The Zm00001eb181850 gene, a molecular marker associated with resistance to maize white spot disease, and its application.
Through genome-wide association analysis and QTL mapping, the SNP:4-118983592 locus and its associated gene Zm00001eb181850 on maize chromosome 4 were identified, solving the time-consuming problem in maize white spot disease breeding and realizing efficient screening and breeding of disease-resistant varieties.
Patent Information
- Application Number
- CN202510147297.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2045-02-11
AI Technical Summary
In current technologies, the control of white spot disease in maize mainly relies on field cultivation and chemical agents, lacking effective genetic resistance genes, which leads to a time-consuming and inefficient breeding process.
Through genome-wide association analysis and QTL mapping, the SNP:4-118983592 locus and its associated gene Zm00001eb181850 on maize chromosome 4 were identified. These loci can be used to assist in breeding maize white spot disease resistance, shorten the breeding cycle and improve efficiency.
This method enables rapid screening of maize varieties resistant to white spot disease, avoiding a complicated and time-consuming resistance screening process, improving breeding efficiency, and enhancing the disease resistance of maize.
Smart Images

Figure CN119824131B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetic breeding technology, specifically involving the SNP:4-118983592 locus on chromosome 4 of maize, which is related to maize white spot disease resistance, and the application of the locus-associated functional gene Zm00001eb181850. Background Technology
[0002] Corn (Zea mays L.), as an important food crop, directly impacts the development of animal husbandry. In recent years, white spot disease of corn, caused by Pantoea ananatis, has become a serious foliar disease affecting corn production. In the early stages, white spot disease manifests as lesions on the basal leaves, which then rapidly spread to the upper parts of the plant. In later stages, the disease presents as a chlorotic appearance, thus affecting the plant's carbon cycle and photosynthesis. If some leaves are infected before the corn grain-filling stage, it can lead to a significant decrease in net photosynthetic rate by 40%, causing premature cessation of the reproductive maturity stage, ultimately resulting in deformed ears, low shelling percentage, and severely reduced corn yield and quality.
[0003] Currently, the control of white spot disease mainly focuses on optimizing field cultivation systems and the use of agricultural chemicals. Recent studies have shown that resistance to white spot disease largely depends on its genetic factors. Therefore, genetically breeding varieties resistant to white spot disease is the most economical and effective way to control this disease. However, since white spot disease is a newly emerging maize disease in my country, functional genes related to white spot disease resistance have not yet been cloned. This invention, based on genome-wide association analysis and QTL mapping, used tropical maize inbred lines (YML32, TRL418, CML171, TML139, YML226, NK40-1) as resistant parents, crossed them with the temperate susceptible superior inbred line Ye107, and after nine consecutive generations of single-seed self-pollination, selected six F9 recombinant inbred lines (RILs). These RILs were planted in Yanshan County, Yunnan Province for phenotypic identification for three consecutive years. Combined with high-quality SNPs from the RIL population, functional genes significantly associated with maize white spot disease resistance were identified through GWAS and linkage analysis. Summary of the Invention
[0004] The main objective of this invention is to provide the application of the white spot disease resistance QTLs qMWS4-1 and qMWS4-5 located on chromosome 8 of maize, the SNP 4-118983592 on chromosome 4, and the locus-associated gene Zm00001eb181850 to assist in the improvement of maize white spot disease resistance. This can avoid the complicated and time-consuming resistance screening process, shorten the breeding cycle, and improve the efficiency of molecular genetic breeding for maize resistance to white spot disease.
[0005] Specifically, the present invention provides the following technical solutions:
[0006] On the one hand, the present invention provides molecular markers associated with resistance to maize white spot disease, the molecular marker gene sequences of which are shown in SEQ ID NO:1 and / or SEQ ID NO:2.
[0007] Furthermore, the molecular markers, such as the sequence shown in SEQ ID NO:1, exhibit T / C polymorphism at the 201st base position starting from the 5′ end; the sequence shown in SEQ ID NO:2 corresponds to the maize Chr4:119014763-119023372 sequence, exhibiting G / T polymorphism at the 119022188th base position starting from the 5′ end; and / or the expression level of the gene shown in SEQ ID NO:2 or its translated protein is positively correlated with maize white spot disease resistance.
[0008] Furthermore, this invention provides a molecular marker associated with resistance to maize white spot disease, wherein the molecular marker is an SNP locus, including the following SNPs located on maize chromosome 4: 119015573, 119015605, 119015666, 119015689, 119015754, 119015775, 119016626, 119018991, 119019227, 119019236, 119019440, 119019442, 119019442, 119019443, 119019444, 119019442, 119019227, 119019236, 119019440, 119019442, 119019443, 1190194 ...574, 119015605, 119015666, 119015689, 119015754, 119015775, 119016626, 119018991, 119019227, 119019236, 119019440, 119019442, 119019443, 119019444, 119019443, 11901 At least one of the following SNP loci: 9019567, 119019601, 119019635, 119019878, 119020288, 119020495, 119020805, 119021016, 119021024, 119021932, 119022096, 119022608, and 119022763, wherein the reference genome version of the SNP locus is Zm-B73-REFERENCE-NAM-5.0.
[0009] Furthermore, the present invention provides any of the following applications of any of the said molecular markers:
[0010] a) Genetic diversity analysis of white spot disease resistant maize; b) Construction of molecular genetic map of white spot disease resistant maize; c) Genome-wide association analysis of white spot disease resistant maize; d) Identification of white spot disease resistant maize varieties; e) Molecular marker-assisted selection breeding of white spot disease resistant maize; f) Genome-wide selection breeding of white spot disease resistant maize.
[0011] Furthermore, the present invention provides a product for detecting any of the said molecular markers, the product comprising reagents, kits or gene chips, the product detecting the genotype of the molecular marker, or detecting the expression level of the sequence shown in SEQ ID NO:2 or its translated protein.
[0012] Furthermore, the present invention provides products for detecting any of the said molecular markers, said products including those prepared using PCR, qPCR, Sanger sequencing, high-throughput sequencing, fluorescence in situ hybridization, TaqMan probe method, ARMS-PCR method or KASP method, said products for detecting the genotype of said molecular marker, or for detecting the expression level of the sequence as shown in SEQ ID NO:2 or its translated protein.
[0013] Furthermore, the present invention provides any of the following applications of the described product:
[0014] a) Genetic diversity analysis of white spot disease resistant maize; b) Construction of molecular genetic map of white spot disease resistant maize; c) Genome-wide association analysis of white spot disease resistant maize; d) Identification or auxiliary identification of white spot disease resistant maize varieties; e) Molecular marker-assisted selection breeding of white spot disease resistant maize; f) Genome-wide selection breeding of white spot disease resistant maize.
[0015] In another aspect, the present invention provides a method for screening maize resistant to white spot disease. A maize sample to be tested is taken, and the gene sequence shown in SEQ ID NO:1 is detected. When the base at position 201 from the 5′ end of the sequence shown in SEQ ID NO:1 is C, a maize variety resistant to white spot disease is obtained.
[0016] In another aspect, the present invention provides a method for screening maize resistant to white spot disease. A maize sample to be tested is taken, and the expression level or genotype of the gene sequence shown in SEQ ID NO:2 is detected. If the sequence shown in SEQ ID NO:2 or its translated protein is overexpressed and / or the base at position 119022188 from the 5′ end is T, it is determined to be a maize variety resistant to white spot disease.
[0017] In another aspect, the present invention provides a method for screening maize resistant to white spot disease. A maize sample to be tested is taken, and the molecular marker genotype is detected. When the SNP sites of the molecular marker sequentially present as: CTCGCGGTGCTTAACCATGTGCCAA, it is determined to be a maize variety resistant to white spot disease.
[0018] The technical effects achieved by this invention are as follows:
[0019] This invention, through multi-year, multi-location experiments, has co-located the white spot disease resistance QTLs qMWS4-1 and qMWS4-5 on maize chromosome 4, along with the resistance SNP: 4-118983592 and its associated gene Zm00001eb181850. This locus can be located under different environmental conditions using QTL linkage analysis and GWAS association analysis. The white spot disease resistance QTLs qMWS4-1 and qMWS4-5 overlap, explaining 15.05% of the phenotypic variation. This QTL region contains the homologous resistance locus SNP: 4-118983592 (i.e., the 201 bp site from the 5′ end of the sequence shown in SEQ ID NO: 1). SNP: 4-118983592 explains 8.84% of the resistance phenotypic variation. The associated candidate functional gene Zm00001eb181850 (SEQ ID NO:2) mainly encodes leucine-rich repeat sequences (LRR), which play an important regulatory role in plant stress response, plant growth and development, and signal transduction. Attached Figure Description
[0020] Figure 1 Leaf images of maize with different grades of white spot disease; HR: highly resistant to white spot disease, R: resistant to white spot disease, M: moderately resistant to white spot disease, S: susceptible to white spot disease, HS: highly susceptible to white spot disease.
[0021] Figure 2 A heatmap showing the correlation of vitiligo resistance in six groups; it describes the overall correlation of RILs in the six groups under different environments. The narrower the circle and the redder the color, the stronger the correlation.
[0022] Figure 3 SNP density map and LD decay map; (a) Chromosome-specific SNP density within a 1Mb interval, with the vertical axis representing chromosomes and the horizontal axis representing the position on each chromosome. The redder the color of the corresponding position, the more variant sites there are. (b) Genome-wide LD decay (r2) of all chromosomes in 941 maize RILs as a function of physical distance (Kb).
[0023] Figure 4 Colocation map of vitiligo resistance QTLs qMWS4-1 and qMWS4-5 with resistance site SNP:4-118983592;
[0024] Figure 5 A diagram showing the seven haplotypes of the vitiligo resistance candidate gene Zm00001eb181850;
[0025] Figure 6Analysis of candidate gene Zm00001eb181850 for resistance to white spot disease; (a) Overall differences in resistance levels of 7 haplotypes to white spot disease in maize, * indicates p<0.05, **** indicates p<0.0001; (b) Relative positions of Zm00001eb181850 and SNP:4-118983592, and base and amino acid variations in parents TRL418 and TML139; (c) Expression levels of Zm00001eb181850 gene in different maize tissues, with the red box indicating expression of Zm00001eb181850 gene in leaves. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0027] This invention, based on genome-wide association analysis and QTL mapping, utilizes tropical white spot disease resistant maize inbred lines (YML32, TRL418, CML171, TML139, YML226, NK40-1) as resistant parents, crosses them with the temperate susceptible superior inbred line Ye107, and after nine consecutive generations of single-seed self-pollination, six F9 recombinant inbred lines (RILs) were selected. These RILs were planted in Yanshan County, Yunnan Province for phenotypic identification for three consecutive years. Based on the high-quality SNP: 4-118983592 (i.e., the 201 bp site from the 5′ end of the sequence shown in SEQ ID NO:1) of the RIL population, GWAS and linkage analysis identified the functional gene Zm00001eb181850 (SEQ ID NO:2) significantly associated with maize white spot disease resistance. This resistance gene can be subsequently applied to maize white spot disease resistance breeding using molecular breeding techniques.
[0028] Example 1
[0029] 1. Experimental Materials and Design
[0030] This experiment selected six tropical maize inbred lines (YML32, TRL418, CML171, TML139, YML226, and NK40-1) resistant to white spot disease and exhibiting wide genetic variation as female parents. The superior temperate maize inbred line Ye107, susceptible to white spot disease, was used as the common parent for hybridization (the pedigree, heterosis groups, ecological groups, and related resistance levels of the seven parents are detailed in Table 1). Through single-seed propagation and nine consecutive generations of self-pollination, six recombinant inbred line (RIL) populations were generated: pop1 (YML32 × Ye107), pop2 (TRL418 × Ye107), pop3 (TRL418 × Ye107), pop4 ... The RIL lines were initially 200 lines each, including Ye107, pop3 (CML171×Ye107), pop4 (TML139×Ye107), pop5 (YML226×Ye107), and pop6 (NK40-1×Ye107). However, due to environmental selection, inbreeding depression, and other factors, 904 RIL lines were ultimately available for this study (pop1: 145; pop2: 141; pop3: 147; pop4: 160; pop5: 152; pop6: 159). These RIL lines were planted in Yanshan County, Yunnan Province (23°19'-23°59'N, 103°35'-104°45'E) in 2021, 2022, and 2023. The experimental design was a completely randomized block design, with 14 plants per row, a row length of 4m, and a plant spacing of 25cm, and the experiment was conducted according to standard farmland management.
[0031] Table 1. Pedigrees, ecotypes, and vitiligo resistance of the seven parental lines used in the experiment.
[0032]
[0033] 2. Disease severity score
[0034] Phenotypic identification of white spot disease in multi-parental RIL populations was conducted in Yanshan County (YS), Yunnan Province, China, in 2021, 2022, and 2023. White spot disease outbreaks in maize typically occur from early August to late September each year, during the grain-filling to maturity stage, which is suitable for resistance assessment. The severity grading of white spot disease follows the symptom identification criteria outlined in the *Handbook of Maize Diseases and Pests*, and the average severity of disease in individual plots is evaluated on a scale of 1 to 9. Figure 1 As shown in Table 2.
[0035] Table 2. Criteria for classifying the severity of maize white spot disease
[0036]
[0037]
[0038] 3. Phenotypic identification and statistical analysis
[0039] Descriptive analysis of the phenotypic data was performed using SPSS (SPSS Statistics) and ORIGIN (Origin 2022) software. Measures such as mean, minimum, maximum, standard deviation (SD), coefficient of variation (CV), skewness, and kurtosis were calculated. The frequency distribution of the phenotypic data was determined using SPSS software. Kurtosis and skewness were used to assess the normality of the frequency distribution. Generalized heritability was calculated according to the method outlined by Knapp et al.
[0040] 4. Whole genome resequencing
[0041] DNA was extracted from maize seedling leaves using a modified CTAB method, and whole-genome resequencing was performed. DNA libraries were prepared according to standard procedures and sequenced using Illumina Hi Seq. TM The platform performed sequencing. Subsequently, the filtered readings were aligned to the maize reference genome B73_RefGen_v5 (full name: Zm-B73-REFERENCE-NAM-5.0) to identify SNP markers, and they were annotated using SNPeff software.
[0042] 5. Population structure analysis and LD decline
[0043] The distance matrix was calculated using TreeBeST (version: Treebest-1.9.2), and a phylogenetic tree was constructed based on this matrix using the neighbor-joint (NJ) method. To ensure accuracy, the bootstrap values were obtained through up to 1000 calculations. PCA analysis was performed using GCTA, and the first two PC values were used to create a two-dimensional representation of the analyzed samples. The computational linkage disequilibrium (r) between pairwise labels was calculated using PopLDdecay software. 2 The software's built-in script, Plot_OnePop.pl, was used to plot the LD decay.
[0044] 6. Genome-wide association analysis
[0045] Genome-wide association analysis (GWAS) was performed using GEMMA software (http: / / www.xzlab.org / software.html) based on the analysis of 6,390,967 high-quality SNPs. This analysis employed a mixed linear model (MLM) for GWAS, considering phenotypes across all environments and the best unbiased linear uptake (BLUP). A significance threshold of log10(p) > 5 was used to identify significant SNPs associated with maize white spot disease resistance. SNPs meeting or exceeding the threshold were extracted using bedtools v1.7. Based on the B73_RefGen_v5 (full name: Zm-B73-REFERENCE-NAM-5.0) reference genome and annotation information, candidate genes associated with maize white spot disease resistance were screened within a 50kb range upstream and downstream of significant SNPs.
[0046] 7. Construction of genetic linkage maps
[0047] Linkage maps were constructed using JoinMap 4.0 software, and the LOD threshold was determined using a 1000-permutation test. A QTL was considered significant if the LOD threshold was ≥2.5. Linkage groups were defined based on an LOD threshold ≥2.5, and genetic linkage maps were constructed using eligible SNP markers. Genotyping filtering of progeny markers was performed based on a 0.8 integrity score and a 0.001 partial segregation score, resulting in six population markers. Binary markers were then plotted every 15 non-linked markers within each population to obtain the final population markers. JoinMap 4.0 was used to sort the binary markers for each population, and the Kosambi function was used to calculate the genetic distance (cM) between markers.
[0048] 8QTL Positioning Analysis
[0049] QTL mapping was performed using the Composite Interval Mapping (CIM) method in Windows QTL Cartographer 2.0. Phenotypic data of vitiligo were integrated into a high-density genetic linkage map, excluding SNP markers with a deletion rate ≥0.2 and loci with minor allele frequencies below 0.05. A 0.21 cM threshold was used to identify parental polymorphic QTLs. Thresholds were determined using 1000 random permutations with 95% confidence intervals. The LOD threshold associated with flanking markers was set to 2.5 to identify QTLs controlling MWS.
[0050] 9 candidate gene analysis
[0051] Haploview v4.2 software was used to perform candidate gene haplotype analysis. Based on the candidate gene ID, the corresponding gene sequence was extracted from the reference genome B73_RefGen_v5 and compared with the parental TRL418 and TML139. The corresponding coding regions and amino acid variation information were extracted, and the functional gene motifs were predicted using the MEME online software (https: / / meme-suite.org / meme / tools / meme).
[0052] Results Analysis
[0053] 1. Phenotypic Data Analysis
[0054] Data on vitiligo resistance phenotypes of six RIL populations were collected over three years in Yanshan and descriptive statistical analysis was performed. The results showed that the coefficients of variation for the six RIL populations ranged from 0.25 to 0.79 over the three years, indicating differences among the samples. Simultaneously, the average vitiligo severity of the plants in the six RIL populations ranged from 2.9 to 5.81. The absolute values of the skewness and kurtosis coefficients of the six populations over the three years were close to 1, indicating that the vitiligo resistance phenotypes of the tested populations conformed to a normal distribution and were consistent with quantitative trait characteristics during the three-year resistance identification. Further analysis showed that the heritability of vitiligo severity in each RIL population ranged from 76.47% to 98.79%, and there was a strong correlation (0.46-0.98) between the resistance phenotypes of the same population under different environments. Figure 2 The results indicate that the RIL lines showed strong consistency in resistance to white spot disease under different environments. Phenotypic identification results show that maize white spot disease resistance has high heritability, and maize white spot disease resistance is mainly determined by genes.
[0055] 2SNP density and LD decay
[0056] Whole-genome resequencing identified 6,390,967 high-quality SNPs across the entire genome. These SNPs were relatively evenly distributed across the 10 chromosomes of maize. Figure 3 a) The number of SNPs identified on chromosomes 1 through 10 is as follows: 1354402, 699661, 716354, 880880, 668865, 485243, 563392, 545220, 472482, and 462679. Chromosome 1 has the highest number of SNPs, while chromosome 10 has the lowest. The 6,390,967 identified SNPs were used to assess linkage disequilibrium (LD) decay in the association-mapped population. Figure 3 As shown in b, when r 2 When the rate of decline tends to level off, the physical distance is approximately 50 kb. Therefore, we selected a 50 kb range upstream and downstream of significant SNP sites as the criterion for screening candidate genes.
[0057] 3. Group Structure Analysis
[0058] Phylogenetic analysis of the population was performed using TreeBeST, dividing the 941 RIL lines into 6 subpopulations. Principal component analysis (PCA) using GCTA further divided the 941 RIL lines into 6 subpopulations, consistent with our assembled 6 RIL populations. The analysis revealed some mixed or overlapping families, possibly due to the shared parent Ye107 among the 6 subpopulations, and gene introgression during breeding. Therefore, the possibility of false positives in GWAS due to population structure needs to be considered in subsequent analyses.
[0059] 4. Genome-wide association analysis
[0060] GWAS analysis was performed using GEMMA software (http: / / www.xzlab.org / software.html) on vitiligo resistance phenotype data of 941 RIL lines in a multi-parent population over three years in Yanshan and 6,390,967 high-quality SNPs obtained from whole-genome resequencing. A mixed linear model (MLM) was used to simultaneously correct for population structure and individual kinship, identifying several SNPs. Among the significant SNPs located, 4-118983592 were co-located in three or more environments. Because artificial populations may cause false positives in GWAS analysis, QTL analysis will be used to further identify candidate loci to improve the accuracy of identification.
[0061] 5. QTL positioning
[0062] Using the white spot disease resistance phenotypes of different populations under different environments, combined with a constructed high-density genetic map, QTL mapping of white spot disease resistance loci in maize was performed. The mapping results were compared with GWAS analysis results. Finally, in the BLUP and 22YS environments, white spot disease resistance QTLs qMWS4-1 and qMWS4-5 were identified from the TML139×Ye107 population. These two resistance QTLs overlapped and could explain -15.05% of the phenotypic variation. This QTL interval contains the homologous resistance locus SNP 4-118983592 in the above three environments (21YS, 23YS, BLUP). Figure 4 SNP: 4-118983592 can explain 8.84% of the resistance phenotype variation. Figure 4 ).
[0063] 6. Candidate gene mining
[0064] This study used the B73_RefGen_v5 reference genome to screen the 50kb region upstream and downstream of the significant site SNP:4-118983592 within the qMWS4-4 interval. Candidate genes were annotated and functionally predicted using databases such as MaizeGDB, InterPro, UniProt, and NCBI, identifying the candidate functional gene Zm00001eb181850 (Chr4:119014763-119023372). SNP:4-118983592 was co-located in 21-year, 23-year, and BLUP intervals, explaining 8.84% of the phenotypic variation. This site is also contained within the homologous QTL intervals qMWS4-1 and qMWS4-5. Figure 4 This indicates that the SNP within the qMWS4-1 and qMWS4-5 regions is a highly reliable molecular marker. The associated gene Zm00001eb181850 encodes a leucine-rich repeat (LRR) family protein. The LRR domain is evolutionarily conserved in many proteins related to innate immunity in plants and animals. In different plants, LRR-RLK can act as signal recognition receptors to participate in signal transduction processes, playing important regulatory roles in plant stress responses, plant growth and development, and signal transduction.
[0065] 7. Candidate gene analysis
[0066] To clarify the correlation between the screened candidate functional gene Zm00001eb181850 and resistance to maize white spot disease, analysis was performed on Zm00001eb181850. The analysis revealed that the gene at positions 119015573, 119015605, 119015666, and 119015689 in the Zm00001eb181850 (Chr4:119014763-119023372) was involved in the disease. 119015754, 119015775, 119016626, 119018991, 119019227, 119019236, 119019440, 119019442, 119019567, 119019601, 119019635, 119019878, 119020288, 119020495, 119020805 Mutations at base positions 119021016, 119021024, 119021932, 119022096, 119022608, and 119022763 resulted in the study population exhibiting seven major haplotypes (Hap1: CTCGCGGTGCTTAACCATGTGCTGC; Hap2: TGACTTATACCGGTTTGCAGTTTGC; Hap3: CTCGCGGTGCTTAACCATGTGCCGC; Hap4: TGACTTATACCGGTTTGCAGTTCAC; Hap5: TGACTTACACCGGTTTGCAGTTCAA; Hap6: TGACTTATATCGGTTTGCAGTTTGC; Hap7: CTCGCGGTGCTTAACCATGTGCCAA). Figure 5 ),
[0067] Among them, plants with haplotype Hap7 (genotype: CTCGCGGTGCTTAACCATGTGCCAA) showed better resistance to maize white spot disease. Figure 6 a). By comparing the gene sequences in the resistance materials TRL418 and TML139, a specific G / T mutation was found at base position 119022188 in both TRL418 and TML139, resulting in a mutation from glutamine to histidine in the corresponding amino acid sequences of the resistance materials TRL418 and TML139, respectively. Figure 6 b) These amino acid mutations alter the protein motif. Studies of this gene's expression in different stages and tissues of maize revealed that the expression level of Zm00001eb181850 was higher in leaves than in other tissues. Figure 6 c) This further demonstrates that the gene is closely related to maize leaf disease resistance and can be used as a molecular marker for breeding maize resistant to white spot disease.
[0068] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. The application of molecular markers associated with maize white spot disease resistance in marker-assisted selection breeding of maize resistant to white spot disease, characterized in that, The molecular markers are SNP sites, including those located on maize chromosome 4: 119015573, 119015605, 119015666, 119015689, 119015754, 119015775, 119016626, 119018991, 119019227, 119019236, 119019440, 119019442, 119019567, 119019601, 119019635, 119019878, and 1190. The SNP loci 20288, 119020495, 119020805, 119021016, 119021024, 119021932, 119022096, 119022608, and 119022763, are reference genome versions Zm-B73-REFERENCE-NAM-5.
0. When the SNP loci of the molecular markers sequentially appear as: CTCGCGGTGCTTAACCATGTGCCAA, it is determined to be a maize variety with resistance to white spot disease.
2. The application of molecular markers associated with maize white spot disease resistance in marker-assisted selection breeding of maize resistant to white spot disease, characterized in that, The molecular marker gene sequence is shown in SEQ ID NO:
1. As shown in SEQ ID NO:1, the 201st base from the 5′ end of the sequence exhibits T / C polymorphism. When the 201st base from the 5′ end of the sequence is C, a maize variety resistant to white spot disease is obtained.
3. The application of the product containing the molecular marker described in claim 1 or 2 in marker-assisted selection breeding of white spot disease-resistant maize, characterized in that, The product includes reagents, kits, or gene chips, and the product detects the genotype of the molecular marker.
4. A method for screening maize resistant to white spot disease, characterized in that, Take a corn sample to be tested and detect the gene sequence as shown in SEQ ID NO:
1. If the base at position 201 from the 5′ end of the sequence shown in SEQ ID NO:1 is C, a corn variety with resistance to white spot disease is obtained.
5. A method for screening maize resistant to white spot disease, characterized in that, Take a maize sample to be tested and test the molecular marker genotype described in claim 1. When the SNP sites of the molecular marker are sequentially presented as: CTCGCGGTGCTTAACCATGTGCCAA, it is determined to be a maize variety with white spot disease resistance.
Citation Information
Patent Citations
Clone identification of gene ZmNL related to head-smut resistance of corn and application of clone identification in breeding of corn resistant to head smut disease
CN104404054A
Corn leukoderma-related resistant QTN fragment, molecular marker and application thereof
CN117904345A