Single tube one-step nucleic acid detection method for bacteroide thetaiotaobrica and kit therefor

Abstract

The application discloses a single-tube one-step nucleic acid detection method for Pectobacterium brasiliense and a kit used in the method. The application relates to the field of vegetable disease detection, and provides a nucleic acid detection reagent for detecting Pectobacterium brasiliense, which comprises reagent A and reagent B; the reagent A is a reagent for RPA amplification of target nucleic acid of Pectobacterium brasiliense; the reagent B is a reagent for CRISPR / Cas detection of the target nucleic acid; the reagent B contains polyvinyl alcohol. The application realizes pre-preparation and room-temperature storage of a reaction system, does not need on-site preparation, is simple to operate, needs only one-step pipetting for reaction, avoids aerosol pollution, and is low in cost, does not need large-scale instrument equipment, and can complete detection of Pectobacterium brasiliense without high-energy-consumption temperature control equipment. The application provides an efficient, reliable and economical on-site detection solution for diagnosis of vegetable diseases caused by Pectobacterium brasiliense.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of vegetable disease detection, in particular to a single-tube one-step nucleic acid detection method for Xanthomonas campestris pv. campestris and a kit therefor. BACKGROUND

[0002] Xanthomonas campestris pv. campestris (Xcc) is a pathogenic bacterium that seriously harms vegetable crops and can cause soft rot of various vegetables, causing great losses to agricultural production. This bacterium mainly destroys plant cell walls by secreting pectinase, leading to water-stained softening and rotting of the affected tissues, accompanied by a foul odor. Initial symptoms include small water-stained spots on leaves or stems, which then rapidly expand into brown or black rot patches, and in severe cases, the entire plant wilts and dies. Pectobacterium brasiliense Current disease management faces dual challenges: on the one hand, long-term reliance on chemical control leads to pathogen resistance; on the other hand, existing detection techniques have limitations.

[0003] Traditional bacterial detection methods involve isolating and culturing the pathogen, then observing its colony morphology under a microscope to make a preliminary identification of the pathogen. Immunological methods are limited by the antibody preparation period (several months). Molecular detection is sensitive and specific, but requires specialized equipment (such as a PCR instrument) and technical personnel. In particular, for grassroots applications, existing technologies cannot meet the detection needs of "on-site, rapid, and simple."

[0004] In recent years, the combination of CRISPR-Cas systems and isothermal amplification technology has provided a new approach to on-site detection. However, there are still key bottlenecks in technology integration: 1) direct mixing of RPA and CRISPR / Cas12a can inhibit amplification efficiency; 2) step-by-step operation is prone to aerosol contamination; 3) existing solutions (such as paraffin isolation and temperature-controlled gel) have strict operation requirements and need to be prepared and used immediately. Although there have been patent applications attempting to solve these problems (such as CN117512215A and CN118834977A), the complex temperature control requirements and the need for immediate preparation limit their field applicability.

[0005] SUMMARY

[0006] The purpose of the present application is to provide a single-tube one-step nucleic acid detection method for Xanthomonas campestris pv. campestris and a kit therefor.

[0007] In a first aspect, the present application claims a nucleic acid detection reagent for detecting Xanthomonas campestris pv. campestris.

[0008] ​The nucleic acid detection reagent for detecting Pectobacterium brasiliense claimed in the present application comprises (or consists of) reagent A and reagent B; the reagent A is a reagent for RPA amplification of a target nucleic acid of Pectobacterium brasiliense; the reagent B is a reagent for CRISPR / Cas detection of the target nucleic acid; the reagent B contains polyvinyl alcohol.

[0009] Further, the reagent A can contain a recombinase, a single-strand binding protein, a strand displacement DNA polymerase and an RPA primer pair; the RPA primer pair is used for specific amplification of the target nucleic acid. Still further, the reagent A can also contain a reaction buffer and / or magnesium ions (such as magnesium acetate) for RPA amplification.

[0010] Further, the reagent B can contain polyvinyl alcohol, Cas12a protein, crRNA and fluorescent probe; the crRNA targets the target nucleic acid. Still further, the reagent B can also contain a reaction buffer for CRISPR / Cas detection.

[0011] In some embodiments, the RPA primer pair consists of two single-stranded DNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments, the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3.

[0012] In some embodiments, in the reagent B, the ratio of the polyvinyl alcohol, the Cas12a protein, the crRNA and the fluorescent probe is 30 g: 1 pmol: 1 pmol: 10 pmol.

[0013] In some embodiments, the fluorescent probe is a single-stranded DNA probe labeled with a fluorescent group at one end and a quencher group at the other end. In some embodiments, the fluorescent probe is FAM-TTATT-BHQ1 (the fluorescent group is FAM, labeled at the 5' end; the quencher group is BHQ1, labeled at the 3' end). Accordingly, when detecting, a 488 nm laser light source can be used for irradiation, and a 510 nm long wave pass filter can be used to observe whether the product after RPA-CRISPR / Cas12a system reaction emits fluorescence, so as to determine whether the target nucleic acid is contained in the sample to be detected. The upstream and downstream primers in the reaction system of the RPA amplification reaction are characterized in that they can specifically amplify the target nucleic acid, and the fragment can be recognized by the crRNA, thereby activating the cleavage activity of Cas12a, so that the fluorescent reporter probe with both fluorescent group and quencher group is cleaved to emit fluorescence.

[0014] In some embodiments, the nucleic acid detection reagent is a pre-made reagent (e.g., a ready-to-use reagent). In some embodiments, the nucleic acid detection reagent is a pre-packed pre-made reagent (e.g., a pre-packed ready-to-use reagent). Pre-made property: the preparation of reagent components is completed in advance, mixed and optimized for stability (e.g., freeze-dried packaging), without the need for the experimenter to prepare on site (taking into account the characteristics of "ready-to-use" and "long storage period"). Pre-packed property: the pre-made reagent is directly loaded into a special container (e.g., a PCR tube), forming a "reagent-carrier" integrated unit.

[0015] In some embodiments, the reagent A exists in the form of a freeze-dried microsphere, denoted as RPA freeze-dried microspheres; the reagent B exists in the form of a freeze-dried microsphere, denoted as CRISPR freeze-dried microspheres. Specifically, in some embodiments, the RPA freeze-dried microspheres are obtained by uniformly mixing 29.4 μL of buffer A, 2.5 μL of buffer B, 2 μL of RPA amplification upstream primer with a concentration of 10 μM, and 2 μL of RPA amplification downstream primer with a concentration of 10 μM, and then freeze-drying, wherein the buffer A and the buffer B are both products in the DNA constant-temperature rapid amplification kit (the kit is from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT); the freeze-drying can be: liquid nitrogen rapid freezing, using (Alpha 1-4 LSC basic) freeze dryer, setting the program to desorption drying for 12 hours and sublimation drying for 3 hours; the CRISPR freeze-dried microspheres are prepared by mixing the polyvinyl alcohol, the Cas12a protein, the crRNA and the fluorescent probe in the ratio of: polyvinyl alcohol solution (60 g / L) 0.5 μL: Cas12a protein (10 μM) 0.1 μL: crRNA (10 μM) 0.1 μL: fluorescent probe (100 μM) 0.1 μL, and then drying at 4°C for 24 h.

[0016] The pre-made reagent or the pre-packed pre-made reagent can be stored at room temperature under dry and light-proof conditions.

[0017] In a second aspect, the present application claims to protect a pre-packed detection tube for nucleic acid detection of Pectobacterium brasiliense.

[0018] The pre-packed detection tube for nucleic acid detection of Pectobacterium brasiliense claimed by the present application is packaged with the RPA freeze-dried microspheres claimed in the first aspect above and the CRISPR freeze-dried microspheres claimed in the first aspect above.

[0019] In a third aspect, the present application claims to protect a kit for nucleic acid detection of Pectobacterium brasiliense.

[0020] The kit for nucleic acid detection of B. brasiliensis claimed by the present application comprises the nucleic acid detection reagent of the first aspect or the pre-packed detection tube of the second aspect.

[0021] Further, the kit can further comprise a lysis solution for lysing B. brasiliensis or a nucleic acid extraction solution for extracting the genome of B. brasiliensis.

[0022] In the fourth aspect, the present application claims the use of the nucleic acid detection reagent of the first aspect, the pre-packed detection tube of the second aspect or the kit of the third aspect in the nucleic acid detection of B. brasiliensis; the nucleic acid detection of B. brasiliensis is the RPA amplification and CRISPR / Cas detection of the target nucleic acid of B. brasiliensis in a reaction container and the reaction container is not opened during the whole reaction process. Further, no external power is required to be provided and / or the reaction temperature is not required to be changed during the whole reaction process.

[0023] In the fifth aspect, the present application claims a method for nucleic acid detection of B. brasiliensis.

[0024] The method for nucleic acid detection of B. brasiliensis claimed by the present application can comprise the following steps: adding a nucleic acid solution from a sample to be tested into the pre-packed detection tube of the second aspect, performing a reaction, and determining whether the sample to be tested contains B. brasiliensis according to the fluorescence signal without opening the reaction container during the whole reaction process. Further, no external power is required to be provided and / or the reaction temperature is not required to be changed during the whole reaction process.

[0025] Further, determining whether the sample to be tested contains the target nucleic acid according to the fluorescence signal can be specifically: if the fluorescence signal changes (significantly changes), the sample to be tested contains or is suspected to contain the target nucleic acid.

[0026] Further, the reaction condition is 37℃ constant temperature reaction for 30-50 min.

[0027] In some embodiments, the amount of nucleic acid from the sample to be tested is 50 μL.

[0028] In some embodiments, after the reaction is completed, a fluorescence excitation light source is used for irradiation and a filter is worn to observe whether fluorescence is generated.

[0029] In some embodiments of the above aspects, the polyvinyl alcohol is polyvinyl alcohol 1788 type.

[0030] The polyvinyl alcohol is added in the CRISPR / Cas12a detection system, freeze-dried microspheres are prepared, and the freeze-dried RPA amplification microspheres are jointly encapsulated in the same detection tube. During detection, only the sample lysis solution or DNA extraction solution needs to be added to the detection tube, and under the condition of constant temperature at 37 DEG C, the RPA freeze-dried microspheres are first dissolved and the isothermal amplification reaction is started (at this time, the CRISPR freeze-dried microspheres absorb water to form a CRISPR / Cas12a detection system with high viscosity on the surface, and the inhibition of the RPA reaction is weak due to the absence of strong convection in the system); after about 15 minutes of reaction, the CRISPR freeze-dried microspheres are fully dissolved by absorbing water, the CRISPR / Cas12a detection system is fully mixed with the RPA amplification product, and specific reactions occur in the tube; after the reaction is completed, the result can be judged by the fluorescence signal.

[0031] The beneficial effects of the present application are:

[0032] (1) The present application realizes the pre-preparation and room temperature storage of the reaction system, without the need for on-site preparation of the reaction system, and the activity is still detectable for 30 days at room temperature.

[0033] (2) The present application is simple to operate, and the reaction only needs one-step pipetting, which simplifies the work of on-site detection and reduces the requirements for the operator, and avoids aerosol pollution.

[0034] (3) The present application is low in cost, does not need large-scale instruments and equipment, does not need high-energy-consumption temperature control equipment, and only needs a fluorescence excitation light source and a fluorescence observation filter to complete the detection.

[0035] The present application provides an efficient, reliable and economical on-site detection solution for the diagnosis of vegetable diseases of Pectobacterium brasiliense. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 It is a visual detection result graph of RPA-CRISPR / Cas12a detection of Pectobacterium brasiliense. The label "-" represents a negative control.

[0037] Figure 2 It is the influence of different polyvinyl alcohol addition amounts on the fluorescence intensity of the RPA-CRISPR / Cas12a detection system. The concentration shown in the figure is the concentration of PVA in 1 mu L of CRISPR detection reagent solution before freeze-drying.

[0038] Figure 3 It is a specific result graph of RPA-CRISPR / Cas12a detection of Pectobacterium brasiliense.

[0039] Figure 4 It is a detection limit result graph of RPA-CRISPR / Cas12a detection of Pectobacterium brasiliense.

[0040] Figure 5 Figure 2 shows the detection of the activity change of RPA-CRISPR / Cas12a in different storage time. DETAILED DESCRIPTION

[0041] The application will be further described in conjunction with the specific embodiments. The examples provided are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.

[0042] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0043] The polyvinyl alcohol (PVA) used in the following examples is polyvinyl alcohol type 1788, with CAS number 9002-89-5.

[0044] The CRISPR / Cas12a protein used in the following examples is a product of NEB England biolabs, with product number M0653T.

[0045] The RPA lyophilized microspheres used in the following examples contain recombinase, single-strand binding protein, strand displacement DNA polymerase, MgoAc and RPA primer pair. One of the RPA lyophilized microspheres is specifically obtained by mixing 29.4 μL of buffer A, 2.5 μL of buffer B, 2 μL of RPA amplification upstream primer with a concentration of 10 μM, and 2 μL of RPA amplification downstream primer with a concentration of 10 μM in a dry powder reaction tube of a DNA constant temperature rapid amplification kit (the kit is from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT), and then freeze-drying treatment (specifically: liquid nitrogen quick freezing into shape, using (Alpha 1-4LSC basic) freeze dryer, setting the program to desorption drying for 12 hours and sublimation drying for 3 hours). The buffer A and the buffer B are both products in the above-mentioned kit.

[0046] The Pectobacterium brasiliense used in the following examples is described in "Rapid Detection and Quantification of Viable Cells of Pectobacterium spp. by CRISPR / Cas12a Assay" (2021). Pectobacterium brasiliense Pectobacterium brasiliense ​Using Propidium Monoazide Combined with Real-Time PCR.J. Li, R. Chen, R. Yang, X. Wei, H. Xie, Y. Shi, et al. Microorganisms 2023 Vol. 11 Issue 11 Pages 2808” available to the public from the Applicant for use in repeating the experiments of the present invention only and not for other purposes.

[0047] Pseudomonas syringae pv. lachrymans Pseudomonas syringae pv. lachrymans ): described in the article “Li, H. L., Li, B. J. Doctor Li’s Diagnosis Notes (Fifty-Three) Symptoms Diversity and Comprehensive Control of Bacterial Angular Leaf Spot of Cucumber [J]. China Vegetables, 2012(21): 23-25.” available to the public from the Applicant for use in repeating the experiments of the present invention only and not for other purposes.

[0048] Xanthomonas campestris pv. campestris Xanthomonas campestris pv. campestris ): described in the article “Zhang, Y., Li, J. P., Zhou, H. M., Li, B. J. Doctor Li’s Diagnosis Notes (Thirty-Nine) Occurrence Regularity and Control of Bacterial Black Rot of Cruciferous Vegetables. China Vegetables 2011, 17:23-25.” available to the public from the Applicant for use in repeating the experiments of the present invention only and not for other purposes.

[0049] Corynebacterium michiganense subsp. michiganense Clavibacter michiganensis subsp. michiganens is ): described in the article “Li, H. L., Shi, Y. X., Xie, X. W., Li, B. J. Doctor Li’s Diagnosis Notes (Forty-Two) Occurrence Regularity and Control Techniques of Tomato Bacterial Wilt. China Vegetables 2011, 23:24-27.” available to the public from the Applicant for use in repeating the experiments of the present invention only and not for other purposes.

[0050] Rhizoctonia solani Rhizoctonia solani ): described in the article “Huang, Y. S., Xie, X. W., Shi, Y. X., Chai, A. L., Li, L., Li, B. J. Control Effect of Paenibacillus polymyxa ZF197 on Chinese Cabbage Stem and Base Rot. Journal of Horticulture: 1-13.” available to the public from the Applicant for use in repeating the experiments of the present invention only and not for other purposes.

[0051] Phytophthora capsici Phytophthora capsici): recorded in "Cheng Yingchao, Kang Huajun, Shi Yanxia, Chai Ali, Zhang Hongjie, Xie Xuewen, Li Baoju. The establishment and application of RT-PCR detection technology of Phytophthora capsici [J]. Acta Horticulturae Sinica, 2018, 45(05): 997-1006." The public can obtain it from the applicant, and it can only be used for repeating the experimental use of the invention, and cannot be used for other purposes.

[0052] Sclerotinia sclerotiorum (Lib.) de Bary Stemphylium solani ): recorded in "Li Baoju, Zhou Yanfang, Li Jinping, Xie Xuewen. Dr. Li Baoju's diagnosis notes (thirty) diagnosis and control of tomato Sclerotinia sclerotiorum leaf spot (gray leaf spot). Chinese vegetables, 2010(23): 24-26." The public can obtain it from the applicant, and it can only be used for repeating the experimental use of the invention, and cannot be used for other purposes.

[0053] Botrytis cinerea (Pers.) Fr. Botrytis cinerea ): recorded in "Shi Yanxia, Tang Ming, Jin Zhiwen, Xie Xuewen, Chai Ali, Li Baoju. Evaluation of Botrytis cinerea resistance to different types of fungicides on vegetable crops. Chinese vegetables, 2016(03): 60-65." The public can obtain it from the applicant, and it can only be used for repeating the experimental use of the invention, and cannot be used for other purposes.

[0054] Fusarium oxysporum (Schl) f. sp. cucumeris (Leach) Snyder et Hansen Fusarium oxysporum ): recorded in "Shi Yanxia, Zhang Xiaohui, Xu Yufang, Xie Xuewen, Chai Ali, Li Baoju. Pyrazolopyrimidine derivative BDO-1 induces resistance of cucumber to fusarium wilt [J]. Acta Horticulturae Sinica, 2019, 46(05): 877-890." The public can obtain it from the applicant, and it can only be used for repeating the experimental use of the invention, and cannot be used for other purposes.

[0055] Example 1, RPA-CRISPR detection of Pseudomonas cichorii

[0056] The RPA primer pair for detecting Pseudomonas cichorii in the application is as follows:

[0057] Upstream primer: GCAGTGGTTGCGTGAACGGTGGTCATCAGTG (SEQ ID NO: 1);

[0058] Downstream primer: CGTTCTGACTGGTCCATCTAAAGATGATACC (SEQ ID NO: 2).

[0059] The nucleotide sequence of crRNA is as follows: UAAUUUCUACUAAGUGUAGAUCUGACCAGCGUAAGUUUUGU (SEQ ID NO: 3).

[0060] Fluorescent probe: FAM-TTATT-BHQ1 (fluorescent group FAM, labeled at 5' end; quenching group BHQ1, labeled at 3' end).

[0061] I. Preparation of pre-packed detection tube for nucleic acid detection of Pectobacterium brasiliense

[0062] 1. Preparation of CRISPR freeze-dried microspheres

[0063] Mix 0.1 μL of CRISPR / Cas12a protein solution with a concentration of 10 μM, 0.1 μL of crRNA (see above) solution with a concentration of 10 μM, 0.1 μL of fluorescent probe (see above) solution with a concentration of 100 μM (all solvents are DEPC water), 0.5 μL of polyvinyl alcohol (PVA) solution with a concentration of 6% (i.e. 60 g / L) (solvent is water), and 0.2 μL of distilled water, a total of 1 μL (i.e. the final concentration of PVA is 3%, i.e. 30 g / L), and then coat it on the bottom of a 200 μL reaction tube. Dry the tube in a drying box (a sealed box filled with desiccant, dried at 4°C for 24 hours) to obtain CRISPR freeze-dried microspheres.

[0064] 2. Preparation of pre-packed detection tube

[0065] Add one RPA freeze-dried microsphere (RPA amplification primer has been added) to the tube containing the CRISPR freeze-dried microspheres prepared in step 1, and cover the tube cap to obtain a pre-packed detection tube for nucleic acid detection of Pectobacterium brasiliense.

[0066] II. Single-tube RPA-CRISPR detection of Pectobacterium brasiliense

[0067] Use LB liquid medium to culture Pectobacterium brasiliense. When the medium is turbid, take 20 μL of bacterial cells and put them into a 1.5 mL centrifuge tube containing lysis buffer (Anfuwei product, catalog number: WLR8203-ES-S). After shaking, centrifuge slightly to obtain the supernatant containing genomic DNA.

[0068] Add 50 μL of lysis product to the pre-packed detection tube prepared in step one, incubate at 37°C for 30 min, and then use a 488 nm laser light source and a 510 nm long wave pass filter to observe the detection results. If a significant fluorescence signal is observed, it indicates that the sample is positive, i.e. it contains Pectobacterium brasiliense; if no significant fluorescence signal is observed, it indicates that the sample is negative, i.e. it does not contain Pectobacterium brasiliense.

[0069] At the same time, set 50 μL of sterile water as negative control instead of sample genomic DNA.

[0070] As Figure 1As shown, it can be seen that the RPA primer and crRNA designed by the method can specifically recognize P. brasiliensis.

[0071] Example 2, Effect of Different Concentrations of Polyvinyl Alcohol on Fluorescence Signal Intensity

[0072] P. brasiliensis was cultured using LB liquid medium. When the medium was turbid, 20 μL of bacterial cells were taken and placed in a 1.5 mL centrifuge tube containing lysis solution (Anpu Future, Catalog No. WLR8203-ES-S). After shaking, the supernatant was obtained by slight centrifugation to obtain the lysis product containing genomic DNA.

[0073] (1) Add protective agent: a total of 7 groups, prepare the pre-packed detection tube according to Example 1, the difference is only that the concentration of 0.5 μL polyvinyl alcohol (PVA) solution (solvent is DEPC water) is set to 16%, 12%, 10%, 8%, 6%, 4%, 2% (% represents g / 100 mL, for example, 16% means that the concentration of PVA in 0.5 μL polyvinyl alcohol solution is 160 g / L), that is, the concentration of PVA in 1 μL CRISPR detection reagent solution before freeze-drying is 8%, 6%, 5%, 4%, 3%, 2%, 1% (% represents g / 100 mL, for example, 8% means that the concentration of PVA in 1 μL CRISPR detection reagent solution is 80 g / L).

[0074] (2) No protective agent control: 1 group, prepare the corresponding pre-packed detection tube according to Example 1, the difference is only that 0.5 μL polyvinyl alcohol (PVA) solution is replaced with an equal volume of distilled water.

[0075] Add 50 μL of the above prepared P. brasiliensis lysis product to the above 8 pre-packed detection tubes, and use an enzyme marker to react at 37°C for 50 min, collecting fluorescence signals every 1 min.

[0076] Meanwhile, a traditional RPA-CRIPSR / Cas12a stepwise detection of the prepared *Pectinobacter brasiliensis* lysate was set up as a positive control. The specific operation was as follows: First, the RPA reaction was performed at 37°C for 20 minutes. The reaction system was as follows: 29.4 μL of Buffer A, 2 μL each of forward and reverse primers (concentration of 10 μM), 2 μL of lysate, 11.2 μL of DEPC H2O, and 2.5 μL of Buffer B were added to a dry powder reaction tube (wherein, the dry powder reaction tube, Buffer A, and Buffer B are all products of the kit, which is from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT). After the RPA reaction, 12.5 μL of the RPA reaction solution was transferred to the CRISPR / Cas12a detection system for detection. The system was incubated at 37°C for 20 minutes. The CRISPR detection system consisted of: 1 μL of Cas12a (1 μM), 1 μL of crRNA (1 μM), 4.5 μL of DEPC H2O, 1 μL of fluorescent probe (10 μM), and 12.5 μL of RPA amplification product.

[0077] like Figure 2 As shown, with the addition of an appropriate concentration of polyvinyl alcohol as a protective agent, the RPA reagent and CRISPR reagent can react in a single tube. The fluorescence signal at a concentration of 3% (the concentration of PVA in 1 μL of CRISPR detection reagent solution before freeze-drying) is closest to that of the positive control, and the amplification curve is good. The control group without protective agent showed no obvious fluorescence signal after the reaction.

[0078] Example 3: Specificity verification of single-tube RPA-CRISPR detection of *Pectinobacter brasiliensis*

[0079] Using Brazilian pectinobacterium ( Pectobacterium brasiliense ), lilac pseudomonas lacrimal lesion ( Pseudomonas syringae pv. lachrymans ), Xanthomonas aurea, a pathogenic species of wild rapeseed ( Xanthomonas campestris pv. campestris ), Corynebacterium micranthae subsp. micranthae ( Clavibacter michiganensis subsp. michiganensis Rhizoctonia solani ( )), Rhizoctonia solani ( Rhizoctonia solani ), Phytophthora capsici ( Phytophthora capsici ), eggplant stalk mold ( Stemphylium solani ), Botrytis cinerea ( Botrytis cinerea Fusarium oxysporum ( Fusarium oxysporumGenomic DNA of *Pectinobacter brasiliensis* was used as the test sample. 50 μL of the sample genomic DNA was added to a pre-loaded detection tube prepared in Example 2 for nucleic acid detection of *Pectinobacter brasiliensis* (the concentration of PVA in 1 μL of CRISPR reagent solution before freeze-drying was 3%, % represents g / 100 mL). The tube was incubated at 37°C for 30 min. After the reaction, the detection results were observed using a blue laser light source and a filter. Simultaneously, 50 μL of sterile water was used as a negative control (i.e., a template-free control) to replace the sample genomic DNA.

[0080] like Figure 3 As shown, *Pseudomonas brasiliensis* exhibited green fluorescence after the reaction, while *Pseudomonas syringae*, *Xanthomonas spp.*, *Corynebacterium miltanense* subsp. *miltanense*, *Rhizoctonia solani*, *Phytophthora capsici*, *Stemona solani*, *Botrytis cinerea*, *Fusarium oxysporum*, and the negative control all showed no fluorescence. This indicates that the method for detecting *Pseudomonas brasiliensis* in this invention has high specificity.

[0081] Example 4: Sensitivity verification of single-tube RPA-CRISPR detection of *Pectinobacter brasiliensis*

[0082] *Pectinus brasiliensis* was cultured in LB liquid medium. After the medium became turbid, bacterial cells were collected from the liquid medium, and genomic DNA of *Pectinus brasiliensis* was extracted. The DNA concentration was determined using a nanodrop 2000 and then serially diluted to prepare test samples containing different concentrations of *Pectinus brasiliensis* DNA (1 to 1 × 10⁻⁶). -6 (ng / μL).

[0083] Add 50 μL of test samples containing different concentrations of *Pectinus brasiliensis* DNA to the pre-loaded test tubes prepared in Example 2 for nucleic acid detection of *Pectinus brasiliensis* (the concentration of PVA in 1 μL of CRISPR test reagent solution before freeze-drying was 3%, % represents g / 100 mL). Incubate at 37°C for 30 min. After the reaction, observe the detection results using a blue laser light source and a filter. Simultaneously, set up 50 μL of sterile water to replace the sample genomic DNA as a negative control (i.e., a template-free control).

[0084] like Figure 4 As shown, 1 to 1×10 -5 Fluorescence was observed at DNA concentrations of ng / μL and 1×10⁻⁶. -6 No fluorescence signal was generated in ng / μL and the negative control. This method can detect 1×10 -5 ng / μL of *Pectinobacter brasiliensis* DNA. This indicates that the method for detecting *Pectinobacter brasiliensis* in this invention has high sensitivity.

[0085] Example 5: Changes in the activity of single-tube RPA-CRISPR after 30 days of storage

[0086] The B. brasiliensis was cultured using LB liquid medium, and when the medium was turbid, 20 μL of bacterial bodies were taken and placed in a 1.5 mL centrifuge tube containing lysis solution (Anpu Future, product number: WLR8203-ES-S). After shaking, the supernatant was obtained by slight centrifugation to obtain the lysis product containing genomic DNA.

[0087] To the pre-packed detection tube (the concentration of PVA in 1 μL of CRISPR detection reagent solution before freeze-drying was 3%, which represents g / 100 mL) for nucleic acid detection of B. brasiliensis prepared in Example 2 stored at room temperature for different times (1, 3, 7, 15, 30 days), 50 μL of the above lysis product was added, and a microplate reader was used for 37°C reaction for 40 min, and the fluorescence signal was collected every 1 min.

[0088] As shown in Figure 5 , the reagent still has activity when stored for 30 days. This result shows that the pre-packed detection tube of the present application can be placed at room temperature for more than 30 days.

[0089] The present application has been described in detail above. For those skilled in the art, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the present application, and without unnecessary experiments. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, the present application is intended to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. A nucleic acid detection reagent for detecting *Pectinobacter brasiliensis*, characterized in that: The nucleic acid detection reagent includes reagent A and reagent B; reagent A is a reagent for RPA amplification of the target nucleic acid of *Pectinobacter brasiliensis*; reagent B is a reagent for CRISPR / Cas detection of the target nucleic acid; reagent B contains polyvinyl alcohol. Reagent A contains a recombinase, a single-strand binding protein, a strand displacement DNA polymerase, and an RPA primer pair; the RPA primer pair is used to specifically amplify the target nucleic acid. Reagent B contains polyvinyl alcohol, Cas12a protein, crRNA, and a fluorescent probe; the crRNA targets the target nucleic acid. The RPA primer pair consists of two single-stranded DNAs as shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleotide sequence of the crRNA is shown in SEQ ID NO:

3.

2. The nucleic acid detection reagent according to claim 1, characterized in that: In reagent B, the ratio of polyvinyl alcohol, Cas12a protein, crRNA and fluorescent probe is 30g:1μmol:1μmol:10μmol.

3. The nucleic acid detection reagent according to claim 1 or 2, characterized in that: The reagent A exists in the form of lyophilized microspheres, denoted as RPA lyophilized microspheres; and / or, the reagent B exists in the form of lyophilized microspheres, denoted as CRISPR lyophilized microspheres.

4. A pre-loaded detection tube for nucleic acid detection of *Pectinobacter brasiliensis*, characterized in that: The pre-loaded detection tube is encapsulated with the RPA freeze-dried microspheres and the CRISPR freeze-dried microspheres as described in claim 3.

5. A kit for nucleic acid detection of *Pectinobacter brasiliensis*, comprising the nucleic acid detection reagent according to any one of claims 1-3 or the pre-loaded detection tube according to claim 4.

6. The reagent kit according to claim 5, characterized in that: The kit also contains a lysis buffer for lysing *Bacillus brasiliensis* or a nucleic acid extraction buffer for extracting the genome of *Bacillus brasiliensis*.

7. The application of the nucleic acid detection reagent according to any one of claims 1-3, the pre-loaded detection tube according to claim 4, or the kit according to claim 5 or 6 in the nucleic acid detection of *Pectinobacter brasiliensis*; wherein the nucleic acid detection of *Pectinobacter brasiliensis* involves RPA amplification and CRISPR / Cas detection of the target nucleic acid of *Pectinobacter brasiliensis* in a reaction vessel without opening the reaction vessel during the entire reaction process.

8. A method for nucleic acid detection of *Pectinobacter brasiliensis*, comprising the following steps: adding a nucleic acid solution from the sample to be tested into the pre-loaded detection tube as described in claim 4, reacting, without opening the reaction container during the entire reaction process, and determining whether the sample to be tested contains *Pectinobacter brasiliensis* based on the fluorescence signal after the reaction.

Images