. The gRNA targeted the 45-65bp position of the ADH2 cds region, and the gRNA plasmid and donor sequence were constructed. The donor sequence consisted of 3139bp of the upstream 500bp of the ADH2 gene cds, the PTA cds, and the downstream 500bp of the ADH2 gene cds. At the same time, the gRNA plasmid and donor sequence were simultaneously transformed into the FIM1Δura3Δpdc1::aclΔadh1::po strain. The clones with successful ADH2 gene knockout and PTA gene insertion were obtained through uracil-deficient plate screening and PCR verification. The strains that lost the gRNA plasmid were then screened on 5-fluoroorotic acid plates to obtain the strain FIM1Δura3Δpdc1::aclΔadh1::poΔadh2::pta, which was named Kluyveromyces marxianus NE6.

[0045] Example 2, Optimization of the EPA synthesis pathway in Kluyveromyces marxianus

[0046] Kluyveromyces marxianus naturally has a pathway to synthesize linoleic acid (C18:2) and linolenic acid (C18:3) from acetyl-CoA, but to synthesize the 20-carbon fatty acid EPA, it needs to use acetyl-coenzyme (CoA) and linoleic acid (C18:2) or linolenic acid (C18:3) as substrates under the action of Δ9 elongase (9E), and elongate to 11,14-eicosadienoic acid (EDA) and 11,14,17-eicosatrienoic acid (ETrA), respectively. Further, EDA and ETrA are dehydrogenated and desaturated to 8,11,14-eicosatrienoic acid (DGLA) and eicosatetraenoic acid (ETA) under the action of Δ8 desaturase (8D). Subsequently, Δ5 desaturase (5D) can dehydrogenate and desaturate DGLA and ETA to arachidonic acid (ARA) and eicosapentaenoic acid EPA, respectively. In addition, studies have shown that the introduction of Δ17 desaturase (17D) can catalyze the desaturation of EDA to ETrA, the desaturation of DGLA to ETA, and the desaturation of ARA to EPA.

[0047] In order to construct an efficient EPA synthesis pathway in Kluyveromyces marxianus, four genes including elongase 9E and desaturase 8D, 5D and 17D are codon optimized and synthesized without changing the amino acid sequence. In order to reduce the influence of Kluyveromyces marxianus on the regulation of these gene expression, the present invention adopts the promoter and terminator of heterologous saccharomyces cerevisiae to mediate the translation initiation and termination of these four genes. Firstly, the PDC1 gene promoter Ppdc1 and terminator Tpdc1 are amplified from the genome of saccharomyces cerevisiae S288 strain, and the Ppdc1 promoter fragment, 8D gene fragment and terminator Tpdc1 fragment are fused by Overlap PCR technology to construct the 8D gene expression frame PDC8D. Similarly, the amplified TEF1 gene promoter Ptef fragment and terminator Ttef fragment were fused with the 5D gene by overlap PCR technology to obtain the expression cassette TEF5D; the FBA1 gene promoter Pfba fragment, terminator Tfba fragment, and 9E gene were fused to obtain the expression cassette FBA9E; the GPD1 gene promoter Pgpd fragment, terminator Tgpd fragment, and 17D gene were fused to obtain the expression cassette GPD17D. In order to integrate the four gene expression cassettes into the genome, we concatenated the gene expression cassettes in the association step, and concatenated the PDC8D gene expression cassette and the TEF5D gene expression cassette by overlap PCR technology to obtain the 8D and 5D double gene expression cassette PDC8D-TEF5D; the FBA9E gene expression cassette and the GPD17D gene expression cassette were concatenated to obtain the 9E and 17D double gene expression cassette FBA9E-GPD17D.

[0048] Example 3: Construction of Kluyveromyces marxianus NE6-EPA1 and detection of fatty acid composition

[0049] Using CRISPR Cas9 gene editing technology, the tandem expression frames PDC8D-TEF5D and FBA9E-GPD17D were sequentially integrated into the chromosome of Kluyveromyces marxianus NE6 strain for expression. To integrate the tandem expression cassette PDC8D-TEF5D, gRNA primers 101g-F (tcattgggggaattataagcgta) and 101g-R (acctacgcttataattcccccaa) were synthesized, and the gRNA targeted the 273-292bp position downstream of the PDC1 cds (chromosome interface 101 site), and the gRNA and donor sequences were constructed, wherein the donor sequence consisted of a 5731bp sequence consisting of 500bp upstream of the targeting region, the PDC8D-TEF5D tandem expression cassette, and 500bp downstream of the targeting region. The gRNA plasmid and donor sequence were simultaneously transformed into the NE6 strain, and clones with the PDC8D-TEF5D tandem expression cassette successfully inserted at the 101 site were obtained by uracil-deficient plate screening and PCR verification. The strain that lost the gRNA plasmid after 5-fluoroorotic acid plate screening was recorded as NE6 101::85 and named Kluyveromyces marxianus NE6-EPA0.5 ( Figure 2 ).

[0050] Based on strain NE6-EPA0.5, the FBA9E-GPD17D tandem expression cassette was further integrated at the chromosome interface 702 site. To this end, gRNA primers 702g-F (tcagatgagcgaaacgaaacgta) and 702g-R (acctacgtttcgtttcgctcatc) were synthesized, and the gRNA targeted the 601-620bp position downstream of CCW12 cds (chromosome interface 702 site). The gRNA and donor sequences were constructed, wherein the donor sequence consisted of a 5086bp sequence consisting of 500bp upstream of the targeting region, the FBA9E-GPD17D tandem expression cassette and 500bp downstream of the targeting region. The gRNA plasmid and donor sequence were simultaneously transformed into the NE6-EPA0.5 strain, and the clone with the FBA9E-GPD17D tandem expression cassette successfully inserted at the 702 site was obtained by uracil-deficient plate screening and PCR verification. The strain that lost the gRNA plasmid after 5-fluoroorotic acid plate screening was recorded as NE6101::85 702::917 and named Kluyveromyces marxianus NE6-EPA1.

[0051] Kluyveromyces marxianus NE6-EPA1 was inoculated into YPD liquid medium and cultured at 30°C and 220rpm for 72h before detecting the fatty acid composition of the cells. The specific detection method is as follows: Centrifuge the fermented bacterial solution at 3000rpm for 3min and discard the supernatant. Weigh 50mg of cell pellet and add 100μL of saline to resuspend evenly. Take 50μL of cell suspension, add 75μL of methanol solution, 100μL of methyl tert-butyl ether solution, 25μL of 36% phosphoric acid solution, and vortex for 3min. Soak the centrifuge tube in liquid nitrogen for 2min, take it out and thaw it on ice for 5min, vortex for 3min, and repeat twice. Centrifuge at 4°C and 12000rpm for 5min. Take 200μL of the supernatant and blow it dry on the nitrogen blower, and add 200μL of 15% boron trifluoride methanol solution. ) Vortex for 3min and place it in a 60°C oven for 30min. After cooling to room temperature, accurately add 500 μL of n-hexane solution and 200 μL of saturated sodium chloride solution, vortex for 3 min, centrifuge at 4°C and 12000 rpm for 5 min, and then remove 200 μL of the n-hexane layer solution for GC-MS / MS detection and analysis.

[0052] The conditions of GC-MS / MS are as follows: injection volume 1 μL, carrier gas helium, chromatographic column DB-5MS (30m x0.25mm x 0.25μm), flow rate 1mL / min, column temperature 50℃ for 1.5min, then increased to 170℃ at 30℃ / min, then increased to 200℃ at 15℃ / min, then increased to 220℃ at 5℃ / min, kept at 220℃ for 2min, then increased to 228℃ at 8℃ / min, then increased to 240℃ at 20℃ / min, kept at 240℃ for 2min, then increased to 265℃ at 25℃ / min, kept at 265℃ for 2min, then increased to 280℃ at 30℃ / min, kept at 280℃ for 2min. The transfer line temperature was 280℃, the ion source temperature was 230℃, the quadrupole temperature was 150℃, and the ionization voltage was 70eV.

[0053] The results showed that although the strain had the ability to naturally synthesize linolenic acid, its ability to desaturate stearic acid (C18:0) to form oleic acid (C18:1) was weak ( Figure 3 ). In addition, it was found that after the introduction of elongase 9D into Kluyveromyces marxianus, the carbon chain of stearic acid (C18:0) was desaturated to form oleic acid (C18:1) and extended to produce twenty-carbon fatty acids, and then under the action of fatty acid desaturase 17D, eicosadienoic acid EDA and eicosatrienoic acid ETrA were produced, with the yields reaching 115 mg / g and 96.0 mg / g respectively.

[0054] Example 4, Optimization of the EPA synthesis pathway in Kluyveromyces marxianus

[0055] The EPA synthesis pathway was further optimized by overexpressing a Δ9 desaturase (9D) through chromosome integration to enhance downstream synthesis capacity. Codon optimization and synthesis were performed without changing the amino acid sequence. The promoter Ptpi and terminator Ttpi of the TPI1 gene were amplified from Saccharomyces cerevisiae. The 9D gene expression cassette was obtained by fusing Ptpi, 9D, and Tpdc1 using overlap PCR technology, and was recorded as TPI9D. Based on the strain NE6-EPA1, the TPI9D expression cassette was further integrated. The gRNA primers 201g-F (tcagaaaaacagtagtggaagga) and 201g-R (acctccttccactactgtttttc) were synthesized, and the gRNA targeted the position 358-377bp downstream of the HSP60 cds (chromosome interface 201 site). The gRNA and donor sequences were constructed, wherein the donor sequence consisted of a 3657bp sequence consisting of 500bp upstream of the targeting region, the TPI9D expression frame, and 500bp downstream of the targeting region. The gRNA plasmid and the donor sequence were simultaneously transformed into the NE6-EPA1 strain, and the clone with the TPI9D expression frame inserted at the 201 site was successfully obtained by uracil-deficient plate screening and PCR verification ( Figure 2 ), and then the strain that lost the gRNA plasmid after 5-fluoroorotic acid plate screening was recorded as NE6 101::85 702::917 201:9D and named Kluyveromyces marxianus NE6-EPA1.5.

[0056] Then, the EPA production capacity of Kluyveromyces marxianus strain NE6-EPA1.5 was analyzed ( Figure 4 ), the results showed that EDA and ETrA accumulated in large quantities in the strain. Compared with Kluyveromyces marxianus NE6-EPA1, the yields of eicosadienoic acid EDA and eicosatrienoic acid ETrA increased to 170.3 mg / g and 109.3 mg / g, respectively. However, EDA and ETrA did not continue to be desaturated to generate EPA. Therefore, it is believed that Δ8D is another rate-limiting step in the synthesis of EPA.

[0057] Example 5: Continuous fed-batch fermentation of Kluyveromyces marxianus NE6-EPA2 to produce EPA

[0058] Based on the above results, the present invention continues to express an additional Δ8 desaturase (Ps8D) from Salina salina in the Kluyveromyces marxianus NE6-EPA1.5 strain, and performs codon optimization and synthesis without changing the amino acid sequence. Ps8D was obtained by PCR amplification and inserted into the Kluyveromyces marxianus expression vector pUKDN115 for expression, obtaining the plasmid pUKDN115-Pinu-Ps8D-Tinu ( Figure 5The constructed plasmid pUKDN115-Pinu-Ps8D-Tinu was transformed into Kluyveromyces marxianus chassis cells NE6-EPA1.5 to obtain Kluyveromyces marxianus NE6-EPA1.5 / pUKDN115-Pinu-Ps8D-Tinu, which was named Kluyveromyces marxianus NE6-EPA2.

[0059] The metabolic engineering strain of Kluyveromyces marxianus was streaked on a YPD plate and activated overnight at 30°C. 3-5 single clones were picked and inoculated into 50 mL of YPD medium, cultured at 30°C and 220 rpm for 24 h, and 10% of the seed was inoculated into a fermenter with YPD medium, 50% glucose was fed as a carbon source, and 5% ammonia was fed to maintain the pH at 5.5, and continuous fed-batch fermentation was performed. Under the continuous fed-batch fermentation conditions, the strain was fermented at a high density for 48 h, and an EPA yield of 8.71 mg / g cell dry weight ( Figure 6 ).

Claims

1. A metabolically engineered strain of Kluyveromyces marxianus for efficiently synthesizing eicosapentaenoic acid, characterized in that: It is constructed by the following steps: (1) Using Crispr gene editing technology, the pyruvate decarboxylase PDC1 gene was knocked out in the genome of the Kluyveromyces marxianus strain FIM1Δura3, and the citrate lyase ACL gene from Yarrowia lipolytica was inserted into the PDC1 locus to construct a Kluyveromyces marxianus strain, which was named FIM1Δura3Δpdc1::acl; (2) The alcohol dehydrogenase ADH1 gene was knocked out in the Kluyveromyces marxianus strain FIM1Δura3Δpdc1::acl and the pyruvate oxidase PO gene from Lactobacillus plantarum was inserted into the ADH1 locus to construct a Kluyveromyces marxianus strain, which was denoted as FIM1Δura3Δpdc1::aclΔadh1::po; (3) The alcohol dehydrogenase ADH2 gene was knocked out in the Kluyveromyces marxianus strain FIM1Δura3Δpdc1::aclΔadh1::po and the phosphotransacetylase PTA gene from vine nitrogen-fixing bacteria was inserted into the ADH2 locus to construct a Kluyveromyces marxianus strain, which was named FIM1Δura3Δpdc1::aclΔadh1::poΔadh2::pta and was named Kluyveromyces marxianus NE6; (4) Using the PDC1 promoter Ppdc1 and the terminator Tpdc1, the Δ8 desaturase Δ8D gene expression cassette from Chlamydomonas was constructed, denoted as PDC8D; using the TEF1 promoter Ptef and the terminator Ttef, the Δ5 desaturase Δ5D gene expression cassette from Chlamydomonas was constructed, denoted as TEF5D; and the PDC8D expression cassette and the TEF5D expression cassette were connected in series by the overlap PCR technique, denoted as PDC8D-TEF5D; using the FBA1 promoter Pfba and the terminator Tfba, the Δ9 elongase Δ9E gene from Chlamydomonas was constructed, denoted as FBA9E; using the GPD1 promoter Pgpd and the terminator Tgpd, the Δ17 desaturase Δ17D gene from Rhizopus achromatus was constructed, denoted as GPD17D; and using the overlap PCR technique, the FBA9E expression cassette and the GPD17D expression cassette were connected in series by the overlap PCR technique, denoted as FBA9E-GPD17D; The promoter Ptpi and terminator Ttpi of TPI1 were used to construct the Δ9 desaturase Δ9D gene expression cassette from Mortierella alpina, denoted as TPI9D. (5) inserting the PDC8D-TEF5D tandem expression cassette into the 101 chromosome interface site downstream of the pyruvate decarboxylase PDC1 gene in the Kluyveromyces marxianus strain NE6 described in step (3) by gene editing technology, denoted as NE6101::85, and named Kluyveromyces marxianus NE6-EPA0.5; (6) In step (5), the FBA9E-GPD17D tandem expression cassette was inserted into the 702 chromosome interface site downstream of the genomic cell wall protein CCW12 gene in the Kluyveromyces marxianus strain NE6-EPA0.5 by gene editing technology, recorded as NE6 101::85 702::917, and named as Kluyveromyces marxianus NE6-EPA1; (7) inserting the TPI9D expression cassette into the 201 chromosome interface site downstream of the heat shock protein HSP60 gene in the Kluyveromyces marxianus strain NE6-EPA1 described in step (6) by gene editing technology, denoted as NE6 101::85702::917 201::9D, and named Kluyveromyces marxianus NE6-EPA1.5; (8) The Δ8 desaturase Δ8D gene from Pavolova salina was inserted into the expression vector pUKDN115 to construct an expression plasmid named pUKDN115-Pinu-PsΔ8D-Tinu; (9) The constructed expression plasmid pUKDN115-Pinu-PsΔ8D-Tinu was transformed into the Kluyveromyces marxianus strain NE6-EPA1.5 described in step (7), and the Kluyveromyces marxianus engineered strain was obtained by screening, recorded as NE6-EPA1.5 / pUKDN115-Pinu-PsΔ8D-Tinu, and named as Kluyveromyces marxianus NE6-EPA2; in: The Kluyveromyces marxianus expression vector pUKDN115 contains a Kluyveromyces marxianus autonomous replication sequence, an inulinase promoter, an inulinase terminator and a selection marker gene URA3 element; The Kluyveromyces marxianus FIM1Δura3 strain is obtained by knocking out the uracil synthase gene URA3 on the genome of the Kluyveromyces marxianus FIM1 strain (accession number: CGMCC No.10621) preserved in the China General Microbiological Culture Collection Center; The pyruvate decarboxylase PDC1 gene, Genbank accession number: QGN17490.1; the alcohol dehydrogenase ADH1 gene, Genbank accession number: QGN15858.1; the alcohol dehydrogenase ADH2 gene, Genbank accession number: QGN15976.1; After codon optimization, the citric acid lyase ACL gene from Yarrowia lipolytica has a nucleotide sequence as shown in SEQ ID No. 1 and an amino acid sequence as shown in SEQ ID No. 2; The pyruvate oxidase PO gene derived from Lactobacillus plantarum has a nucleotide sequence as shown in SEQ ID No.3 and an amino acid sequence as shown in SEQ ID No.4; After codon optimization, the phosphotransacetylase PTA gene derived from the green nitrogen-fixing bacteria has a nucleotide sequence as shown in SEQ ID No.5, and an amino acid sequence as shown in SEQ ID No.6; After codon optimization, the Δ8 desaturase Δ8D gene from Chlamydomonas has a nucleotide sequence as shown in SEQ ID No.7 and an amino acid sequence as shown in SEQ ID No.8; After codon optimization, the Δ5 desaturase Δ5D gene from Chlamydomonas has a nucleotide sequence as shown in SEQ ID No.9 and an amino acid sequence as shown in SEQ ID No.10; After codon optimization, the Δ9 elongase Δ9E gene from Chlamydomonas has a nucleotide sequence as shown in SEQ ID No.11 and an amino acid sequence as shown in SEQ ID No.12; After codon optimization, the Δ17 desaturase Δ17D gene from Rhizopus achromatus has a nucleotide sequence as shown in SEQ ID No. 13 and an amino acid sequence as shown in SEQ ID No. 14; After codon optimization, the Δ9 desaturase Δ9D gene from Mortierella alpina has a nucleotide sequence as shown in SEQ ID No. 15 and an amino acid sequence as shown in SEQ ID No. 16; After codon optimization, the Δ8 desaturase Δ8D gene from Pavolova salina has a nucleotide sequence as shown in SEQ ID No.17 and an amino acid sequence as shown in SEQ ID No.

18.

2. A method for synthesizing EPA using the metabolically engineered strain of Kluyveromyces marxianus according to claim 1, characterized in that: The metabolically engineered strain of Kluyveromyces marxianus was used as a fermentation strain, and glucose, yeast extract and peptone components were used as a culture medium to produce EPA through culture and fermentation.

3. The method for synthesizing EPA according to claim 2, characterized in that: The specific operation is as follows: the metabolically engineered strain of Kluyveromyces marxianus is inoculated into 50-150 mL of YPD medium, cultured at 30-35° C. and 200-300 rpm for 24-48 h, inoculated into a fermenter of YPD medium at a 5-10% inoculum amount, 50-70% glucose is fed as a carbon source, 5-10% ammonia water is fed to maintain the pH at 5.0-6.0, and continuous fed-batch fermentation is carried out. Under the conditions of continuous fed-batch fermentation, the strain is fermented at a high density for 48-72 h to obtain an EPA yield of 8.71 mg / g cell dry weight.

Images