Establishment method of zebrafish model for simulating duodenal obstruction

Abstract

Newborn congenital duodenal obstruction is an enteric cavity obstructive disease caused by fetal duodenal dysplasia, and is a common type in newborn digestive tract obstruction. The global morbidity is about 1 / 5000-1 / 10000 newborns, and the disease is more common in Asian people. Typical clinical manifestations of the disease include vomiting, epigastric distension and fetal stool discharge delay after birth, the invention provides a method for establishing a zebra fish model for simulating duodenum obstruction, and additionally provides a target design idea.

Description

Technical Field

[0001] The invention relates to the technical field of methods for constructing model animal disease models, and in particular to a method for establishing a zebrafish model for simulating duodenal obstruction. Background Art

[0002] Congenital duodenal obstruction in newborns is an intestinal obstructive disease caused by abnormal development of the duodenum during the fetal period. It is a common type of digestive tract obstruction in newborns. Its global incidence is about 1 / 5000 to 1 / 10000 newborns, and it is more common in Asian populations. The typical clinical manifestations of this disease include vomiting after birth, upper abdominal distension, and delayed meconium discharge.

[0003] The cause of duodenal obstruction is not yet fully understood. The main hypotheses for the pathological mechanism include abnormal intestinal recanalization during embryonic development (usually occurring at 5–7 weeks of gestation) and obstruction of mesenteric artery blood supply. Most cases are sporadic, but some patients may have genetic susceptibility. In recent years, genetic studies have shown that genes such as JAG1, GATA4, and FGF10 may play an important role in the development of the duodenum.

[0004] SNAPC4 The gene is located on human chromosome 15 and encodes the small nuclear RNA activating protein complex 4 subunit. This protein plays a key role in the transcription process of RNA polymerase II and III, especially in the transcriptional activation of small nuclear RNA. snapc4 Genetic studies have shown that its mutations are associated with a variety of diseases. In 2023, Altamimi et al. found that in two newborns with biliary atresia born to a consanguineous couple, snapc4 Homozygous mutations in the gene highlight its possible role in neonatal biliary atresia. snapc4 The function and expression of mitochondria and their association with gastrointestinal tract developmental abnormalities need further study.

[0005] This study used the CRISPR / Cas9 system to construct snapc4 Zebrafish line, describing the pathogenesis of mutant fish lineage by structural and pathological analysis of digestive tract malformations of mutants.

[0006] Clinical characteristics Patient Information gender male Digestive tract malformation phenotype Duodenal obstruction Other diseases Congenital ileocecal ectopia, neonatal gastric bleeding, scalp edema, patent ductus arteriosus, neonatal hyperbilirubinemia, neonatal anemia Family members become ill none Related genes SNAPC4 Nucleotide changes NM_003086:c.A1354GNM_003086:c.A1021G Amino acid changes p.K452E、p.N341D genotype Compound heterozygous Genetic origin Mother / Father Summary of the invention

[0007] The method for establishing a zebrafish model for simulating duodenal obstruction is characterized by comprising the following steps: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the specific sequence of sgRNA is GAGATCGAGGTCCAGCTCTCTGG or AACTCTATCTTCTCAGTACCTGG or CTAGGGTCCTCCAGCTAATGAGG or GATAAAATCGCAGAGGCTCTTGG on the coding strand, and the primers are synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mix the gRNA and Cas9 mRNA recovered in step S3 to make the final concentration of gRNA reach 320 ng / μL and Cas9 mRNA reach 800 ng / μL, then microinject into one-cell stage zebrafish embryos, injecting 180 to 220 pieces per target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injection batch embryos with double peaks in the sequencing results into a breeding system (Beijing Aisheng Company). When they are sexually mature, the next generation of embryos is screened to detect effective mutant types of zebrafish, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0008] The steps of establishing the above model are further optimized as follows: In step S1, the specific sequence of sgRNA selected is GATAAAATCGCAGAGGCTCTTGG on the coding strand, which directly corresponds to the sequence of mRNA and encodes protein.

[0009] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0010] The gRNA and Cas9 mRNA in the S4 were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0011] The injected batch embryos with bimodal sequencing results in step S5 are placed in a breeding system and raised until sexual maturity, and then the next generation of embryos are screened to detect effective mutant zebrafish.

[0012] The method for observing the situation under a fluorescence microscope in step S6 is as follows: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then DMSO dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the zebrafish culture water was used for 3 washes, and the samples were fixed with low melting point glue after washing, and finally photographed using a stereo microscope.

[0013] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0014] Said snapc4 Mutant zebrafish larvae were 6-7 days old.

[0015] Beneficial effects of the present invention: The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that the Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked. The present invention established snapc4 After the mutant zebrafish line is finally tested and analyzed through steps S6-S8, it can simulate the disease characteristics of congenital duodenal obstruction in newborns. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 For zebrafish snapc4 Mutant construction target sequence map.

[0017] Figure 2 For zebrafish control group and snapc4Real-time in vivo fluorescence imaging of digestive tract motility in mutant digestive tracts.

[0018] Figure 3 For zebrafish control group and snapc4 Data comparison of mutant fluorescence intensity measurement, where control is the control group. SnapC4 is the experimental group and “*” is used to mark statistical significance.

[0019] Figure 4 For zebrafish control group and snapc4 Pathological changes in the digestive tract of mutants.

[0020] Figure 5 For zebrafish snapc4 Genome sequence validation diagram.

[0021] Figure 6 The sequencing results of mutant zebrafish with cleavage of the Target1 site.

[0022] Figure 7 This is the sequencing result of mutant zebrafish with cleavage of the Target2 site.

[0023] Figure 8 This is the sequencing result of the mutant zebrafish with the Target3 site cut.

[0024] Fig. 9 This is the sequencing result of mutant zebrafish with cleavage of the Target4 site.

[0025] Fig.10 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target1 site.

[0026] Fig.11 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target2 site.

[0027] Fig.12 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target3 site.

[0028] Fig.13 This is a diagram showing the cutting efficiency of mutant zebrafish that cuts the Target4 site. DETAILED DESCRIPTION

[0029] In order to make up for the above shortcomings, the present invention provides a method for establishing a zebrafish model for simulating duodenal obstruction to solve the problems in the above background technology.

[0030] The method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the breeding system with a double peak in the injected batch embryos. The breeding system uses a zebrafish breeding system (ESEN-AW-DU5SS, Beijing Aisheng Company). When the zebrafish are sexually mature, the next generation of embryos are screened to detect effective mutation types, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0031] In step S1, the synthesis and reading of the specific sequence of sgRNA selected is the tail end of the pentose in the nucleotide, with a hydroxyl group. It needs to be explained here that the 5' and 3' ends of DNA or RNA refer to the number of the pentose in the nucleotide, the 5' end has a phosphate group, and the 3' end has a hydroxyl group. The synthesis and reading direction of the nucleic acid chain are from 5' to 3', 5' is the head end, and 3' is the tail end.

[0032] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0033] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0034] In the S4 step, 200 pellets were injected into each target point.

[0035] Method for observing the situation under fluorescence microscope in step S6: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then DMSO dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the zebrafish culture water was used for 3 washes, and the samples were fixed with low melting point glue after washing, and finally photographed using a stereo microscope.

[0036] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0037] snapc4 Mutant zebrafish larvae were 6-7 days old.

[0038] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0039] The specific target design of the present invention is as follows: (1) Target site selection: Select the target site as follows (Note: red fonts mark gene exon sequences; underlines mark sequence amplification primers; yellow background or wavy lines mark target sequences). Figure 1 shown.

[0040] (2) The designed target sequence is as follows: snapc4-Target1 GAGATCGAGGTCCAGCTCTC TGG-3 snapc4-Target2 AACTCTATCTTCTCAGTACC TGG-3 snapc4-Target3 CTAGGGTCCTCCAGCTAATG AGG-3 snapc4-Target4 GATAAAATCGCAGAGGCTCT TGG-3 The 3 above, namely 3', is the tail end.

[0041] (3) The forward primers for target gRNA transcription template amplification are: snapc4-T1F TTAATACGACTCACTATAGAGATCGAGGTCCAGCTCTCGTTTTAGAGC TAGAAATAG snapc4-T2F TTAATACGACTCACTATAGAACTCTATCTTCTCAGTACCGTTTTAGAGC TAGAAATAG snapc4-T3F TTAATACGACTCACTATAGCTAGGGTCCTCCAGCTAATGGTTTTAGAG CTAGAAATAG snapc4-T4F TTAATACGACTCACTATAGATAAAATCGCAGAGGCTCTGTTTTAGAGC TAGAAATAG (4) The reverse primer for target gRNA transcription template amplification is: T7gRNA-R AAAAAAAGCACCGACTCGGTGCCAC (5) Design and synthesize target detection primers: The detection primers for target 1, target 2 and target 3 are: snapc4-F1 GTGCTGACGATTTAGAGCTTCC snapc4-R1 AACTGCATTGGTCAGCAAAGTC The detection primers for target 4 are: snapc4-F2GATGATTTGAAAGAGGTTCTGGC snapc4-R2 TGAGGAGATCGTCTTCCTCTTC (6) Verification of snapc4 genome sequence: The DNA sequence containing several target sites was amplified and sequenced, which was consistent with the designed target site sequence.

[0042] (7) SNAPc4 target in vitro transcription concentration T1-gRNA: 5115 ng / μL T2-gRNA: 1851 ng / μL T3-gRNA: 3943 ng / μL T4-gRNA: 2922 ng / μL (8) SNAPc4 target injection The target gRNA and Cas9 protein were mixed and injected into AB wild-type zebrafish embryos. The final concentration of Cas9 protein injection was 800 ng / μL, and the final concentration of gRNA was 320 ng / μL. Microinjection was performed at the 1st embryonic stage of zebrafish, with 1 nL injected into each embryo and about 100 embryos injected into each target site. After 3 dpf, 20 larvae were randomly selected from each group to extract the genome and perform PCR amplification, and then sent for sequencing. The sequencing results are shown in Figure 6 , Figure 7 , Figure 8 as well as Fig. 9 As shown, specifically: A. Figure 6 It showed that Target1 GAGATCGAGGTCCAGCTCTC TGG was cleaved; B. Figure 7 It shows that Target2 AACTCTATCTTCTCAGTACC TGG is cleaved; C. Figure 8 It shows that Target3 CTAGGGTCCTCCAGCTAATG AGG is cleaved; D. Fig. 9 It shows that Target4 GATAAAATCGCAGAGGCTCT TGG is cleaved.

[0043] (9) SnapC4 target cleavage efficiency detection PCR products were cloned by TA, and 15 clones were selected for sequencing. The sequencing results without signal and non-monoclonal were removed, and the target cutting efficiency was calculated. For details, refer to Fig.10 , Fig.11 , Fig.12 as well as Fig.13 , the conclusions are as follows: like Fig.10 As shown, the cutting efficiency of Target1 was 6 / 15; like Fig.11 As shown, the cutting efficiency of Target2 was 7 / 15; like Fig.12 As shown, the cutting efficiency of Target3 was 10 / 18; like Fig.13 As shown, the cutting efficiency of Target4 is 6 / 7.

[0044] In summary, in fact, the specific sequence of the sgRNA of the present invention can be selected from Target1, Target2, Target3 or Target4, any of which undergoes cutting, but the best one is selected based on the cutting efficiency.

[0045] Embodiment 1: The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, specificity score, etc. gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked ( Figure 6-Figure 9 ).

[0046] Fluorescent digestive tract examination of mutants: Real-time in vivo fluorescence imaging of digestive tract peristalsis in zebrafish mutants at 7 days of development showed obvious structural abnormalities in the digestive tract, including narrowing of the intestinal bulb, severe narrowing of the digestive tract cavity, obstructed contraction, and loss of peristalsis ( Figure 2 ). The fluorescence intensity of zebrafish was measured and it was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p <0.0001, indicated by four * in the figure), indicating that the zebrafish digestive tract obtained by this experimental method had obvious congenital obstruction ( Figure 3 ), in experimental results, "*" is usually used to mark statistical significance. Specifically, it means that the difference between two or more groups has reached a certain preset significance level, so that the difference is not caused by random errors, but is of practical significance. The P value is less than or equal to 0.0001: In the statistical significance report of statistics, four asterisks indicate that the P value is less than or equal to 0.0001, which means that the probability of observing the current difference or more extreme differences between the two or more groups of data being compared is very small, and it can almost be considered to be due to real differences rather than accidental factors.

[0047] Pathological analysis of mutants: Crispant homozygous zebrafish larvae screened in Example 1 were grown to day 7. HE staining results showed that snapc4 gene knockdown zebrafish showed a trend of overall digestive tract narrowing, significantly reduced intestinal folds, and the appearance of a large number of alveolar goblet cells ( Figure 4 ).

[0048] Comprehensive mutant fluorescent digestive tract examination and mutant pathological analysis, thus the invention establishes snapc4Mutant zebrafish lines can mimic disease characteristics of congenital duodenal obstruction in newborns.

[0049] The present invention provides Experimental Example 1, Experimental Example 2, Experimental Example 3 and Experimental Example 4, and Experimental Examples 1-4 all use the following same reagents and instruments: Reagents: DEPC water (Solarbio), agar powder Agarose-Molecular Biology Grade (invitrogen), borosilicate glass capillaries (model 1B100F-4, World Precision Instruments, USA), HiScribe™ T7 (catalog number E2040S, New England Biolabs, USA); miRNA isolation kit (catalog number AM1561, Invitrogen, USA); NLS-Cas9 nuclease (model E365, China Jinan Protein Company).

[0050] Instruments: The feeding system used a zebrafish breeding system (ESEN-AW-DU5SS, Beijing Aisheng Company), a Hengsheng biochemical incubator (Shanghai Yuejin Medical Instrument Co., Ltd.), a stereo microscope (P2-CTLA, Japan Nekon Company), a culture dish, a microinjection needle, a microinjection instrument (model PICOSPRITZER® Ⅲ, Parker, USA), and a real-time fluorescence quantitative PCR instrument (CFX96, Bio-Rad Company, USA).

[0051] Experimental Example 1 The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the specific sequence of sgRNA was GATAAAATCGCAGAGGCTCT TGG-3, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of the digestive tract motility of mutant zebrafish was performed; the fluorescence intensity of the zebrafish was measured, and it was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p <0.001, represented by four * in the figure), indicating that the zebrafish digestive tract obtained using this experimental method had obvious congenital obstruction.

[0052] S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0053] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0054] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0055] In the S4 step, 200 pellets were injected into each target point.

[0056] Method for observing the situation under fluorescence microscope in step S6: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0057] In step S7 snapc4Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0058] snapc4 Mutant zebrafish larvae were 6-7 days old.

[0059] The specific sequence of the sgRNA selected for this experimental example is GAGATCGAGGTCCAGCTCTCTGG, and it is the tail end, because from the above target design module, it is known that the cutting efficiency of the selected Target1 is 6 / 15. Although the efficiency is not high, cutting still occurs, so it can be selected.

[0060] Experimental Example 2 The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the specific sequence of sgRNA was GATAAAATCGCAGAGGCTCT TGG-3, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4Real-time in vivo fluorescence imaging of the digestive tract motility of mutant zebrafish was performed; the fluorescence intensity of the zebrafish was measured, and it was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p <0.001, represented by four * in the figure), indicating that the zebrafish digestive tract obtained using this experimental method had obvious congenital obstruction.

[0061] S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0062] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0063] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0064] In the S4 step, 200 pellets were injected into each target point.

[0065] Method for observing the situation under fluorescence microscope in step S6: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0066] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0067] snapc4 Mutant zebrafish larvae were 6-7 days old.

[0068] The specific sequence of the sgRNA selected for this experimental example is AACTCTATCTTCTCAGTACCTGG, and it is the tail end, because from the above-mentioned target design module, it is known that the cutting efficiency of the selected Target2 is 7 / 15. Although the efficiency is not high, cutting still occurs, so it can be selected.

[0069] Experimental Example 3 The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the specific sequence of sgRNA was GATAAAATCGCAGAGGCTCT TGG-3, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of the digestive tract motility of mutant zebrafish was performed; the fluorescence intensity of the zebrafish was measured, and it was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p <0.001, represented by four * in the figure), indicating that the zebrafish digestive tract obtained using this experimental method had obvious congenital obstruction.

[0070] S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0071] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0072] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0073] In the S4 step, 200 pellets were injected into each target point.

[0074] Method for observing the situation under fluorescence microscope in step S6: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0075] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0076] snapc4 Mutant zebrafish larvae were 6-7 days old.

[0077] The specific sequence of the sgRNA selected for this experimental example is CTAGGGTCCTCCAGCTAATGAGG, and it is the tail end, because from the above target design module, it is known that the cutting efficiency of the selected Target3 is 10 / 18. Although the efficiency is not high, cutting still occurs, so it can be selected.

[0078] Experimental Example 4 The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish snapc4On the amino acid domain of the gene, the specific sequence of sgRNA was GATAAAATCGCAGAGGCTCT TGG-3, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining snapc4 mutant zebrafish; S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of the digestive tract motility of mutant zebrafish was performed; the fluorescence intensity of the zebrafish was measured, and it was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p <0.001, represented by four * in the figure), indicating that the zebrafish digestive tract obtained using this experimental method had obvious congenital obstruction.

[0079] S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

[0080] In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

[0081] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

[0082] In the S4 step, 200 pellets were injected into each target point.

[0083] Method for observing the situation under fluorescence microscope in step S6: snapc4 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0084] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0085] snapc4 Mutant zebrafish larvae were 6-7 days old.

[0086] The specific sequence of the sgRNA selected for this experimental example is GATAAAATCGCAGAGGCTCTTGG, and it is the tail end, because from the above-mentioned target design module, it is known that the cutting efficiency of the selected Target4 is 6 / 7, and cutting occurs with the highest efficiency, so it can be selected and is the most preferred.

[0087] Beneficial effects of the present invention: The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that the Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked. The present invention established snapc4 After the mutant zebrafish line is finally tested and analyzed in steps S6-S7, it can simulate the disease characteristics of congenital duodenal obstruction in newborns.

[0088] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for establishing a zebrafish model for simulating duodenal obstruction, characterized in that: The following steps are involved: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the sgRNA specific sequence is GAGATCGAGGTCCAGCTCTCTGG or AACTCTATCTTCTCAGTACCTGG or CTAGGGTCCTCCAGCTAATGAGG or GATAAAATCGCAGAGGCTCTTGG, and the primers are synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mix the gRNA and Cas9 mRNA recovered in step S3 to make the final concentration of gRNA reach 320 ng / μL and Cas9 mRNA reach 800 ng / μL, then microinject into one-cell stage zebrafish embryos, injecting 180 to 220 pieces per target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injection batch embryos with double peaks in the sequencing results into a breeding system (Beijing Aisheng Company). When they are sexually mature, the next generation of embryos is screened to detect effective mutant types of zebrafish, thereby obtaining snapc4 Mutant zebrafish.

2. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 1, characterized in that: In step S1, the sgRNA uses a specific sequence GATAAAATCGCAGAGGCTCTTGG.

3. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 2, characterized in that: The following steps are also included: S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

4. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3, characterized in that: In step S1, the sgRNA is synthesized and read as a specific sequence of the tail end of the pentose in the nucleotide, with a hydroxyl group.

5. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3, characterized in that: In step S1, the gRNA target sequence is designed in zebrafish snapc4 Amino acid domains of genes.

6. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3, characterized in that: The gRNA and Cas9 mRNA in the S4 were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA being 320 ng / μL and the Cas9 mRNA being 800 ng / μL.

7. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3, characterized in that: The injected batch embryos with bimodal sequencing results in step S5 are placed in a breeding system and raised until sexual maturity, and then the next generation of embryos are screened to detect effective mutant zebrafish.

8. The method for establishing a zebrafish model for simulating duodenal obstruction according to any one of claims 3 to 6, characterized in that: The method for observing the situation under a fluorescence microscope in step S6 is as follows: snapc4 Mutant zebrafish: 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then DMSO dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the zebrafish culture water was used for 3 washes, and after washing, the samples were fixed with low-melting point glue and finally photographed using a stereo microscope.

9. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 7, characterized in that: In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, embedded, and sectioned at a thickness of 4 μm. The digestive tract pathology was observed under a bright-field microscope after HE staining.

10. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 8, characterized in that: Said snapc4 Mutant zebrafish larvae were 6-7 days old.

Images