Mycobacterium tuberculosis fusion protein LS2R as well as construction method and application thereof

Abstract

The invention discloses a mycobacterium tuberculosis fusion protein LS2R as well as a construction method and application thereof, and belongs to the technical field of biomedicine. The mycobacterium tuberculosis fusion protein LS2R is successfully constructed by selecting four antigen proteins Rv2029c, Rv2131c, Rv2309c and Rv0867 from an active period antigen, an incubation period antigen and a recovery period antigen of M.tb and splicing genes by utilizing restriction enzyme cutting sites. The fusion protein can stimulate peripheral blood of M.tb infected people to generate high-level IFN-gamma, and the level of the IFN-gamma is higher than the corresponding level of each subcomponent protein. The fusion protein is mixed with a DG adjuvant to prepare an LS2R + DG multi-fusion subunit vaccine, and a mouse experiment proves that the vaccine not only can induce Th1 type immune response required for resisting M.tb infection, but also proves that the LS2R + DG multi-fusion subunit vaccine has stronger immune response potential in a primary immune enhancement strategy as an enhanced vaccine initially.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a Mycobacterium tuberculosis fusion protein LS2R and a construction method and application thereof. Background Art

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (M.tb). It is the leading cause of death from a single infectious pathogen worldwide and remains a serious public health problem. Nearly 10 million people are infected with M.tb each year, and about 6,000 people die every day.

[0003] The most widely used vaccine in the fight against TB is Bacillus Calmette-Guérin (BCG). BCG is the only live attenuated vaccine widely used in clinical TB prevention. After vaccination, it can make the body resistant to M.tb, especially to severe TB in infants and young children and extrapulmonary TB. Since 1921, the coverage of BCG vaccination has been increasing worldwide. Billions of doses have been given worldwide so far, proving that it can effectively prevent primary TB, with good prevention effect, high safety performance, and easy use. Although BCG vaccine is the most widely used TB vaccine, its protective effect in adults is not ideal and the duration of protection is limited, usually 10 to 15 years. The possible reasons are as follows: (1) BCG preferentially induces short-term T effector memory (TEM) responses; (2) The complex interaction between BCG, host and environment determines the nature of anti-M.tb immunity, such as host genotype, nutritional and metabolic status, environmental factors, smoking, microbiota and co-infection, virulence and adaptability of prevalent M.tb strains may affect BCG immunity; (3) Widespread exposure to nontuberculous mycobacteria (NTM) in the environment may explain the variable and short-lived protective effect of BCG in some TB-endemic areas. Because NTM shares a wide range of antigenic repertoires with BCG and M.tb and induces phenotypically similar T cell responses, NTM sensitization leads to a reduction in BCG-induced immune responses. In addition, as a live vaccine, BCG is generally not considered a good booster, and WHO does not recommend repeated vaccination. Among the TB vaccines currently under development, there are still other BCG vaccines modified from BCG vaccines: such as BCG-Denmark and BCG-Russia. Experiments have shown that these vaccines have good preventive effects in animals, but there are more adverse reactions, such as local dermatitis and lymphadenopathy. These vaccines can prevent various types of TB, but more clinical trials are needed to confirm their effectiveness and safety.

[0004] TB vaccine candidates currently in clinical trials can be divided into two major categories: mycobacterial whole cell-derived vaccines and subunit vaccines, which target a limited number of selected antigens. The former are whole cell vaccines derived from M.tb, BCG, or closely related NTM strains, which can be further subdivided into live vaccines attenuated by genetic modification (such as VPM 1002, MTBVAC), or from inactivated or isolated whole mycobacteria such as Mycobacterium vaccae (M.vaccae), M.indicus pranii (MIP), DAR-901, and RUTI. The use of whole cell-derived vaccines is an attractive vaccine strategy for two reasons: on the one hand, the effectiveness of BCG, i.e., a live attenuated whole cell vaccine that mimics BCG, provides a solid proof of concept; on the other hand, whole cell-derived vaccines contain many different antigenic components, such as non-protein antigens such as lipids and glycolipids commonly present in the outer layer of the M.tb cell wall, microbial metabolites, and phosphoantigens, and therefore have the potential to stimulate a more diverse immune response. However, the limitations of this type of vaccine are that it is difficult to repeatedly administer and cannot induce strong, lasting and safe immune responses and protection. Difficult preparation, high feasibility costs and critical stability are also its disadvantages.

[0005] The second type of subunit vaccine can be further divided into adjuvanted protein subunit vaccines and recombinant viral vector vaccines. First, recombinant viral vector vaccines (including three candidate vaccines in clinical trials, namely TB / Flu04L, Ad5Ag85A and ChAdOx185A / MVA85A) are believed to have an important M.tb antigen delivery system in generating protective immune responses against TB, thereby triggering a strong and lasting immune response and eliminating the need for exogenous adjuvants. However, the design of viral vectors and the attendant safety are particularly challenging, such as HIV-infected people may also be infected with non-pathogenic viral vectors to cause disease. In addition, repeated vaccination with viral vector vaccines may lead to premature immune-based destruction of the vector, thereby preventing the expression of antigens and rendering the vaccine ineffective. Secondly, subunit adjuvanted protein vaccines have good safety, low cost and easy standardization, and are particularly suitable for the immune strategy of heterologous BCG priming-subunit vaccine boosting immunity, which can release strong, stable, efficient and lasting immune response levels and protection. Compared to whole-cell vaccines, subunit vaccines target a small number of selected antigens, usually six or fewer. Therefore, the main challenges in developing protein subunit vaccines are the need to identify the optimal antigens to include in such vaccines, in addition to the determination of the adjuvant components and adjuvant forms in the adjuvant system, and the evaluation of their compatibility effects. Summary of the invention

[0006] In view of the above problems, the present invention aims to provide a Mycobacterium tuberculosis fusion protein LS2R and a construction method and application thereof. A multi-stage fusion protein LS2R prokaryotic expression vector based on four M.tb subcomponent antigens is constructed by using a restriction endonuclease digestion and ligation method.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A Mycobacterium tuberculosis fusion protein LS2R comprises subcomponent proteins Rv2029c, Rv2131c, Rv2309c and Rv0867.

[0009] Furthermore, the gene sequence of the fusion protein LS2R is shown in SEQ ID NO:1.

[0010] Furthermore, the present invention also includes a method for constructing the Mycobacterium tuberculosis fusion protein LS2R, characterized in that it includes the following steps:

[0011] S1: H37Rv whole genome DNA extraction;

[0012] S2: Design primer sequences for the fusion protein LS2R and its subcomponent protein genes;

[0013] S3: PCR amplification and horizontal gel electrophoresis of Rv2029c, Rv2131c, Rv2309c, Rv0867, and LS2R;

[0014] S4: Rv2029c, Rv2131c, Rv2309c, Rv0867 and LS2R were double-digested with restriction endonucleases, and the digestion products were purified;

[0015] S5: Rv2029c, Rv2131c, Rv2309c, Rv0867 and LS2R were connected with the empty vector plasmid pET30B / pET28a to construct the corresponding recombinant plasmids, and IPTG was used to successfully induce the expression of the fusion protein LS2R and its subcomponent proteins;

[0016] S6: Induce purification and remove endotoxin from the fusion protein LS2R and its subcomponent proteins.

[0017] Furthermore, the primer sequence of the fusion protein LS2R gene in step S2 is shown in SEQ ID NO:6.

[0018] Furthermore, the present invention also includes a subunit vaccine comprising the Mycobacterium tuberculosis fusion protein LS2R as described above.

[0019] Furthermore, the subunit vaccine is a LS2R+DG multi-fusion subunit vaccine, wherein DG is an adjuvant.

[0020] Furthermore, the DG adjuvant is prepared by mixing a DDA adjuvant with a graphene oxide adjuvant.

[0021] Furthermore, the present invention also includes a pharmaceutical composition for preventing tuberculosis, comprising BCG and the subunit vaccine as described above.

[0022] Furthermore, the present invention also includes a tuberculosis serum detection kit, comprising the Mycobacterium tuberculosis fusion protein LS2R as described above, wherein the Mycobacterium tuberculosis fusion protein LS2R is used as a diagnostic marker antigen protein in the kit.

[0023] Furthermore, the present invention also includes a product for promoting or activating the production of Mycobacterium tuberculosis antigen-specific IFN-γ, wherein the active ingredient of the product is the Mycobacterium tuberculosis fusion protein LS2R as described above.

[0024] The beneficial effects of the present invention are:

[0025] 1. The present invention selects four antigen proteins Rv2029c, Rv2131c, Rv2309c and Rv0867 from M.tb active phase antigens, latent phase antigens and resuscitation phase antigens, splices genes using restriction enzyme cutting sites, and successfully constructs the Mycobacterium tuberculosis fusion protein LS2R. The SDS-PAGE and WB results show that they are consistent with expectations; and the fusion protein LS2R can stimulate the peripheral blood of people infected with Mycobacterium tuberculosis M.tb to produce high levels of IFN-γ, which is higher than the corresponding levels of each subcomponent protein.

[0026] 2. The Mycobacterium tuberculosis fusion protein LS2R constructed in the present invention was mixed with the DG adjuvant to prepare a new subunit vaccine LS2R+DG, which can induce sufficient titer of IgG antibodies after immunization of mice. The ratio of IgG2a:IgG1 of the experimental group mice was greater than 1. The spleen cells of the mice in the prime-boost group could secrete the highest level of Th1 cytokines after stimulation with the fusion protein, which was significantly higher than that in the BCG group and the single adjuvant group, and the PBS group was the lowest. This shows that the vaccine can not only induce the Th1 immune response required for anti-M.tb infection, but also confirms that it has a stronger immune response potential as a booster vaccine in the prime-boost strategy. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the construction mode of the fusion protein recombinant plasmid LS2R in Example 1 of the present invention.

[0028] Figure 2The SDS-PAGE identification results of the fusion protein LS2R and its subcomponent proteins in Example 1 of the present invention are shown.

[0029] Figure 3 This is the Western blotting identification result of the fusion protein LS2R and its subcomponent proteins in Example 1 of the present invention.

[0030] Figure 4 The results of WBIA detection of antigen-specific IFN-γ secretion levels after peripheral blood stimulation in different populations in Example 1 of the present invention.

[0031] Figure 5 This is the timeline of mouse immunization in Example 2 of the present invention.

[0032] Figure 6 These are the test results of IgG, IgG1, and IgG2a levels in each group of mice after immunization in Example 2 of the present invention.

[0033] Figure 7 These are the test results of the secretion levels of various cytokines in the culture supernatant of mouse spleen cells in Example 2 of the present invention.

[0034] Figure 8 The FCM analysis of IFN-γ in each group of mice after immunization in Example 2 of the present invention + Single positive CD4 + T lymphocytes, TNF-α + Single positive CD4 + T lymphocytes, IL-2 + Single positive CD4 + T lymphocytes, IFN-γ + TNF-α + Double positive CD4 + T lymphocytes, IFN-γ + IL-2 + Double positive CD4 + T lymphocytes and TNF-α + IL-2 + Double Yang CD4 + The number of T lymphocyte subsets.

[0035] Fig. 9 IFN-γ in Example 2 of the present invention + Single positive CD8 + T lymphocytes, TNF-α + Single positive CD8 + T lymphocytes, IL-2 + Single positive CD8 + T lymphocytes, TNF-α + IFN-γ + Sanyang CD4 +T lymphocytes, IL-2 + IFN-γ + Sanyang CD4 + T lymphocytes and IL-2 + TNF-α + Sanyang CD4 + The number of T lymphocyte subsets.

[0036] Fig.10 The numbers of different types of T cells in each group of mice in Example 2 of the present invention. DETAILED DESCRIPTION

[0037] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0038] Embodiment 1:

[0039] Example 1 provides a method for constructing a Mycobacterium tuberculosis fusion protein. A multi-stage fusion protein LS2R prokaryotic expression vector based on four M.tb subcomponent antigens was constructed by using a restriction endonuclease digestion and ligation method. After recombinant expression in an Escherichia coli vector, it was purified and identified. At the same time, M.tb infected people were recruited in Huainan Cancer Hospital, and peripheral blood T cells of the population were stimulated with LS2R and its subcomponents. The IFN-γ levels induced in different antigens and different populations and their differences were detected, thereby verifying the immunogenicity of the fusion protein LS2R and its subcomponent antigens, which specifically includes the following contents:

[0040] 1.1 Experimental Materials

[0041] 1.1.1 Main tool enzymes

[0042] Restriction endonucleases NdeⅠ, BamHI, HindⅢ, XhoⅠ, and T4 DNA Ligase were purchased from ThermoScientific, USA, and stored at -20°C. The strains and plasmids are shown in Table 1.

[0043] Table 1 Main strains and plasmids

[0044]

[0045] 1.1.2 Related reagent information

[0046] The relevant reagent information is shown in Table 2 below.

[0047] Table 2 Relevant reagent information

[0048]

[0049] 1.1.3 Main instruments

[0050] The main instrument information is shown in Table 3.

[0051] Table 3 Main instruments

[0052]

[0053] 1.1.4 Preparation of culture medium

[0054] 1.1.4.1 Preparation method of solid culture medium:

[0055] Prepare the basic culture medium: Add appropriate amounts of peptone, glucose, agar, phosphate and other ingredients to distilled water, boil to dissolve, and then cool naturally to below about 50°C. Add the required nutrients: According to the needs of different strains, select appropriate nutrients, such as chromosomes, sodium chloride, magnesium sulfate, etc., add to the basic culture medium and dissolve evenly. Adjust the pH value: Use a pH meter to measure the pH value of the culture medium and adjust it as needed. Sterilization: Divide the culture medium into culture dishes and sterilize them with a high-temperature and high-pressure sterilizer.

[0056] 1.1.4.2 Preparation method of liquid culture medium:

[0057] Prepare the basal culture medium: Add appropriate amounts of peptone, glucose, agar, phosphate and other ingredients to distilled water, boil to dissolve, and then cool naturally to below about 50°C. Add the required nutrients: According to the needs of different strains, select appropriate nutrients, such as chromosomes, sodium chloride, magnesium sulfate, etc., add to the basal culture medium and dissolve evenly. Adjust the pH value: Use a pH meter to measure the pH value of the culture medium and adjust it as needed. Sterilization: Divide the culture medium into culture bottles and sterilize them with a high-temperature and high-pressure sterilizer.

[0058] Note: In liquid culture media, oxygen-containing culture bottles need to be used and stirred at appropriate temperature and conditions to ensure the uniformity of the culture medium and the supply of oxygen.

[0059] 1.1.5 Preparation of relevant solutions

[0060] 1.1.5.1 Preparation of TAE buffer solution:

[0061] Prepare 1M Tris base solution: add 121g Tris base to distilled water, adjust pH to 8.0 with sodium hydroxide or hydrochloric acid, and adjust volume to 1L with distilled water. Prepare 0.5M EDTA disodium salt solution: add 186.1g EDTA disodium salt to distilled water (add in 4 times), adjust pH to 8.0 with sodium hydroxide or hydrochloric acid, and adjust volume to 1L with distilled water. Note: EDTA disodium salt should be stirred and dissolved in distilled water before adjusting pH. Prepare 0.5M acetic acid solution: add 57.1g acetic acid to distilled water, adjust pH to 8.0 with sodium hydroxide or hydrochloric acid, and adjust volume to 1L with distilled water. Mix 1M Tris base, 0.5M EDTA disodium salt and 0.5M acetic acid in a ratio of 1:0.4:0.1, and adjust volume to 1L with distilled water to make TAE buffer. The pH can be adjusted to 8.0 as needed.

[0062] Note: TAE buffer should be stored at room temperature and should not be exposed to sunlight or contact with metal. TAE buffer is also not suitable for electrophoretic separation of DNA fragments. If electrophoretic separation of DNA fragments is required, TBE buffer can be used.

[0063] 1.1.5.2 IPTG inducer

[0064] Weigh IPTG powder: Weigh the corresponding IPTG powder according to the required concentration and volume, usually 0.1-1mM. Add distilled water: Add IPTG powder to distilled water and stir thoroughly with a magnetic stirrer to dissolve. Heat can be used to accelerate the dissolution process. Adjust pH value: Use pH test paper or pH meter to test the pH value of the solution, which is usually around 7.0. If necessary, use hydrochloric acid or sodium hydroxide to adjust the pH value. Filter sterilization: Filter and sterilize the IPTG solution and store it in a refrigerator at -20°C for later use.

[0065] 1.1.5.3 Preparation of antibiotic solution

[0066] Preparation of Kanamycin:

[0067] Prepare kanamycin powder: Weigh the required amount of kanamycin powder. Add solvent: Add kanamycin powder to an appropriate amount of solvent, usually an organic solvent such as petroleum ether or isopropanol. Stir and dissolve: Use a magnetic stirrer to stir thoroughly so that the kanamycin powder is fully dissolved in the solvent. Filter sterilize: Filter and sterilize the kanamycin solution and store it in a refrigerator at 4°C for later use.

[0068] Preparation of Ampicillin:

[0069] Prepare ampicillin powder: Weigh the required amount of ampicillin powder. Add solvent: Add ampicillin powder to an appropriate amount of solvent, usually physiological saline, glucose injection, etc. Stir and dissolve: Use a magnetic stirrer to stir thoroughly to fully dissolve the ampicillin powder in the solvent. Filter sterilize: Filter sterilize the ampicillin solution and store it in a refrigerator at 4°C for later use.

[0070] 1.1.5.4 Glycerol gel loading buffer

[0071] Prepare 1×TAE buffer: Mix 1M Tris base, 0.5M EDTA disodium salt and 0.5M acetic acid in a ratio of 1:0.4:0.1, and adjust the volume to 1L with distilled water to obtain 1×TAE buffer. Add glycerol: Add an appropriate amount of glycerol to 1×TAE buffer, usually 5-10% (volume ratio), and mix thoroughly with a magnetic stirrer. Adjust the pH value: Use pH test paper or pH meter to detect the pH value of the buffer, which is usually around 8.0. If necessary, use hydrochloric acid or sodium hydroxide to adjust the pH value. Filter sterilize: Filter sterilize the glycerol gel loading buffer and store it at room temperature for later use.

[0072] PBS solution

[0073] Add NaCl: Add 8.0g NaCl to distilled water and stir thoroughly with a magnetic stirrer to dissolve. Add KCl: Add 0.2g KCl to the solution and stir thoroughly with a magnetic stirrer to dissolve. 2 HPO 4 : Add 1.44 g Na to the solution 2 HPO 4 , stir thoroughly with a magnetic stirrer to dissolve. Add KH 2 PO 4 : Add 0.24 g KH 2 PO 4 , stir thoroughly with a magnetic stirrer to dissolve. Adjust pH: Use pH test paper or pH meter to test the pH of the solution, usually around 7.4. If necessary, use hydrochloric acid or sodium hydroxide to adjust the pH. Adjust volume with distilled water: Adjust the solution to 1L, adjust the volume with distilled water, and stir evenly. Filter sterilization: Filter sterilize the PBS buffer and store it in a refrigerator at 4°C for later use.

[0074] 1.1.5.5 Binding buffer

[0075] Prepare buffer: Select appropriate buffer, such as Tris-HCl buffer, PBS buffer, etc., according to the type of affinity chromatography column used and the properties of the protein. Add required additives: Add required additives, such as NaH 2 PO4 , NaCl, Imidazole, 8M urea, etc., and mix thoroughly with a magnetic stirrer. Adjust pH: Use pH test paper or pH meter to test the pH of the buffer, which is usually between 7.0 and 9.0. If necessary, adjust the pH with hydrochloric acid or sodium hydroxide. Filter sterilization: Filter sterilize the binding buffer and store it in a refrigerator at 4°C for later use.

[0076] 1.1.5.6 Elution buffer

[0077] Prepare buffer: Select appropriate buffer, such as Tris-HCl buffer, PBS buffer, etc., according to the type of affinity chromatography column used and the properties of the protein. Add required additives: Usually, it is necessary to add high concentrations of salts, pH adjusters and eluents, such as NaCl, Tris-HCl, EDTA, imidazole, 8M urea, etc. Adjust pH: Use pH test paper or pH meter to detect the pH of the buffer, which is usually between 7.0 and 9.0. If necessary, use hydrochloric acid or sodium hydroxide to adjust the pH. Filter sterilization: Filter the elution buffer.

[0078] 1.1.5.7 SDS-PAGE protein loading buffer

[0079] Add Tris-HCl buffer: Add 2 mL of 10% SDS buffer to 50 mL of Tris-HCl buffer and mix thoroughly with a magnetic stirrer. Add β-mercaptoethanol: Add 50 μL of β-mercaptoethanol to the above mixture and mix thoroughly with a magnetic stirrer. Add glycerol: Add 4 mL of 30% glycerol to the above mixture and mix thoroughly with a magnetic stirrer. Adjust the pH value: Use pH test paper or pH meter to check the pH value of the buffer, which is usually around 6.8. If necessary, use hydrochloric acid or sodium hydroxide to adjust the pH value. Adjust the volume with distilled water: Adjust the mixture to 100 mL, adjust the volume with distilled water, and stir well.

[0080] Note: β-mercaptoethanol in SDS-PAGE protein loading buffer is toxic to the human body and should be avoided from contact with skin and mucous membranes. Wear gloves when using. In addition, the protein sample should be fully mixed with SDS-PAGE protein loading buffer before loading and boiled at 100°C for 5 minutes to completely denature the protein and evenly distribute it in the gel.

[0081] 1.1.5.8 Preparation of Coomassie Brilliant Blue Staining Solution

[0082] Add methanol: Add 50 mL of methanol to a 250 mL beaker and heat to about 70°C. Add glacial acetic acid: Add 10 mL of glacial acetic acid to the methanol and stir thoroughly with a glass rod. Add Coomassie Brilliant Blue: Add 1.025 g of Coomassie Brilliant Blue to the methanol and stir thoroughly with a glass rod until the Coomassie Brilliant Blue is completely dissolved. Add distilled water: Adjust the volume to 250 mL with distilled water and mix thoroughly. Add acetic acid: Add 10 mL of acetic acid to the mixture and mix thoroughly.

[0083] Note: Coomassie Brilliant Blue dye is irritating to the skin and mucous membranes. Avoid contact with the skin and mucous membranes and wear gloves when using it. In addition, the dye should be fully stirred and the gel should be pre-heated before staining to fully expose the protein and stain evenly.

[0084] 1.2 Experimental methods

[0085] 1.2.1 Extraction of H37Rv whole genome DNA

[0086] Cultivate bacteria: Inoculate the H37Rv strain into a liquid culture medium containing 7H9 medium and 10% OADC, and culture at 37°C until the bacterial solution becomes turbid. Harvest bacteria: Centrifuge the culture solution and harvest the bacterial cells. Cell disruption: Add the bacterial cells to 10 mL of solution (containing 20 mM Tris-HCl pH 8.0, 20 mM EDTA, 0.5% SDS) and incubate at 65°C for 1 hour. Protease treatment: Add RNase A and Proteinase K (final concentrations of 100 μg / mL and 200 μg / mL, respectively) and incubate at 37°C for 2 hours. Column chromatography: Add the sample to the lysis buffer, extract the DNA by the phenol / chloroform method, and purify the DNA using column chromatography. Purify and store DNA: Dissolve the DNA in sterile water, purify it by ethanol precipitation or a commercial DNA purification kit, and store it in a refrigerator at -20°C for use.

[0087] 1.2.2 Primer sequences for fusion genes and subcomponent genes

[0088] The primer sequences of LS2R and its subcomponent protein genes are shown in Table 4 below.

[0089] Table 4 Primer sequences of LS2R and its subcomponent protein genes

[0090]

[0091] 1.2.3 Target fragment PCR reaction conditions

[0092] Reaction system: Adjust according to factors such as the size of the DNA fragment to be amplified and the concentration of primers. The general PCR reaction system includes: 2×PCR Mix (containing Taq DNA polymerase, dNTPs, buffer, MgCl 2 ), DNA template, primers. PCR program: adjusted according to the characteristics and length of the primers. The general PCR program is: pre-denaturation (94°C, 3min), denaturation (94°C, 30s), annealing (adjusted according to the Tm value of the primer, 30s-1min), extension (72°C, adjusted according to the length of the DNA fragment to be amplified, 1min / kb), and final extension (72°C, 10min). PCR reaction conditions: adjusted according to the reaction system and PCR program. The general PCR reaction conditions are: the total volume of the reactants in the reaction system is 20-50μL, the reaction tube is made of PP tube, the reaction tube is sealed, and it is protected from light and vibration during the reaction.

[0093] 1.2.4 Horizontal gel electrophoresis

[0094] Prepare gel: Heat agarose, buffer and water until completely dissolved, add DNA dye (such as Bromophenol Blue) after cooling, stir evenly and pour into the gel mold, wait for solidification. Preparation of electrophoresis buffer: Select appropriate electrophoresis buffer according to experimental needs, such as TAE buffer, TBE buffer, etc., and prepare electrophoresis buffer according to the concentration in the instructions. Add sample: Add the DNA or RNA sample to be tested to the pre-opened gel well, and add an appropriate amount of DNA dye (such as Bromophenol Blue) for observation. Perform electrophoresis: Soak the gel in electrophoresis buffer, then connect the power supply, set the appropriate voltage and time, and allow DNA or RNA to migrate in the gel. Generally, the voltage is 100-150V and the time is 30-60min. Staining: After the electrophoresis is completed, take out the gel and stain it with a stain (such as Ethidium Bromide). The DNA band pattern can be observed by ultraviolet irradiation.

[0095] 1.2.5 Double restriction digestion of target gene and empty vector

[0096] Selection of restriction endonucleases: According to the gene sequence to be detected, select the appropriate enzyme at the relevant restriction site, such as EcoRⅠ, BamHⅠ, etc. Preparation of double enzyme digestion reaction system: Calculate the concentration of each component in the reaction system according to the concentration of the reactants. Common double enzyme digestion reaction systems include: DNA sample, buffer, and enzyme. Double enzyme digestion reaction: Heat the prepared reaction system to an appropriate temperature, add double enzyme, and stop the reaction after a certain reaction time. Gel electrophoresis: The reaction product is subjected to agarose gel electrophoresis. The size of the DNA fragments generated by the double enzyme digestion can be used to determine whether the cutting is successful.

[0097] 1.2.6 Purification of enzyme digestion products

[0098] Follow the purification kit.

[0099] 1.2.7 Ligation of target gene and empty vector plasmid

[0100] Use T4 ligase to perform ligation at a molar ratio of empty vector to target gene of about 1:3-1:10, and incubate at 16°C overnight.

[0101] 1.2.8 Preparation of competent cells

[0102] Take out a piece of frozen DH5α strain, inoculate it into LB medium containing appropriate antibiotics, culture it overnight, transfer the bacterial solution into new LB medium containing appropriate antibiotics and continue to culture it until the bacterial solution becomes turbid, centrifuge the bacterial solution to remove the medium, and use a medium containing appropriate concentration of CaCl 2 The cells were washed with LB medium containing appropriate antibiotics and then resuspended.

[0103] 1.2.9 Cloning vector E. coli DH5α transformation and plasmid extraction

[0104] Escherichia coli DH5α strain was cultured in LB medium with equal bacterial counts of OD 600 The value reaches 0.4-0.6. The linearized plasmid DNA is added to the DH5α strain and the DNA is transformed into the DH5α strain by heat shock method. After transformation, the culture is recovered in LB medium, and the recovery time is generally 1-2 hours. The culture medium containing the antibiotics for selecting resistance genes is screened to screen out the colonies containing the target clones. The plasmid extraction method is based on the plasmid mini-extraction kit.

[0105] 1.2.10 Bacterial liquid PCR and double enzyme digestion verification

[0106] The bacterial solution PCR conditions and system are the same as above PCR.

[0107] 1.2.11 Expression vector E. coli BL21 (DE3) transformation

[0108] The transformation steps of the expression vector E. coli BL21 (DE3) are similar to the transformation steps of the cloning vector E. coli DH5α mentioned above.

[0109] 1.2.12 Induced purification of fusion proteins and subcomponent proteins

[0110] The bacterial solution containing the recombinant vector plasmid of the successfully constructed subcomponent and fusion protein was cultured overnight, and the expression was induced with IPTG at a final concentration of 1mmol / L after shaking for 2 hours on the second day. After 4 hours, the bacteria were collected by low-speed centrifugation to avoid cell damage. The expressed cells were broken up using an ultrasonic cell disruptor to release the protein. The supernatant was collected by centrifugation, and the binding buffer was used to specifically bind to the Ni-NTA 6FF agarose gel column for 2 hours, and then the target protein was eluted with the elution buffer.

[0111] 1.2.13 Protein expression and SDS-PAGE verification

[0112] According to the molecular weight range of the protein to be separated, select the SDS-PAGE gel of appropriate concentration, use the gel making kit to make the gel, and load the sample after the gel solidifies. The sample protein must be boiled at 100°C for 20 minutes before loading to ensure protein denaturation. Perform electrophoresis at 90V, 60mA, 60min, use the Coomassie blue staining method, stain the separated protein on the gel for 30min at room temperature, and then use high methanol and low methanol solutions to alternately decolorize for 16h. After decolorization, use a gel imager to save and mark the image.

[0113] 1.2.14 Western blot verification of proteins

[0114] The gel preparation method is the same as the electrophoresis conditions in the previous step. After the electrophoresis, the separated proteins are transferred to the polyacrylamide gel membrane (NC membrane), and the electrotransfer is performed at 90V, 150mA, and 120min under ice bath conditions. After the transfer, the membrane is blocked and the membrane is soaked in TBST buffer containing 5% non-fat milk powder or 3% BSA, and reacted at room temperature for 1 hour. The target protein on the membrane is labeled with a specific primary antibody. The primary antibody is added to the TBST buffer containing 1% non-fat milk powder or 1% BSA, and the reaction is carried out overnight at room temperature on a shaker. The NC membrane is repeatedly rinsed with PBST, and the primary antibody on the membrane is incubated with a fluorescently labeled or HRP-labeled secondary antibody to detect the binding of the primary antibody to the protein on the membrane. Subsequently, the binding signal is converted into a fluorescent signal or a chemiluminescent signal using methods such as ECL color developer, BCIP / NBT color developer, etc. Finally, a gel imager is used for image observation, marking, and preservation.

[0115] 1.2.15 Protein dialysis

[0116] The pore size of the semipermeable membrane is determined according to the molecular weight, charge, hydrophilicity and other properties of the protein to be separated. The dialysate is prepared using urea. The selected semipermeable membrane is cut into pieces of appropriate size and then sealed with a dialysis bag sealer. The protein mixture to be separated is added to the dialysis bag and the dialysis bag is suspended in the dialysis buffer to allow the dialysis bag to fully contact with the dialysis buffer.

[0117] 1.2.16 Endotoxin Removal

[0118] According to the endotoxin removal kit, the endotoxin concentration was <0.1EU / L.

[0119] 1.2.17 Protein quantification (BCA method)

[0120] Prepare the sample to be tested, which can be a purified protein solution or a protein mixture in a complex system. Mix the sample and reagent according to the ratio in the kit instructions and mix them thoroughly. Incubate the reagent mixture at the specified temperature (37°C) and time (30min) to promote the reaction. Use the absorbance of the microplate reader colorimeter to record the corresponding value. According to the standard curve provided by the kit, compare the measured absorbance or fluorescence intensity value with the absorbance or fluorescence intensity value on the standard curve to determine the protein concentration in the sample.

[0121] 1.2.18WBIA detection of antigen-specific IFN-γ levels in peripheral blood of the population

[0122] The laboratory department of Huainan Oriental Cancer Hospital was commissioned to recruit volunteers for the project. All volunteers signed informed consent forms. All volunteers met the following conditions after basic physical examinations: 1. Aged between 18 and 55 years old, 2. No tuberculosis vaccine or other similar vaccines except BCG, 3. No history of allergies or other serious allergic reactions. A total of 45 recruits, including 13 active tuberculosis patients, 12 latent tuberculosis infection patients, and 20 healthy volunteers. Among them, tuberculosis infected people (active tuberculosis patients and latent tuberculosis infection patients) met the following conditions after physical examinations and questionnaires: 1. Use tuberculin for intradermal injection and observe the reaction at the injection site to determine whether it is infected with tuberculosis. 2. Blood test to detect tuberculosis antibodies in the blood to determine whether it is infected with M.tb. 3. X-ray examination: observe the image of the lungs to determine whether there are TB lesions. 5-10 ml of peripheral blood from the above volunteers was collected using anticoagulant tubes. The blood of each patient was divided into PBS group, PHA group, rEC group, and experimental protein group (LS2R), and 500 μL of blood was added to each well of a 24-well plate and incubated at 37°C for 24 hours. Serum was collected by centrifugation, and the IFN-γ level in each well was detected using an ELISA kit according to the procedure.

[0123] 1.2.19 Statistical analysis

[0124] This experiment involved the detection of IFN-γ in the MFCIA population. An independent sample t-test was used in the detection, and the results were analyzed with the help of SPSS software (version 22.0). α=0.05, P<0.05, indicating that the results were statistically significant.

[0125] 1.3 Results

[0126] 1.3.1 Successful construction of fusion protein recombinant plasmid LS2R (construction model diagram)

[0127] The four different genes of M.tb were ligated to the prokaryotic expression vector pET-30b by PCR, restriction endonuclease digestion and T4 ligase ligation, as shown in the attached Figure 1 Shown is a schematic diagram of the construction of the fusion plasmid.

[0128] 1.3.2 SDS-PAGE identification of fusion protein and its subcomponent proteins

[0129] The fusion gene LS2R was successfully constructed by molecular cloning methods such as restriction endonuclease digestion and ligase ligation. After BL21 transformation, the fusion protein LS2R was induced to express, which was purified and identified by SDS-PAGE. The results are shown in the attached figure. Figure 2 As shown in the figure, the molecular weights of rRv2029c, rRv2131c, rRv2309c, rRv0867c and LS2R are 14.5 kDa, 29.3 kDa, 20.2 kDa, 41.5 kDa and 105.5 kDa, respectively. It can be seen that the fusion protein LS2R and its subcomponent proteins were successfully expressed, and their molecular weights were in line with expectations. (In the attached Figure 2 In the figure, M: protein molecular weight standard; 1: recombinant plasmid without induction; 2: recombinant plasmid induced by IPTG for 4 h; 3: ultrasonic fragmentation product; 4: affinity column chromatography effluent; 5: affinity chromatography 8 mol / L urea binding solution eluate; 6-9: eluted protein).

[0130] 1.3.3 Western Blot Identification of Fusion Protein and Subcomponent Protein

[0131] The His primary antibody and LS2R immunized mouse serum were used as primary antibodies. The results of Western blotting are shown in the attached figure. Figure 3 As shown in the attached Figure 3 In the figure, A is the identification result of anti-LS2R mouse serum, B is the identification result of anti-His monoclonal antibody, 1 is LS2R, 2 is rRv2131c, 3 is rRv2029c, 4 is rRv0867c, 5 is rRv2309c, from the attached Figure 3It can be seen that whether using His primary antibody or LS2R immunized mouse serum as the primary antibody, the fusion protein and each subcomponent protein can be specifically recognized.

[0132] 1.3.4 Fusion protein LS2R and its subcomponent proteins can stimulate the production of high levels of IFN-γ

[0133] After stimulating peripheral blood of different groups with PHA, rEC, and experimental protein, the secretion level of antigen-specific IFN-γ was detected. The results are shown in the attached figure. Figure 4 As shown in the attached Figure 4 It can be seen that PHA, rEC and experimental protein can stimulate the secretion of sufficient IFN-γ in peripheral blood, but the amount of stimulation in each group is different. When PHA is used as a stimulator, it can stimulate the peripheral blood of different populations to produce high levels of IFN-γ; when rEC, a laboratory diagnostic marker commonly used in clinical practice, is used as a stimulator, it can stimulate a higher level of IFN-γ. When stimulated by experimental protein, the IFN-γ stimulated in whole blood is higher but slightly inferior to rEC. The IFN-γ level stimulated by the healthy population group is the lowest. However, the differences within the groups are statistically significant, P<0.01.

[0134] In summary, the present invention successfully constructed a fusion protein LS2R, which includes antigens Rv2029c, Rv2131c, Rv2309c and Rv0867 (RpfD) that are actively expressed at different stages of M.tb infection. Among them, Rv2131c is a secretory antigen, which can be used as an immune antigen and diagnostic marker, and is mainly involved in the process of M.tb adhesion and invasion of host cells; in addition, Rv2131c can also induce the body to produce cytotoxic T cells and humoral immune responses, thereby improving the body's immune defense against M.tb. Rv2029c is a latent antigen that participates in the cell wall synthesis and cell wall structure maintenance of M.tb. The protein encoded by Rv2309 is an antigen protein of M.tb, which can be used as an immune antigen, participate in the growth and metabolism of M.tb, and may play a role in the growth, metabolism, infection and immune escape of M.tb. RpfD is a target antigen with potential in both TB diagnosis and vaccination. Therefore, these proteins were combined, connected through restriction enzyme sites and constructed into fusion protein LS2R to ensure its spatial structure integrity and active biological function.

[0135] Moreover, WBIA was used in the present invention to detect the levels of IFN-γ secreted by peripheral blood of different populations stimulated by the four subcomponent proteins and the fusion protein LS2R, and it was found that all target proteins induced higher levels of IFN-γ, which were significantly higher in the ATB group than in the LTBI and HCs groups, confirming that LS2R and its subcomponent proteins have strong immunogenicity. In addition, the level of IFN-γ induced by LS2R in Chinese M.tb infected persons was significantly higher than the corresponding levels of the subcomponents, reflecting the leap in immunogenicity brought about by the fusion infection of multi-stage antigens, achieving a synergistic effect of 1+1>1. The WBIA experimental results show that the fusion protein LS2R constructed by the present invention has great potential to stimulate the body to produce a Th1 type cellular immune response, laying a solid research foundation for evaluating its strong immunogenicity and protection in animals.

[0136] The gene sequence of the fusion protein LS2R in the present invention is shown below.

[0137] ATGACGGAGCCAGCGGCGTGGGACGAAGGCAAGCCGCGAATCATCACTTTGACCATGAACCCCGCCTTGGACATCACGACGAGCGTCGACGTGGTGCGCCCGACCGAGAAAATGCGTTGTGGCGCACCTCGCTACGATCCCGGCGGCGGCGGTATCAATGTCGCCCGCATTGTGCATGTCCTCGGCGGTTGCTCGACAGCACTGTTCCCGGCCGGCGGGTCGACCGGGAGCCTGCTGATGGCGCTGCTCGGTGATGCGGGAGTGCCATTTCGCGTCATTCCGATCGCGGCCTCGACGCGGGAGAGCTTCACGGTCAACGAGTCCAGGACCGCCAAGCAGTATCGTTTCGTGCTTCCGGGGCCGTCGCTGACCGTCGCGGAGCAGGAGCAATGCCTCGACGAACTGCGCGGTGCGGCGGCTTCGGCCGCCTTTGTGGTGGCCAGTGGCAGCCTGCCGCCAGGTGTGGCTGCCGACTACTATCAGCGGGTTGCCGACATCTGCCGCCGATCGAGCACTCCGCTGATCCTGGATACATCTGGTGGCGGGTTGCAGCACATTTCGTCCGGGGTGTTTCTTCTCAAGGCGAGCGTGCGGGAACTGCGCGAGTGCGTCGGATCCGAACTGCTGACCGAGCCCGAACAACTGGCCGCCGCACACGAACTCATTGACCGTGGGCGCGCCGAGGTCGTGGTGGTCTCGCTTGGATCTCAGGGCGCGCTATTGGCCACACGACATGCGAGCCATCGATTTTCGTCGATTCCGATGACCGCGGTTAGCGGTGTCGGCGCCGGCGACGCGATGGTGGCCGC

[0138] GATTACCGTGGGCCTCAGCCGTGGCTGGTCGCTCATCAAGTCCGTTCGCTTGGGA

[0139] AACGCGGCAGGTGCAGCCATGCTGCTGACGCCAGGCACCGCGGCCTGCAATCGC

[0140] GACGATGTGGAGAGGTTCTTCGAGCTGGCGGCCGAACCCACCGAAGTCGGGCA

[0141] GGATCAATACGTTTGGCACCCGATCGTTAACCCGGAAGCCTCGCCAGTGAGCCCT

[0142] GCCGCACCTGATCTGACGGACGACCTGACTGACGCCGAGCTGGCCGCCGACCTG

[0143] GCGGCGGACGCGGGAAAGCTGTTGCTCCAGGTGCGTGCGGAGATCGGTTTCGAT

[0144] CAGCCATGGACGCTCGGGGAAGCCGGTGACCGCCAGGCTAACTCGCTGCTGTTG

[0145] CGACGGCTGCAGGCCGAACGGCCGGGTGACGCAGTGCTCAGTGAGGAGGCCCA

[0146] CGACGATCTGGCCCGGCTGAAATCCGATCGGGTGTGGATTATTGACCCGTTGGAT

[0147] GGCACCCGCGAGTTCTCCACACCGGGTCGCGACGACTGGGCGGTACACATTGCG

[0148] CTGTGGCGGCGTTCCTCCAATGGCCAGCCCGAGATCACCGACGCCGCGGTGGCG

[0149] TTGCCGGCCCGTGGCAACGTGGTGTACCGCACCGATACGGTGACTTCCGGCGCC

[0150] GCGCCGGCCGGCGTTCCTGGCACCTTGCGGATTGCCGTCAGCGCCACCCGGCCA

[0151] CCGGCAGTCCTGCACCGCATCCGCCAGACGCTGGCGATCCAACCGGTGTCGATC

[0152] GGTTCGGCGGGCGCCAAAGCGATGGCCGTCATTGACGGCTACGTCGACGCCTAC

[0153] CTGCACGCCGGAGGCCAATGGGAGTGGGATTCCGCGGCGCCGGCTGGGGTGATG

[0154] TTGGCCGCCGGCATGCACGCGTCACGACTCGATGGCTCGCCGCTGCGATACAACC

[0155] AACTGGACCCCTACCTGCCGGATCTGCTGATGTGTCGAGCCGAGGTGGCGCCGAT

[0156] CCTGCTCGGTGCCATCGCCGACGCGTGGCGCACCGGCGCCGGGATTGTCGAGAC

[0157] GACGACCAACCGGGTGCGTCACGTGCCTGTCCCCGAGCCGGTATCGGAGCGCCT

[0158] GCGTGATGAACTGCCAACCGAGCCCAATGCCCTCGTGTTCCCAAGCTACCGCGG

[0159] CGGGCACCTACCTATCGAGGAGTACCGCAGAGCCTTCGACAAGGGATGCAAGGC

[0160] GGTTGGCATTGCCGACCTGGTCCCGCACGGGCTGAGGCACACCACGGCGTCGCT

[0161] GGCGATCAGTGCGGGCGCTAATGTCAAAGTCGTGCAGAGGCTTCTCGGACACGC

[0162] CACAGCGGCCATGACCTTGGACCGCCATGGCCACCTGCTCAGCGACGACCTGGC

[0163] GGGCGTGGCAGGTTTGCTTGTGCAGGCCATCAAGAGTGCTGCGGCATCACTGCG

[0164] GTATTCCGACCCTGATTCAGTCGCGGTGGAGAACATATCTGCAGCTAGTAGTGGA

[0165] CGCCACCGTAAGCCCACCACATCCAACGTCAGCGTCGCCAAGATCGCCTTTACCG

[0166] GCGCAGTACTCGGTGGCGGCGGCATCGCCATGGCCGCTCAGGCGACCGCGGCCA

[0167] CCGACGGGGAATGGGATCAGGTGGCCCGCTGCGAGTCGGGCGGCAACTGGTCGA

[0168] TCAACACCGGCAACGGTTACCTCGGTGGCTTGCAGTTCACTCAAAGCACCTGGG

[0169] CCGCACATGGTGGCGGCGAGTTCGCCCCGTCGGCTCAGCTGGCCAGCCGGGAGC

[0170] AGCAGATTGCCGTCGGTGAGCGGGTGCTGGCCACCCAGGGTCGCGGCGCCTGGC

[0171] CGGTGTGCGGCCGCGGGTTATCGAACGCAACACCCCGCGAAGTGCTTCCCGCTT

[0172] CGGCAGCGATGGACGCTCCGTTGGACGCGGCCGCGGTCAACGGCGAACCAGCA

[0173] CCGCTGGCCCCGCCGCCCGCCGACCCGGCGCCACCCGTGGAACTTGCCGCTAAC

[0174] GACCTGCCCGCACCGCTGGGTGAACCCCTCCCGGCAGCTCCCGCCGACCCGGCA

[0175] CCACCCGCCGACCTGGCACCACCCGCGCCCGCCGACGTCGCGCCACCCGTGGAA

[0176] CTTGCCGTAAACGACCTGCCCGCACCGCTGGGTGAACCCCTCCCGGCAGCTCCC

[0177] GCCGACCCGGCACCACCCGCCGACCTGGCACCACCCGCGCCCGCCGACCTGGCG

[0178] CCACCCGCGCCCGCCGACCTGGCGCCACCCGCGCCCGCCGACCTGGCACCACCC

[0179] GTGGAACTTGCCGTAAACGACCTGCCCGCGCCGCTGGGTGAACCCCTCCCGGCA

[0180] GCTCCCGCCGAACTGGCGCCACCCGCCGATCTGGCACCCGCGTCCGCCGACCTG

[0181] GCGCCACCCGCGCCCGCCGACCTGGCGCCACCCGCGCCCGCCGAACTGGCGCCA

[0182] CCCGCGCCCGCCGACCTGGCACCACCCGCTGCGGTGAACGAGCAAACCGCGCC

[0183] GGGCGATCAGCCCGCCACAGCTCCAGGCGGCCCGGTTGGCCTTGCCACCGATTT

[0184] GGAACTCCCCGAGCCCGACCCCCAACCAGCTGACGCACCGCCGCCCGGCGACG

[0185] TCACCGAGGCGCCCGCCGAAACGCCCCAAGTCTCGAACATCGCCTATACGAAGA

[0186] AGCTGTGGCAGGCGATTCGGGCCCAGGACGTCTGCGGCAACGATGCGCTGGACT

[0187] CGCTCGCACAGCCGTACGTCATCGGCTGA

[0188] Example 2:

[0189] Example 2 The fusion protein LS2R successfully constructed in Example 1 was bidirectionally mixed with a novel composite adjuvant constructed by graphene oxide in the form of DDA liposome adjuvant to prepare a subunit protein adjuvant vaccine LS2R+DG, and the immunogenicity of the vaccine in vivo was evaluated by mouse experiments, specifically including the following contents:

[0190] 2.1 Experimental animals

[0191] 6-9 week old C57BL / 6 female mice were purchased from Henan Sikebes Co., Ltd. with an average weight of 12-20 g and were kept in an SPF animal room to exclude interference from other pathogens in the experiment. The animal experiment of the present invention was reviewed and approved by the Animal Research Ethics Committee of the School of Medicine of Anhui University of Science and Technology (No. 20180313-019).

[0192] 2.2 Experimental methods

[0193] 2.2.1 Adjuvant preparation

[0194] Preparation of DDA adjuvant: Under sterile conditions, weigh the required DDA and cholesterol, add them to chloroform to prepare a DDA-cholesterol mixture, add the DDA-cholesterol mixture to a centrifuge tube, remove the chloroform with a rotary evaporator, and prepare a DDA-cholesterol film. Wash the DDA-cholesterol film with methanol-water solution, centrifuge, remove the colloidal particles, and then wash with sterile methanol to make the film sterile. Under sterile conditions, the above-mentioned DDA-cholesterol film is prepared into a DDA adjuvant liquid with anhydrous ethanol.

[0195] Preparation of DG adjuvant: DDA adjuvant and graphene oxide adjuvant were mixed in a certain ratio so that the dose standard of DG adjuvant injected into mice was 10 mg / kg.

[0196] 2.2.2 Subunit vaccine preparation

[0197] The prepared and endotoxin-treated fusion protein LS2R was mixed with the above-mentioned DG adjuvant in a certain ratio so that the effective protein amount reached 20ug / mouse, and the LS2R+DG multi-fusion subunit vaccine was prepared.

[0198] 2.2.3 Preparation of BCG injection

[0199] Weigh an appropriate amount of BCG dry powder (calculate its weight according to the specifications), dissolve it in sterile PBS, and divide it into sterilized centrifuge tubes, seal them and store them in a refrigerator at 4°C for later use. Finally, the BCG load reaches 1×10 7 CFU / mg.

[0200] 2.2.4 Animal grouping and immunization method

[0201] 2.2.4.1 Animal grouping

[0202] The animal groups are shown in Table 5 below.

[0203] Table 5 Experimental animal groups

[0204]

[0205] 2.2.4.2 Immunization regimen

[0206] The injection standard for mice was 200ul / mouse. The PBS group, BCG group, and primary immunization and booster group were injected with the relevant drugs only once at week 0, and the protein adjuvant group and primary immunization and booster group were injected with the corresponding drugs every 3 weeks, for a total of 3 immunizations, and the immunization cycle was 9 weeks. Figure 5 shown.

[0207] 2.2.5 Analysis of immunogenicity of subunit vaccines

[0208] 2.2.5.1 Detection of antigen-specific total IgG antibody titer in mouse serum (indirect ELISA method)

[0209] Peripheral blood of mice was collected by orbital bleeding, and mice were killed. Peripheral blood serum was collected by high-speed centrifugation. Fusion protein LS2R was added to 96-well plates (5 μg / well) according to the instructions of the kit, and coated with coating solution and incubated overnight at 4°C. After the incubation on the second day, it was blocked to avoid nonspecific binding and incubated in a 37°C incubator for 1 hour. 200ul of serum diluted in multiples from each group of mice was added, and the incubation continued for 1 hour under the same conditions. IgG 1:5000, IgG1 (IgG2a) 1:10000, and specific binding detection antibodies were added to form antigen-antibody complexes. The signal intensity of the complex was detected by an enzyme-labeled microplate reader to determine the titer of specific IgG antibodies in the serum. The antibody titer was expressed as the reciprocal of the highest dilution multiple with a positive result, and the result of each mouse serum was expressed as lg (antibody titer); IgG2a:IgG1 was calculated based on the actual measured dilution multiples of IgG2c and IgG1.

[0210] 2.2.5.2 Specific cytokine secretion levels in mouse spleen cell culture supernatant

[0211] Mouse spleen cells were collected, ground aseptically, and red blood cell lysis buffer was added. After washing, they were centrifuged at 4°C to prepare single-cell suspensions. The number of cells was counted using a cell counter, and the cells were seeded at an appropriate density in a 96-well plate. Cytokine secretion was stimulated using PPD or fusion protein LS2R. 2The cells were cultured at 37°C in an incubator for 48 to 72 hours, and the supernatant was collected by low-speed centrifugation. Cells can be removed by centrifugation or filtration. The subsequent steps were to detect the cytokine secretion level in the supernatant according to the instructions of the specific ELISA kit. After obtaining the standard curve data using an ELISA reader, the secretion levels of various cytokines in each group of mice were calculated.

[0212] 2.2.5.3 Detection of antigen-specific T lymphocyte subsets in mice by flow cytometry

[0213] Prepare samples: Collect mouse spleens and prepare single-cell suspensions. Red blood cells can be removed by red blood cell lysis solution as needed. Cell counting and adjustment: Use a cell counter to calculate the cell concentration and adjust the cells to an appropriate concentration. Cell surface labeling: Use fluorescently labeled antibodies such as anti-CD4 and CD8 to label the surface of T lymphocytes. Antigen stimulation: Add mouse antigens to the cell suspension at a concentration of 10ug / ml and incubate at 37°C for 4 hours. Cell fixation and permeabilization: Treat cells with fixation and permeabilization solution to increase cell membrane permeability, add intracellular cytokine antibodies, namely anti-IFN-γ, TNF-α and IL-2, to allow fluorescent dyes to enter the cells. Flow cytometer analysis: Analyze samples on a flow cytometer to determine antigen-specific T lymphocyte subsets. The analysis strategy is to circle CD3 first. + CD4 + T cells, CD3 + CD4 + T cells, and then circle the T lymphocytes with single positive, double positive and triple positive IFN-γ, TNF-α and IL-2 respectively. Data analysis: According to the results of flow cytometric analysis, the percentage and number of each antigen-specific T lymphocyte subset were calculated.

[0214] 2.2.6 Statistical analysis

[0215] In the validation of immunogenicity in animal experiments, paired sample t-test was used as the statistical method to analyze the same index, and the control variable was tested by one-way analysis of variance. α=0.05, P<0.05 indicated that the results were statistically significant.

[0216] 2.3 Results

[0217] 2.3.1 Fusion protein LS2R can stimulate mice to produce high titer IgG antibodies

[0218] Nine weeks after immunization, blood was collected from the orbits and the mice were killed by vertebral dislocation. Serum was collected and the antibody titer in the serum was tested. The results are shown in the attached Figure 6 As shown in the attached Figure 6It can be seen that the antibody titer in the PBS group was extremely low, and the LS2R+DG adjuvant was able to induce lower levels of IgG, IgG1, and IgG2a antibodies, while the antibody titer level in the serum of mice in the primary immunization booster group BCG+LS2R+DG group was significantly increased.

[0219] 2.3.2 Fusion protein LS2R stimulates splenocytes to secrete Th1-specific cytokines

[0220] Mice were killed 9 weeks after immunization, spleens were removed under sterile conditions and single cells were prepared. Splenocytes were stimulated with PPD and fusion protein LS2R. The secretion levels of various cytokines in the supernatant of mouse spleen cell culture are shown in the attached figure. Figure 7 As shown in the attached Figure 7 It can be seen that the level of IFN-γ secreted by BCG+LS2R+DG group mice was higher in splenocytes stimulated with PPD, and the same trend was also shown in the secretion level of TNF-α and IL-2 cytokines. Although the secretion level of cytokines in splenocytes stimulated with LS2R showed the same trend as PPD, the secretion amount was higher than that of PPD stimulation.

[0221] 2.3.3 Fusion protein subunit vaccine can stimulate mice to produce a large number of CD4 + / CD8 + IFN-γ + TNF-α + , IL-2 + Single positive T lymphocytes and double positive and triple positive T lymphocytes

[0222] The mice were killed by dislocation 9 weeks after immunization, and the spleen was aseptically removed from the biosafety cabinet, ground on a sterile cell sieve, and centrifuged and washed after adding red blood cell lysis buffer to prepare spleen cell suspension. The FCM technique was used for detection. The results are shown in the attached figure. Figure 8-10 As shown in the attached Figure 8-10 You can get:

[0223] IFN-γ + Single positive CD4 + T lymphocytes: After stimulation with multi-fusion protein, IFN-γ + Single positive CD4 + T lymphocyte subsets showed different trends. The number of cells in the PBS group was the least, while the proportion of target cells in BCG was slightly higher than that in the PBS group. The proportion of cells in the LS2R+DG group was significantly higher than that in the first two groups, but slightly less than that in the primary booster group BCG+LS2R+DG group. The same trend was also shown in CD8 + T lymphocytes.

[0224] TNF-α + Single positive CD4 +T lymphocytes: TNF-α + Single positive CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes.

[0225] IL-2 + Single positive CD4 + T lymphocytes: IL-2 + Single positive CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes.

[0226] IFN-γ + TNF-α + Double Yang CD4 + T lymphocytes: IFN-γ + TNF-α + Double Yang CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes. Compared with single positive cells, the number of cells is less.

[0227] IFN-γ + IL-2 + Double Yang CD4 + T lymphocytes: IFN-γ + IL-2 + Double Yang CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes. Compared with single positive cells, their number is less.

[0228] TNF-α + IL-2 + Double Yang CD4 + T lymphocytes: TNF-α + IL-2 + Double Yang CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes. Compared with single positive cells, the number of cells is less.

[0229] IFN-γ + TNF-α + IL-2 + Sanyang CD4 + T lymphocytes: IFN-γ+ TNF-α + IL-2 + Sanyang CD4 + The trend of T lymphocyte subsets was similar to that of IFN-γ + Single positive CD4 + T lymphocytes. Compared with single positive cells, their number is smaller.

[0230] In summary, the fusion protein LS2R in the present invention can induce high levels of IFN-γ, IL-2 and TNF-α in the supernatant of spleen cells whether it is used alone in combination with an adjuvant or for primary immunization enhancement, and the level of related cytokines is the highest when the enhanced vaccine is used, which proves that it has good immunogenicity.

[0231] In addition, the experimental group mice were able to stimulate a certain level of IgG antibody titer after vaccine stimulation, and the antibody titer in the BCG+LS2R+DG group was the highest. IgG antibodies play a role in resisting the invasion of pathogens such as bacteria, viruses, and fungi in the body, and can also regulate the response of the immune system. IgG antibodies have a good memory function, can recognize previously infected pathogens, and respond to them faster and stronger. In this experiment, the titers of IgG subclasses IgG1 and IgG2a also increased to a certain extent, but the IgG2a secretion titer was significantly higher than IgG1; similar to IgG antibodies, the IgG1 and IgG2a titers in the BCG+LS2R+DG group were also the highest. IgG1 is mainly involved in humoral immune response, can neutralize pathogens, enhance the phagocytosis of macrophages, promote complement activation, etc., and dominates humoral immunity, while IgG2A antibodies are mainly involved in cellular immunity, can recognize antigens on the cell surface, and clear infected cells by activating natural killer cells, macrophages and other cells. The ratio of IgG2a:IgG1 is greater than 1, indicating that the new subunit vaccine LS2R+DR still mainly induces Th1 type cellular immune response, which is also the main mechanism for TB vaccine to stimulate the body to produce cellular immunity to eliminate pathogens.

[0232] In the BCG prime and LS2R+DG boost groups, the induced Th1 immune response level was higher and the level of cytokines produced also increased, revealing that this new subunit has great development potential and optimistic development prospects as a booster vaccine in the future.

[0233] Multifunctional T cells refer to CD4 + or CD8 +It can produce two or more functions at the same time, including degranulation, cytokine or chemokine production. The quantity and quality of multifunctional T cells are closely related to the body's defense ability, especially the quality of T cell response is the key factor, that is, inducing T cell proliferation, secretion of different cytokines and / or chemokines, which can be reflected at the level of a single cell or the sum of antigen-specific cells. Among the various cytokines secreted by multifunctional T cells, IFN-γ and TNF-α play an important role in particular. In the flow cytometry test of the present invention, intracellular factor staining (ICS) detection found that the primary immunization booster group induced no matter CD4 + Still CD8 + The number of IFN-γ+, TNF-α+, IL-2 single-positive, double-positive and triple-positive T cells increased significantly compared with the BCG group and the vaccine alone group.

[0234] In the present invention, DDA is used as an adjuvant form and graphene oxide is used as the main adjuvant component to prepare DG adjuvant. By using a new adjuvant with LS2R fusion protein and graphene as the main component, spleen cells are induced to produce Th1 cell immune response with the main characteristics of secreting IFN-γ, TNF-α, IL-2 and activating corresponding multifunctional T cells after immunizing mice.

[0235] In summary, the novel TB subunit fusion protein adjuvant vaccine constructed in the present invention can not only induce the Th1 type immune response required for anti-M.tb infection, but also proves that it has a stronger immune response potential in the primary immunization and enhancement strategy as an enhanced vaccine. The present invention provides a research idea and experimental basis for the advanced verification of the primary immunization and enhancement strategy, and opens up a new path for the screening of candidate target antigens and the selection and application of novel adjuvant components and types.

[0236] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A Mycobacterium tuberculosis fusion protein LS2R, characterized in that: Including subcomponent proteins Rv2029c, Rv2131c, Rv2309c and Rv0867.

2. The Mycobacterium tuberculosis fusion protein LS2R according to claim 1, characterized in that: The gene sequence of the fusion protein LS2R is shown in SEQ ID NO:

1.

3. The method for constructing the Mycobacterium tuberculosis fusion protein LS2R according to claim 1, characterized in that: The following steps are included: S1: H37Rv whole genome DNA extraction; S2: Design primer sequences for the fusion protein LS2R and its subcomponent protein genes; S3: PCR amplification and horizontal gel electrophoresis of Rv2029c, Rv2131c, Rv2309c, Rv0867, and LS2R; S4: Rv2029c, Rv2131c, Rv2309c, Rv0867 and LS2R were double-digested with restriction endonucleases, and the digestion products were purified; S5: Rv2029c, Rv2131c, Rv2309c, Rv0867 and LS2R were connected with the empty vector plasmid pET30B / pET28a to construct the corresponding recombinant plasmids, and IPTG was used to successfully induce the expression of the fusion protein LS2R and its subcomponent proteins; S6: Induce purification and remove endotoxin from the fusion protein LS2R and its subcomponent proteins.

4. The method for constructing the Mycobacterium tuberculosis fusion protein LS2R according to claim 3, characterized in that: The primer sequences of the fusion protein LS2R gene in step S2 are shown in SEQ ID NO:10 and SEQ ID NO:

11.

5. A subunit vaccine, characterized in that: It comprises the Mycobacterium tuberculosis fusion protein LS2R as claimed in claim 1.

6. A subunit vaccine according to claim 5, characterized in that: The subunit vaccine is a LS2R+DG multi-fusion subunit vaccine, wherein DG is an adjuvant.

7. A subunit vaccine according to claim 6, characterized in that: The DG adjuvant is prepared by mixing a DDA adjuvant with a graphene oxide adjuvant.

8. A pharmaceutical composition for preventing tuberculosis, characterized in that: It comprises BCG and the subunit vaccine according to claim 6.

9. A serum test kit for tuberculosis, characterized in that: The kit comprises the Mycobacterium tuberculosis fusion protein LS2R as claimed in claim 1, wherein the Mycobacterium tuberculosis fusion protein LS2R is used as a diagnostic marker antigen protein in the kit.

10. A product for promoting or activating the production of Mycobacterium tuberculosis antigen-specific IFN-γ, characterized in that: The active ingredient of the product is the Mycobacterium tuberculosis fusion protein LS2R described in claim 1.

Images