Single-stranded nucleic acid binding protein t4 gp32 mutants and uses thereof
By performing specific amino acid mutations on the T4 gp32 protein, its binding affinity and stability to DNA were improved, solving the problems of low activity and low stability of the existing T4 gp32 protein in the RPA reaction, and achieving a significant reduction in RPA reaction time and an improvement in efficiency.
Patent Information
- Application Number
- CN202510139470.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-08
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2045-02-08
AI Technical Summary
The existing T4 gp32 single-stranded DNA binding protein has low binding efficiency and stability, resulting in poor performance in industrial production and application, especially in recombinase polymerase amplification (RPA) reactions, where it exhibits low activity, low stability, and low expression levels and purity.
By performing specific site mutations in the amino acid sequence of the wild-type T4 gp32 protein, its binding affinity and stability to DNA can be improved. Specifically, this includes amino acid substitutions or combination mutations at positions 62, 78, 80, 100, 140, and 186, resulting in T4 gp32 protein variants with improved characteristics.
The mutated T4 gp32 protein variant significantly improves the efficiency of the RPA reaction and shortens the reaction time, making it more suitable for rapid nucleic acid testing in primary laboratories and on-site.
Smart Images

Figure BDA0005264389920000071 
Figure BDA0005264389920000081 
Figure BDA0005264389920000091
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular diagnosis and genetic engineering, in particular to a single-stranded nucleic acid binding protein T4 gp32 mutant and application thereof. BACKGROUND
[0002] T4 gp32 protein is a single-stranded DNA binding protein from T4 bacteriophage, which is a typical single-stranded DNA binding protein and has been widely studied. It plays a core role in the replication, recombination and repair of T4 bacteriophage. It can bind to the exposed ssDNA after the dsDNA is unwound, maintain the stability of the ssDNA, and prevent the ssDNA from forming secondary structure or being degraded by nucleases. T4 gp32 protein can improve the efficiency of reverse transcription in RT-PCR, enhance the activity of T4 DNA polymerase and improve the yield of PCR. Although the existing gp32 single-stranded DNA binding protein has binding activity, the binding efficiency needs to be improved, and the unit cell expression amount of gp32 single-stranded DNA binding protein in industrial production is low, which also makes its use effect relatively poor in industrial production. SUMMARY
[0003] To solve at least one of the above problems, the present disclosure mutates the wild-type T4 gp32 protein (the amino acid sequence is shown as SEQ ID NO: 2), and screens out a T4 gp32 protein variant with significantly improved DNA binding affinity and stability.
[0004] According to one aspect of the present disclosure, a T4 gp32 protein variant with improved DNA binding affinity and stability is provided, the T4 gp32 protein variant has amino acid mutations at one or more of positions 62, 78, 80, 86, 100, 140 and 186 of the amino acid sequence shown as SEQ ID NO: 2, and the T4 gp32 protein variant has at least 85% sequence identity to the amino acid sequence shown as SEQ ID NO: 2.
[0005] In some embodiments, the T4 gp32 protein variant has the amino acid V at position 62 substituted to C.
[0006] In some embodiments, the T4 gp32 protein variant has the amino acid S at position 78 substituted to C.
[0007] In some embodiments, the T4 gp32 protein variant has the amino acid T at position 80 substituted to C.
[0008] In some embodiments, the T4 gp32 protein variant has the amino acid S at position 86 substituted with C.
[0009] In some embodiments, the T4 gp32 protein variant has the amino acid N at position 100 substituted with any one of A, I, L, V, F, W, Y, C, Q, M, S, T, R, H, K, D, E, G, or P.
[0010] In some embodiments, the T4 gp32 protein variant has the amino acid N at position 100 substituted with any one of R, H, or K.
[0011] In some embodiments, the T4 gp32 protein variant has the amino acid N at position 100 substituted with R.
[0012] In some embodiments, the T4 gp32 protein variant has the amino acid G at position 140 substituted with any one of A, I, L, V, F, W, Y, N, C, Q, M, S, T, R, H, K, D, E, or P.
[0013] In some embodiments, the T4 gp32 protein variant has the amino acid G at position 140 substituted with P.
[0014] In some embodiments, the T4 gp32 protein variant has the amino acid Y at position 186 substituted with any one of A, I, L, V, F, W, N, C, Q, M, S, T, R, H, K, D, E, G, or P.
[0015] In some embodiments, the T4 gp32 protein variant has the amino acid Y at position 186 substituted with any one of R, H, or K.
[0016] In some embodiments, the T4 gp32 protein variant has the amino acid Y at position 186 substituted with R.
[0017] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or more of positions 62, 78, 80, and 86 of the amino acid sequence set forth in SEQ ID NO: 2.
[0018] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 62 and 80 of the amino acid sequence set forth in SEQ ID NO: 2.
[0019] In some embodiments, the T4 gp32 protein variant has an amino acid mutation at one or both of positions 78 and 86 of the amino acid sequence set forth in SEQ ID NO: 2.
[0020] In some embodiments, the T4 gp32 protein variant has amino acid mutations at positions 62 and 80 of the amino acid sequence set forth in SEQ ID NO: 2.
[0021] In some embodiments, the T4 gp32 protein variant has amino acid mutations at positions 78 and 86 of the amino acid sequence set forth in SEQ ID NO: 2.
[0022] In some embodiments, the T4 gp32 protein variant has one or more of V62C, S78C, T80C, S86C, N100R, G140P, and Y186R amino acid mutations relative to the amino acid sequence set forth in SEQ ID NO: 2.
[0023] In some embodiments, the T4 gp32 protein variant has one or both of V62C and T80C amino acid mutations relative to the amino acid sequence set forth in SEQ ID NO: 2.
[0024] In some embodiments, the T4 gp32 protein variant has one or both of S78C and S86C amino acid mutations relative to the amino acid sequence set forth in SEQ ID NO: 2.
[0025] In some embodiments, the T4 gp32 protein variant has one or both of V62C and T80C, or S78C and S86C amino acid mutations relative to the amino acid sequence set forth in SEQ ID NO: 2.
[0026] In some embodiments, the T4 gp32 protein variant has one or more of V62C and T80C, S78C and S86C, N100R, G140P, and Y186R amino acid mutations relative to the amino acid sequence set forth in SEQ ID NO: 2.
[0027] According to yet another aspect of the present disclosure, there is provided a nucleic acid molecule encoding the above-mentioned T4 gp32 protein variant of the present disclosure.
[0028] According to yet another aspect of the present disclosure, there is provided an expression vector comprising the above-mentioned nucleic acid molecule of the present disclosure.
[0029] In some embodiments, the expression vector includes prokaryotic expression vectors and eukaryotic expression vectors.
[0030] In some embodiments, the eukaryotic expression vector includes yeast expression vectors, mammalian expression vectors, insect expression vectors, and the like.
[0031] According to yet another aspect of the present disclosure, there is provided a host cell comprising the above-mentioned nucleic acid molecule and / or expression vector of the present disclosure.
[0032] In some embodiments, the host cell is selected from a prokaryotic cell and a eukaryotic cell.
[0033] In some embodiments, the prokaryotic cell comprises a bacterial cell.
[0034] In some embodiments, the bacteria comprises Escherichia coli, Streptomyces, Bacillus subtilis;
[0035] In some embodiments, the eukaryotic cell comprises a yeast cell, a mammalian cell, an insect cell, and the like.
[0036] In some embodiments, the mammal is selected from a human, a monkey, a mouse, a rat, a hamster, a goat, a sheep, a cow, a pig, a dog, a cat, and the like.
[0037] In some embodiments, the bacterial cell comprises B. subtilis RIK1285 cell, T1 E. coli, Bl21(DE3) E. coli, WB600 cell, DH5a cell, BL21 cell, DH10Bac cell, XL10-Gold cell, TG1 cell, Stbl2 cell, BJ5183 cell, HB101 cell, or Turbo cell.
[0038] According to yet another aspect of the present disclosure, there is provided a composition comprising the T4 gp32 protein variant as described.
[0039] According to yet another aspect of the present disclosure, there is provided a kit comprising the T4 gp32 protein variant as described.
[0040] According to yet another aspect of the present disclosure, there is provided a method of recombinase polymerase amplification (RPA), the method comprising using the T4 gp32 protein variant for recombinase polymerase amplification.
[0041] According to yet another aspect of the present disclosure, there is provided the use of the T4 gp32 protein variant, the nucleic acid molecule, the expression vector, the host cell, the composition, the kit, and the method of expressing the T4 gp32 protein variant in any one or more of the following:
[0042] 1) binding to DNA;
[0043] 2) increasing the affinity or stability of binding to DNA;
[0044] 3) recombinase polymerase amplification;
[0045] 4) improve the efficiency of recombinase polymerase amplification;
[0046] 5) reduce the time of recombinase polymerase amplification reaction.
[0047] Beneficial effects:
[0048] The present disclosure uses point mutation technology to screen T4 gp32 protein variants, and the affinity and stability of the mutants to DNA are significantly improved compared with the wild type. The T4 gp32 protein variants screened by the present disclosure can significantly improve the efficiency of RPA reaction, greatly shorten the reaction time of RPA reaction, and make it more suitable for basic laboratories and on-site rapid nucleic acid detection. BRIEF DESCRIPTION OF DRAWINGS
[0049] Figure 1 Electropherograms showing the activity of wild-type gp32 and gp32 mutants: S25C+E30C, W31C+F135C, S50C+P57C, V62C+T80C tested in 30 min RPA amplification reaction.
[0050] Figure 2 Electropherograms showing the activity of wild-type gp32 and gp32 mutant S78C+S86C tested in 30 min RPA amplification reaction.
[0051] Figure 3 Electropherograms showing the activity of wild-type gp32 and gp32 mutants S25C+E30C, W31C+F135C, S50C+P57C and P88C+F235C tested in 30 min RPA amplification reaction.
[0052] Figure 4 Electropherograms showing the activity of wild-type gp32 and gp32 mutants: V62C+T80C, S78C+S86C tested in 16 min RPA amplification reaction.
[0053] Figure 5 Electropherograms showing the activity of wild-type gp32 and mutants: N100R, G140P and Y186R tested in 30 min RPA amplification reaction.
[0054] Figure 6 Electropherograms showing the activity of wild-type gp32 in 30 min and 16 min RPA amplification reaction, and mutant N100R tested in 16 min RPA amplification reaction.
[0055] Figure 7 Electropherograms showing the activity of wild-type gp32 in 30 min and 16 min RPA amplification reaction, and mutant G140P tested in 16 min RPA amplification reaction.
[0056] Figure 8 Electrophoretogram showing the activity of wild-type gp32 in 30 min and 16 min RPA amplification reactions, and mutant Y186R tested in 16 min RPA amplification reactions. DETAILED DESCRIPTION
[0057] Recombinase polymerase isothermal amplification technology (RPA) is a nucleic acid isothermal amplification technology developed by TwistDx Company in the United Kingdom in 2006, which has many advantages compared with PCR technology. RPA amplification does not require high temperature to denature the template, so it can quickly complete nucleic acid amplification in 20-30 minutes at a temperature range of 37-42°C, and the sensitivity and specificity are similar to PCR. Therefore, RPA technology has developed rapidly in recent years. In the RPA reaction, gp32 protein binds to the unwound double-stranded DNA and maintains its stability. Therefore, gp32 protein is a key protein in RPA reaction.
[0058] With the further development of RPA reaction, it is becoming more and more important to improve the reaction effect. However, in practical application, gp32 has the problems of low RPA activity, low stability, low expression amount of protein, and low purity. This leads to poor effect of gp32 in PRA reaction, and also limits the industrial application of gp32.
[0059] The present disclosure improves the stability and activity of the protein in recombinant protein production by predicting the molecular structure of T4 gp32 protein (referred to as gp32 protein) binding to single-stranded DNA and virtual mutation screening.
[0060] The present disclosure improves the binding affinity and stability of the protein to DNA by predicting the structure of the protein molecule and optimizing the mutation. The activity of the protein in RPA is enhanced.
[0061] The RPA activity of the mutant of T4 gp32 protein screened by the present disclosure is significantly improved compared with the wild type, and the reaction effect is still good after the time is shortened. It shows that the mutant can greatly shorten the reaction time of RPA reaction.
[0062] DEFINITIONS
[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. For purposes of interpreting this specification, the following definitions will apply and, unless otherwise indicated, singular articles shall include the plural and vice versa.
[0064] The expressions "a" and "an" as used herein include plural references unless the context clearly dictates otherwise.
[0065] The expression "about" as used herein is as understood by one of ordinary skill in the art and varies according to the context in which it is used. If one of ordinary skill in the art cannot tell from the context in which the term is used whether it is intended to refer to a particular value plus or minus 10%, then "about" will mean the particular value plus or minus 10%.
[0066] In the present disclosure, the term "DNA", the full name of "DeoxyriboNucleic Acid" (abbreviated as DNA), is one of the four biological macromolecules of nucleic acid contained in biological cells. DNA carries the genetic information necessary for the synthesis of RNA and proteins, and is an essential biological macromolecule for the development and normal operation of organisms. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose, and phosphates. There are four bases: adenine (A), guanine (G), thymine (T), and cytosine (C).
[0067] In the present disclosure, the term "upstream primer" is an oligonucleotide that undergoes uninterrupted elongation along the negative strand; the term "downstream primer" used in the present invention is an oligonucleotide that undergoes uninterrupted elongation along the positive strand. The positive strand, also known as the sense strand or coding strand, is generally located at the upper end of double-stranded DNA, with the direction from left to right being 5'-3', and the base sequence is basically the same as that of the mRNA of the gene; the primer combined with this strand is the downstream primer; the negative strand, also known as the antisense strand or non-coding strand, is complementary to the positive strand, and the primer combined with this strand is the upstream primer. It should be understood that when the designation of the sense strand and the antisense strand is interchanged, the corresponding upstream primer and downstream primer designations can also be interchanged.
[0068] As used herein, the term "Single-Strand Binding Protein (SSB)": a protein that can bind to single-stranded DNA, usually plays an important role in processes such as DNA replication, repair, recombination, etc. Exemplary single-strand binding proteins include, but are not limited to, E. coli SSB, T4 gp32, T7 gene 2.5 SSB, phage π29 SSB, RB69 phage gp32 protein, and homologous proteins or protein complexes thereof, or functional variants thereof.
[0069] As used herein, the term "T4 gp32 protein" or "gp32 protein" is a single-stranded DNA binding protein from T4 phage, which plays a key role in DNA replication. It prevents DNA annealing and maintains the stability of single-stranded DNA by binding to single-stranded DNA, thereby promoting DNA replication and repair.
[0070] As used herein, the term "mutant" or "variant" refers to a protein variant produced by altering its original protein sequence through genetic mutation techniques. Mutants are often used to study the relationship between protein structure and function.
[0071] As used herein, the term "Recombinase Polymerase Amplification (RPA)" is a molecular biology technique for DNA amplification that uses specific recombinase, polymerase and accessory proteins to perform efficient DNA amplification at room temperature. The technique mainly includes: at a constant temperature of 37-42°C, the recombinase can be tightly combined with primer DNA to form an enzyme and primer polymer, when the primer searches for a completely complementary sequence on the template DNA, with the help of single-stranded DNA binding protein (SSB), the template DNA is denatured, and under the action of strand displacement DNA polymerase, a new DNA complementary chain is formed. The reaction product is also exponentially increased, and the amplified fragment can be detected by agarose gel electrophoresis within 1 hour. Exemplary recombinases include but are not limited to RecA protein, T4 UvsX protein, RB69 phage UvsX protein and its homologous proteins or protein complexes, or their functional variants. Exemplary strand displacement DNA polymerases include but are not limited to Bsu (Bacillus subtilis), Bst (Bacillus stearothermophilus) polymerase, exo-Klenow polymerase or large fragments of sequencing grade T7 exo-polymerase.
[0072] In some embodiments, the recombinase polymerase amplification will use an "accessory protein" that includes any protein capable of interacting with the recombinase and single-stranded binding protein to facilitate the nucleation function of UvsX filaments on ssDNA. Exemplary accessory proteins include but are not limited to T4 UvsY, RB69 phage UvsY protein, E. coli RecO, E. coli RecR, any homologous protein or protein complex from any door, and their functional variants.
[0073] As used herein, the term "sequence identity" is used in the context of the present disclosure to describe the degree of similarity between two nucleotide sequences or between two amino acid sequences, and is synonymous with the meaning of "percent identity". The percent homology of two sequences can be calculated after aligning the two sequences, by dividing the number of positions where the residues are identical by the total length of the aligned sequences and multiplying by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, for example the BLAST suite available on the NCBI website. As used herein, having "at least 85% sequence identity" to a sequence means having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to that sequence.
[0074] The percent sequence identity can be calculated by determining the number of positions at which the same amino acid residue or nucleic acid base occurs in both sequences, to give the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to give the percent sequence identity. Comparison of sequences and determination of the percent sequence identity between two sequences can be done using software readily available for online use and download. Suitable software programs are available from various sources for alignment of protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST suite of programs available on the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparison between two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs, and are also available on www.ebi.ac.uk / Tools / psa.
[0075] In order to make the objects, technical solutions and advantages of the present application clearer, further specific embodiments of the present application are described in detail below. The specific embodiments described herein are only used to explain the present application and do not constitute any limitation to the present application. The actual protection scope of the present application is set forth in the claims. In the following description, the description of well-known structures and techniques is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and techniques are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are not mentioned the source, are commercially available on the market, or are obtained by conventional methods known to those skilled in the art.
[0076] Embodiments
[0077] Example 1: Construction of mutants
[0078] 1. The DNA template of pet28 vector-wild type gp32 (the sequence is shown as SEQ ID NO: 1) was amplified by PCR to obtain the expression plasmid of gp32 protein mutant, and the reaction system is shown in Table 1. The amino acid sequence of wild type gp32 protein is shown as SEQ ID NO: 2.
[0079] Table 1. Amplification reaction system
[0080] Component Volume Wild-type gp32 template (1 x 10 9 copies) 1 μL Forward primer (10 uM) 1 μL Reverse primer (10 uM) 1 μL 2 x TransStar" Fast Pfu PCR Super Mix (full type gold) 25 μL ddH2O Supplemented to 50 μL
[0081] The amplification procedure of PCR was as follows: pre-denaturation 98℃ for 3 min, denaturation 98℃ for 15 s, annealing 62℃ for 15 s, extension 72℃ for 3 min, cycle 30, and final extension 72℃ for 5 min.
[0082] The primer sequence used in Table 1 is shown in Table 2.
[0083] Table 2. Primer sequence used in amplification
[0084]
[0085]
[0086]
[0087] 2. The reaction product was subjected to 2% agarose gel electrophoresis to check whether the band was correct.
[0088] 3. The product was recovered by using DNA gel rapid purification kit (full gold), and 30 μL of the recovered product was added to DMT Enzyme (full gold) 0.6 μL for digestion of the template at 37℃ in water bath for 1 h.
[0089] 4. After the digestion of the template, 10 μL of the product was added to 10 μL of 2×MultiF Seamless Assembly Mix (Abudant) for circularization of the linear DNA at 50℃ in water bath for 15 min.
[0090] 5. Take 10 μL of the recombined product and transform into 50 μL (full-competent) T1 E. coli competent cells, put on ice for 30 min, then heat shock at 42 °C for 45 s, and put on ice for 2 min. Add 500 μL of LB medium and incubate at 37 °C, 200 rpm for 1 h. Centrifuge at 8000 x g for 1 min to collect the bacteria, resuspend 100 μL of the supernatant, and spread on a LB plate with kanamycin. Incubate at 37 °C for 12 h. Pick a single colony, incubate at 37 °C, 220 rpm for 12 h, and then take a sample for sequencing.
[0091] 6. Take 10 μL of the recombined product and transform into 50 μL (full-competent) T1 E. coli competent cells, put on ice for 30 min, then heat shock at 42 °C for 45 s, and put on ice for 2 min. Add 500 μL of LB medium and incubate at 37 °C, 200 rpm for 1 h. Centrifuge at 8000 x g for 1 min to collect the bacteria, resuspend 100 μL of the supernatant, and spread on a LB plate with kanamycin. Incubate at 37 °C for 12 h. Pick a single colony, incubate at 37 °C, 220 rpm for 12 h, and then take a sample for sequencing.
[0092] Example 2: Protein expression and purification
[0093] 1. Take 10 μL of the recombined product and transform into 50 μL (full-competent) T1 E. coli competent cells, put on ice for 30 min, then heat shock at 42 °C for 45 s, and put on ice for 2 min. Add 500 μL of LB medium and incubate at 37 °C, 200 rpm for 1 h. Centrifuge at 8000 x g for 1 min to collect the bacteria, resuspend 100 μL of the supernatant, and spread on a LB plate with kanamycin. Incubate at 37 °C for 12 h. Pick a single colony, incubate at 37 °C, 220 rpm for 12 h, and then take a sample for sequencing.
[0094] 2. Take 1.2 mL of the bacteria and inoculate into 120 mL of LB medium, add 120 μL of kanamycin to a final concentration of 50 ug / ml, and incubate at 37 °C, 220 rpm for 4-5 h. Measure the OD value.
[0095] 3. When the OD value reaches 0.7-0.8, add 0.005 mM-1 mM IPTG inducer (Guangzhou Saiguo Biological Technology Co., Ltd.) to the shake flask according to the experimental design, and start induction. According to the experimental design, place the shake flask in a shaker at 12-37 °C and incubate for 20 h.
[0096] 4. Centrifuge the bacterial solution at 8000 x g for 5 min, and then take the supernatant for cell disruption.
[0097] 5. After cell disruption, centrifuge the supernatant at 10000 x g for 1 h, and then purify it using a nickel column.
[0098] 6. Equilibrate the nickel column by washing it with 3 column volumes of Buffer 1 (50 mM disodium hydrogen phosphate, 500 mM sodium chloride, pH = 7.2).
[0099] 7. The supernatant was passed through the nickel column 3 times to ensure that all the protein was bound to the column.
[0100] 8. The nickel column was washed with 10 column volumes of wash buffer (50 mM NaH2P04, 500 mM NaCl, 60 mM imidazole) to remove the impurities.
[0101] 9. The gp32 protein was eluted using 10 mL of elution buffer (50 mM NaH2P04, 500 mM NaCl, 500 mM imidazole).
[0102] 10. The nickel column was washed with 3 column volumes of final elution buffer (50 mM NaH2P04, 500 mM NaCl, 1 M imidazole).
[0103] 11. The protein was concentrated using a 10 kDa concentrator tube. The protein was concentrated to about 1-5 mg / mL using a protein storage buffer (10 mM Tris-HCl pH = 7.5, 300 mM NaCl, 1 mM DTT, 0.1 mM EDTA).
[0104] 12. The concentration of the protein was determined using the (Thermo) BCA Protein Assay Kit.
[0105] The protein expressed according to the above procedure carries a His tag and a cleavage site. The amino acid sequence of the wild-type gp32 protein expressed with a His tag and a cleavage site is shown in SEQ ID NO: 3.
[0106] Example 3: RPA reaction process
[0107] The primer pair was used to amplify HPV-16 (SEQ ID NO: 46) as a template for RPA amplification.
[0108] Primer pair sequences:
[0109] Upstream primer (5'-3'): CTACACCTAGTGGTTCTATGGTTACCTCTGAT (SEQ ID NO: 47);
[0110] Downstream primer (5'-3'): AAACCTATAAGTATCTTCTAGTGTGCCTCCTG (SEQ ID NO: 48).
[0111] The reaction system is shown in Table 3.
[0112] Table 3. RPA reaction system
[0113] System Amount of use μL 2 x buffer 25 Upstream primer (10 μM) 1.5 Downstream primer (10 μM) 1.5 Creatine kinase (2 μg / μL) (Yoshitomi) 2.5 gp32 (4 μg / μL) 2.5 uvsX (3 μg / μL) 2 uvsY (1 μg / μL) 1 Bsu (1 μg / μL) 1.5 hpv template (1 x 10 8 copies / μl)]]> 1 ddH2O Supplemented to 50 MgCl2(280 mM) (Aldrich) 2.5
[0114] The 2x buffer formula is: 60mM Tris-HCl pH=8; potassium acetate 80mM; DTT (Aladdin) 4mM; sodium phosphocreatine (Shenshi) 40mM; PEG35K (Hefei Qiansheng) 15%; ATP (ShaoYuan Technology (Shanghai)) 5mM; dNTP (Tianjin Olive Biotechnology Co., Ltd.) 0.9mM. The amino acid sequence of uvsX is shown in SEQ ID NO: 49, the amino acid sequence of uvsY is shown in SEQ ID NO: 50, and the amino acid sequence of Bsu is shown in SEQ ID NO: 51.
[0115] RPA reaction procedure:
[0116] 1. Add all components except gp32 and MgCl2 in a 1.5mL EP tube.
[0117] 2. Add wild-type and mutant gp32 in different EP tubes according to the experimental design.
[0118] 3. Add MgCl2 in the EP tube cap, and cover the tube cap.
[0119] 4. After centrifugation, start the reaction in a 41℃ water bath for 30 minutes.
[0120] 5. After the reaction is completed, add 50μL DNA extraction phenol (Solabio) to terminate the reaction, mix gently by hand, and then centrifuge at 12000xg for 5 minutes to extract the supernatant.
[0121] 6. Electrophorese the supernatant in 2% agarose gel for 40 minutes, and observe the band results on a blue light gel cutter.
[0122] Example 4: Test the reaction effect of 6 gp32 mutants on improving RPA
[0123] According to the RPA procedure of Example 3, different gp32 mutants (mutants: S25C+E30C, W31C+F135C, S50C+P57C, V62C+T80C, S78C+S86C, P88C+F235C) are used to replace wild-type gp32 to test RPA activity, and the RPA reaction time is 30min. The control group (NTC) does not add hpv template.
[0124] The results are as follows: Figures 1 to 3As shown, mutant V62C+T80C and mutant S78C+S86C have better performance than wild type (WT). Using ImageJ software to calculate the gray value, it is found that V62C+T80C is 170% of WT and S78C+S86C is 214% of WT. Mutants S25C+E30C, W31C+F135C, S50C+P57C and P88C+F235C have lower or no RPA activity compared with wild type.
[0125] Further, 16 min RPA reactions were performed using mutant V62C+T80C and mutant S78C+S86C, respectively, and the results are shown in Figure 4 As shown: mutant V62C+T80C and mutant S78C+S86C also have good reaction effect when the RPA reaction time is 16 min. Mutant V62C+T80C has 257% of WT reaction for 16 min and 149% of WT reaction for 30 min. Mutant S78C+S86C has 192% of WT reaction for 16 min and 129% of WT reaction for 30 min. Mutants can effectively shorten the time required for RPA reaction.
[0126] Example 5: Test 12 gp32 mutants to improve RPA reaction effect
[0127] Using the RPA procedure of Example 3, different gp32 mutants (mutants: E30R, W31K, N100R, Y106K, Y106R, S107R, F139R, F139K, F139G, F139Y, G140P and Y186R) were used to replace wild type gp32 to test RPA activity, and the RPA reaction time was 30 min. The control group (NTC) did not add hpv template.
[0128] The results are shown in Figure 5 As shown: mutants N100R, G140P and Y186R have better performance than wild type. Using ImageJ software to calculate the gray value, it is found that N100R is 175% of WT, G140P is 222% of WT, and Y186R is 223% of WT.
[0129] Further, 16 min RPA reactions were performed using mutant N100R, G140P and Y186R, respectively, and the results are shown in Figures 6 to 8As shown, the gp32 mutants also have good reaction results when the RPA reaction time is 16 min. The N100R mutant has 153% of the WT reaction result for 16 min and 72% of the WT reaction result for 30 min. The G140P mutant has 174% of the WT reaction result for 16 min and 95% of the WT reaction result for 30 min. The Y186R mutant has 163% of the WT reaction result for 16 min and 104% of the WT reaction result for 30 min. The mutants can effectively shorten the time required for RPA reaction.
[0130] The technical solutions of the present application are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present application fall within the protection scope of the present application.
Claims
1. A T4 gp32 protein variant having enhanced affinity or stability for DNA binding, the T4 gp32 protein variant being obtained by substituting amino acid V at position 62 of the T4 gp32 protein as shown in SEQ ID NO.2 with C and amino acid T at position 80 with C.
2. A nucleic acid molecule encoding the T4 gp32 protein variant of claim 1.
3. An expression vector comprising the nucleic acid molecule of claim 2.
4. A host cell comprising the nucleic acid molecule of claim 2 and / or the expression vector of claim 3.
5. A kit comprising the T4 gp32 protein variant as described in claim 1.
6. Use of the T4 gp32 protein variant of claim 1, the nucleic acid molecule of claim 2, the expression vector of claim 3, the host cell of claim 4, and the kit of claim 5 in any one or more of the following: 1) Recombinase polymerase amplification; 2) Improve the amplification efficiency of recombinase polymerase.
7. Use of the T4 gp32 protein variant of claim 1, the nucleic acid molecule of claim 2, the expression vector of claim 3, the host cell of claim 4, and the kit of claim 5 in reducing recombinase polymerase amplification reaction time.
Citation Information
Patent Citations
GP32 protein mutant, recombinant vector as well as construction method and application of GP32 protein mutant and recombinant vector
CN114230644A
T4GP32 protein mutant and application thereof
CN117964713A