Construction method of rapid virus detection system, rapid duck hepatitis A virus type 1 detection system, detection method and detection kit

Abstract

The invention discloses a construction method of a rapid virus detection system, a rapid 1-type duck hepatitis A virus detection system, a detection method and a detection kit, and relates to the technical field of rapid pathogen detection. The construction method of the rapid detection system for the type 1 duck hepatitis A virus comprises the following steps: step 1, primary screening; 2, designing a primer; step 3, verification; step 4, construction of standard quality grains; and 5, optimizing the system, and adjusting the concentration of crRNA, the concentration of Cas12a and the reaction time of Cas12a by using standard plasmids as a positive detection template to obtain a rapid detection system with the reaction time not longer than 30 minutes. The invention also provides a detection method based on the detection system and an optimized detection kit, and the detection kit can realize rapid, accurate, high-specificity and high-sensitivity detection of the 1-type duck hepatitis A virus, and is beneficial to popularization and application.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection, and in particular to a method for constructing a rapid virus detection system, a rapid detection system for type 1 duck hepatitis A virus, a detection method and a detection kit. Background Art

[0002] Duck viral hepatitis (DVH) is an acute, highly contagious disease caused by duck hepatitis virus (DHV) infecting ducklings. The disease mainly affects ducklings under 4 weeks old. Its main characteristics are endemicity, rapid spread, short course of disease and high mortality rate. It is one of the main diseases that endanger the duck farming industry. The heads of dead ducklings tilt back in an "opisthotonos" state. Autopsy shows enlarged liver and a large number of hemorrhagic spots. According to genetic evolution analysis, DHAV is divided into three genotypes, namely DHAV-1, DHAV-2 and DHAV-3. Its diagnosis can rely on virus isolation and identification, serological detection methods and molecular biological detection methods. The most commonly used methods for laboratory detection of DHAV include PCR and RT-qPCR. However, these detection methods are often cumbersome to operate and have certain requirements for experimental instruments and experimental personnel. PCR detection has high requirements for sample processing and strict reaction conditions, making it difficult to be widely promoted and applied. Summary of the invention

[0003] The purpose of the present invention is to provide a method for constructing a rapid virus detection system, a rapid detection system for duck hepatitis A virus type 1, a detection method and a detection kit. The detection system constructed by the construction method has high detection accuracy and is easy to operate, and can realize rapid and convenient on-site detection.

[0004] The present invention is achieved through the following technical solutions: The present invention provides a method for constructing a rapid detection system for duck hepatitis A virus type 1, characterized in that it comprises the following steps: Step 1: Initial screening The online CRISPR-Cas12a crRNA prediction software CRISPOR was used to screen crRNA targeting the whole genome sequence of DHAV-1 to obtain a preliminary screening group of crRNA sequences; Step 2: Design primers Design RT-ERA primers based on the position of each crRNA sequence in the DHAV-1 gene and the size of the amplified product in the crRNA sequence preliminary screening group to obtain primers corresponding to each crRNA sequence in the preliminary screening group; Step 3: Verification Select crRNA and the corresponding primer amplification sequence as the target for RT-ERA / CRISPR-Cas12a detection, and screen the crRNA sequence and corresponding primer with the highest fluorescence intensity as the reaction system; Step 4: Construction of standard plasmid According to the crRNA sequence and corresponding primers screened in step 3, the gene fragment containing the corresponding crRNA is amplified using the primers, and the length is within the range of 150-300 bp, and the corresponding DNA fragment is recovered, and the 3' end of the DNA fragment is added with Taq enzyme and then connected with the pMD-19T vector to obtain a connection product; the connection product is transferred into competent cells for cell culture and plasmids are extracted from them to obtain a standard plasmid; Step 5: System Optimization Using the standard plasmid as a positive detection template, the crRNA concentration, Cas12a concentration, and Cas12a reaction time were optimized to obtain a rapid detection system with a reaction time of no more than 30 min.

[0005] Furthermore, in some embodiments of the present application, the activity of the crRNA sequences in the crRNA sequence preliminary screening group is not less than 80 points, and the off-target rate is not more than 3; and / or In step 2, the primers are designed so that the length of the amplified product is within the range of 150-300 bp.

[0006] Further, in some embodiments of the present application, in step 3, the corresponding reaction system obtained includes: ERA dissolving agent with a volume concentration of 40%, upstream primer solution with a volume concentration of 1-10%, downstream primer solution with a volume concentration of 1-10%, Cas12a with a volume concentration of 0.5-5%, crRNA with a volume concentration of 0.5-5%, ssDNA fluorescent probe solution with a volume concentration of 0.5-5%, RNA template with a volume concentration of 4%, and ERA reaction activator with a volume concentration of 4%; The concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the ssDNA fluorescent probe in the ssDNA fluorescent probe solution is 10 μmol / L.

[0007] Furthermore, in some embodiments of the present application, after the reaction system is incubated at 37° C. for 30 minutes, a gel imaging system is used to take photos and detect under ultraviolet light to obtain the detection results.

[0008] Furthermore, in some embodiments of the present application, the crRNA sequence preliminary screening group selected in step one includes at least three crRNA sequences.

[0009] In the second aspect, the present application also provides a type 1 duck hepatitis A virus rapid detection system based on RT-ERA and CRISPR-Cas12a, including an ERA solubilizer with a volume concentration of 40%, an upstream primer solution with a volume concentration of 4%, a downstream primer solution with a volume concentration of 4%, a molar concentration of 50 nmol / L Cas12a, a molar concentration of 50 nmol / L crRNA, a volume concentration of 2% probe solution, a volume concentration of 4% RNA template and a volume concentration of 4% ERA reaction activator; Wherein, the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; Wherein, the RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5-6; The sequence of the crRNA is selected from the sequence in SEQ ID NO.9; The probe solution includes a ssDNA biotin reporter probe; Cas12a protease cleaves the ssDNA-biotin reporter probe, separating the FAM group from the quencher group BHQ, and its FAM group is exposed in the system to generate fluorescence; The sequence of the ssDNA fluorescent reporter probe is the sequence in SEQ ID NO.10.

[0010] In a third aspect, the present application also provides a rapid detection kit for duck hepatitis A virus type 1, comprising an RT-ERA reaction system, a Cas12a protein, a DHAV-1 specific crRNA, an RT-ERA amplification primer pair, an ssDNA biotin reporter probe, and a Cas12 / 13 dedicated nucleic acid detection test strip; The RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5 and SEQ ID NO.6; The sequence of the DHAV-1 specific crRNA is selected from the sequence in SEQ ID NO.9; The sequence of the DNA probe is the sequence in SEQ ID NO.12.

[0011] Further, in some embodiments of the present application, the RT-ERA reaction system in the detection kit includes an ERA dissolving agent, an RNA template and an ERA reaction activator; The concentrations of the ERA dissolving agent, RNA template and ERA reaction activator in the kit are 40%, 4% and 4% by volume respectively; The concentrations of the Cas12a protein, DHAV-1 specific crRNA, RT-ERA amplification primer pair, ssDNA fluorescent reporter probe, and ssDNA biotin reporter probe are respectively 4% by volume of an upstream primer solution, 4% by volume of a downstream primer solution, 50 nmol / L of Cas12a, 50 nmol / L of crRNA, 1% by volume of an ssDNA fluorescent probe solution, and 1% by volume of an ssDNA biotin reporter probe solution; the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; the concentration of the ssDNA biotin reporter probe in the ssDNA biotin reporter probe solution is 10 μmol / L.

[0012] In a fourth aspect, the present application also provides a method for rapid detection of duck hepatitis A virus type 1, comprising the following steps: (1) Extract the total RNA of the sample to be tested as a template; (2) configuring a reaction system with an ssDNA biotin reporter probe as a probe, labeling one end of the probe with Biotin and the other end with FAM to obtain a biotin-labeled probe, adding the RNA template obtained in S1, and performing an isothermal amplification reaction using the RT-ERA primer to obtain an RT-ERA amplification product; (3) S3: Use the amplified product obtained in S2 to activate the Cas12a enzyme activity of the CRISPR-Cas12a reaction system to cut the biotin-labeled probe; (4) Use the Cas12a-specific nucleic acid detection test strip to detect the reaction system of S3, and judge the test result based on the color development position.

[0013] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a method for constructing a type 1 duck hepatitis A virus rapid detection system, a type 1 duck hepatitis A virus rapid detection system, a detection method and a detection kit, the construction method can accurately construct a detection system with high detection accuracy and rapid detection, and provides a key detection system for the preparation of a kit that can be widely promoted and applied in the future, which is conducive to the development and formation of a rapid detection kit. The present invention also provides a detection method for the detection kit, which is short in time, can realize on-site sampling and detection of type 1 duck hepatitis A virus, has low detection cost and high accuracy, is conducive to the rapid judgment of type 1 duck hepatitis A virus, and strives for more processing time for the disease caused by this short-course virus. In addition, the present invention adopts RT-ERA combined with the technology of CRISPR-Cas12a to detect DHAV-1, and the detection method is more simple and fast to operate, and can complete the detection for sample nucleic acid in a one-step method. Moreover, the RT-ERA / CRISPR-Cas12a system constructed according to the present invention has high detection sensitivity, stable and efficient, strong specificity, and can activate the CRISPR / Cas12a system to generate fluorescent signals immediately after viral gene amplification, effectively and quickly detect DHAV-1 low-concentration nucleic acid samples, and the test results are highly consistent with the fluorescent quantitative PCR method, but without the cost of fluorescent detection. In addition, the test only needs to provide a reaction temperature of 37-42°C to complete the amplification of viral fragments, and the results can be interpreted by a simple fluorescent reading device or naked eye observation. The whole process only takes about 30 minutes, which is convenient for farms with simpler instruments and equipment to carry out rapid on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A graph showing the results of crRNA activity screening in the construction method provided in the present application, wherein A is the fluorescence intensity curve of crRNA-1, B is the fluorescence intensity curve of crRNA-2, and C is the fluorescence intensity curve of crRNA-3, and D is a prediction score graph of crRNA-1, crRNA-2, and crRNA-3 using the online CRISPR-Cas12a crRNA prediction software; Figure 2 (A) and Figure 2 (B) are diagrams showing the optimization results of crRNA-3 concentration in the construction method provided in Example 1 of the present application, wherein nc is a blank control; Figure 3 (A) and Figure 3 (B) are diagrams showing the optimization results of Cas12a concentration in the construction method provided in this application; Figure 4 This is a diagram showing the optimization results of the reaction time in the construction method provided in this application; Figure 5 This is a graph of the specific detection results of the detection system provided in this application; where Mock is a test fluorescence detection result graph; Figure 6It is a sensitivity test result diagram of the detection system provided in this application; wherein, Mock is a test fluorescence test result diagram, A is a test result diagram; B is a fluorescence intensity bar graph obtained by the test; Figure 7 A comparison chart of the detection system provided in this application and the fluorescent quantitative PCR detection results, wherein A is the detection result chart and B is the concentration of crRNA-3 in the detection system; Figure 8 A schematic diagram of the test strip method for interpretation of the kit provided in Example 2 of the present application; Fig. 9 This is a graph showing the crRNA concentration optimization results of the test strip method of the kit provided in Example 2 of the present application; Fig.10 Result diagram of Cas12a concentration optimization by the test strip method for the kit provided in Example 2 provided in this application; Fig.11 This is a graph showing the results of optimizing the concentration of biotin reporter probes by the test strip method of the kit provided in Example 2 of the present application; FIG. 12 (A) and FIG. 12 (B) are comparison diagrams of the test strip method and the fluorescence quantitative PCR detection results of the kit provided in Example 2 of the present application. DETAILED DESCRIPTION

[0015] The technical solution of the present application will be described clearly and completely below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present application.

[0016] It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as generally understood by those skilled in the art to which this application belongs. It should also be understood that terms such as those defined in common dictionaries should be understood to have meanings consistent with the meanings in the context of the prior art, and will not be interpreted with idealized or overly formal meanings unless specifically defined as here.

[0017] Those skilled in the art will appreciate that, unless otherwise stated, the singular forms "a", "an", "said" and "the" used herein may also include plural forms. It should be further understood that the term "comprising" used in the specification of the present application refers to the presence of the features, integers, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or groups thereof. The term "and / or" used herein includes all or any unit and all combinations of one or more associated listed items.

[0018] The present invention is achieved through the following technical solutions: The present invention provides a method for constructing a rapid detection system for duck hepatitis A virus type 1, comprising the following steps: Step 1: Initial screening The online CRISPR-Cas12a crRNA prediction software CRISPOR was used to screen crRNA targeting the whole genome sequence of DHAV-1 to obtain a preliminary screening group of crRNA sequences; among them, crRNA plays a role in guiding the Cas12a protein to recognize and bind to the PAM sequence and exert non-specific cleavage activity in the CRISPR-Cas12a system.

[0019] Step 2: Design primers Design RT-ERA primers based on the position of each crRNA sequence in the DHAV-1 gene and the size of the amplified product in the crRNA sequence preliminary screening group to obtain primers corresponding to each crRNA sequence in the preliminary screening group; Step 3: Verification Select crRNA and the corresponding primer amplification sequence as the target for RT-ERA / CRISPR-Cas12a detection, and screen the crRNA sequence and corresponding primer with the highest fluorescence intensity as the reaction system; Step 4: Construction of standard plasmid According to the crRNA sequence and corresponding primers screened in step 3, the gene fragment containing the corresponding crRNA is amplified using the primers, and the length is within the range of 150-300 bp, and the corresponding DNA fragment is recovered, and the 3' end of the DNA fragment is added with Taq enzyme and then connected with the pMD-19T vector to obtain a connection product; the connection product is transferred into competent cells for cell culture and plasmids are extracted from them to obtain a standard plasmid; Step 5: System Optimization Using the standard plasmid as a positive detection template, the crRNA concentration, Cas12a concentration, and Cas12a reaction time were optimized to obtain a rapid detection system with a reaction time of no more than 30 min.

[0020] Among them, the activity of the crRNA sequences in the crRNA sequence preliminary screening group is not less than 80 points, and the off-target rate is not higher than 3. Among them, its scoring system is the scoring system of the online CRISPR-Cas12a crRNA prediction software, which is a prior art, so it is not described in detail in this scheme.

[0021] In addition, in step 2, the primers are designed so that the length of the amplified product is controlled within the range of 150-300 bp.

[0022] Wherein, in step 3, the corresponding reaction system obtained includes: ERA dissolving agent with a volume concentration of 40%, upstream primer solution with a volume concentration of 1-10%, downstream primer solution with a volume concentration of 1-10%, Cas12a with a volume concentration of 0.5-5%, crRNA with a volume concentration of 0.5-5%, ssDNA fluorescent probe solution with a volume concentration of 0.5-5%, RNA template with a volume concentration of 4%, and ERA reaction activator with a volume concentration of 4%; The concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the ssDNA fluorescent probe in the ssDNA fluorescent probe solution is 10 μmol / L.

[0023] The reaction system was incubated at 37° C. for 30 minutes, and then photographed and detected under ultraviolet light using a gel imaging system to obtain the test results.

[0024] Among them, the crRNA sequence preliminary screening group selected in step one includes at least three crRNA sequences, and through screening, the crRNA sequence with the strongest fluorescence effect and the corresponding primer pair are obtained.

[0025] In the second aspect, the present application also provides a type 1 duck hepatitis A virus rapid detection system based on RT-ERA and CRISPR-Cas12a, including an ERA solubilizer with a volume concentration of 40%, an upstream primer solution with a volume concentration of 4%, a downstream primer solution with a volume concentration of 4%, a molar concentration of 50 nmol / L Cas12a, a molar concentration of 50 nmol / L crRNA, a volume concentration of 2% probe solution, a volume concentration of 4% RNA template and a volume concentration of 4% ERA reaction activator; Wherein, the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; Wherein, the RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5-6; The sequence of the crRNA is selected from the sequence in SEQ ID NO.9; The probe solution includes a ssDNA fluorescent reporter probe; Cas12a protease cleaves the ssDNA-fluorescent reporter probe to separate the FAM group from the quencher group BHQ, and the FAM group is exposed in the system to generate fluorescence.

[0026] In the third aspect, the present application also provides a rapid detection kit for duck hepatitis A virus type 1, including an RT-ERA reaction system, a Cas12a protein, a DHAV-1 specific crRNA, an RT-ERA amplification primer pair, an ssDNA biotin reporter probe, and a Cas12 / 13 special nucleic acid detection test strip.

[0027] The RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5 and SEQ ID NO.6; The sequence of the DHAV-1 specific crRNA is selected from the sequence in SEQ ID NO.9; The sequence of the DNA probe is the sequence in SEQ ID NO.12.

[0028] Further, in some embodiments of the present application, the RT-ERA reaction system in the detection kit includes an ERA dissolving agent, an RNA template and an ERA reaction activator; The concentrations of the ERA dissolving agent, RNA template and ERA reaction activator in the kit are 40%, 4% and 4% by volume respectively; The concentrations of the Cas12a protein, DHAV-1 specific crRNA, RT-ERA amplification primer pair, ssDNA fluorescent reporter probe, and ssDNA biotin reporter probe are respectively 4% by volume of an upstream primer solution, 4% by volume of a downstream primer solution, 50 nmol / L of Cas12a, 50 nmol / L of crRNA, 1% by volume of an ssDNA fluorescent probe solution, and 1% by volume of an ssDNA biotin reporter probe solution; the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; the concentration of the ssDNA biotin reporter probe in the ssDNA biotin reporter probe solution is 10 μmol / L.

[0029] In a fourth aspect, the present application also provides a method for rapid detection of duck hepatitis A virus type 1, comprising the following steps: (1) Extract the total RNA of the sample to be tested as a template; (2) configuring a reaction system with an ssDNA biotin reporter probe as a probe, labeling one end of the probe with Biotin and the other end with FAM to obtain a biotin-labeled probe, adding the RNA template obtained in S1, and performing an isothermal amplification reaction using the RT-ERA primer to obtain an RT-ERA amplification product; (3) S3: Use the amplified product obtained in S2 to activate the Cas12a enzyme activity of the CRISPR-Cas12a reaction system to cut the biotin-labeled probe; (4) Use the Cas12a special nucleic acid detection test strip to detect the reaction system of S3, and judge the test result according to the color position. The specific judgment method is: when the test strip quality control line (C line) and the test line (T line) both have red strips; or the test strip quality control line (C line) does not show color, and the test line (T line) has a red strip, it indicates that the sample to be tested is DHAV-1 positive; when the test strip quality control line (C line) has a red strip and the test line (T line) does not show color, it indicates that the sample to be tested is DHAV-1 negative.

[0030] The extraction of total RNA from the sample to be tested in step (1) includes the following steps: Weigh 0.1 g of infected tissue, place the tissue in a 1.5 mL centrifuge tube, add 500 μL Trizol, and grind using a tissue homogenizer for 5 min; Add 200 μL of chloroform to Trizol, mix by inverting at least 15 times, and let stand for 15-20 min until layers are separated; The centrifuge was precooled to 4 °C and centrifuged at 12000 g for 15 min; Pipette 200 μL of supernatant into a 1.5 mL EP tube, add 600 μL of isopropanol, mix by inverting at least 15 times, and let stand for 10 min; Centrifuge at 12000r / min for 15 min at 4°C. After centrifugation, the supernatant was discarded, and the precipitate was washed with 75% ethanol, and then centrifuged at 7500r / min for 5 min at 4°C to obtain the precipitate; after the ethanol was evaporated, 20 μL RNase Free ddH2O was added to dissolve the precipitate to obtain.

[0031] The reaction system in step (2) includes: 20 μL of ERA dissolving agent, 2 μL of amplification primers (10 μmol / L), 1 μL of Cas12a and crRNA, and 1 μL of probe (10 μmol / L). When preparing the system, the above components are mixed, and then DEPC water is added to make up to 46 μL, mixed, 2 μL of the RNA template of the sample to be tested is added, and then 2 μL of ERA reaction activator is added.

[0032] This test method can also be verified by the following methods: S01: Extract the total RNA of the sample to be tested as a template; S02: configuring a reaction system with a ssDNA fluorescent probe as a probe, labeling one end of the ssDNA fluorescent probe with FAM and the other end with BHQ to obtain a fluorescent labeled probe, adding the RNA template obtained in S01, and performing an isothermal amplification reaction using the RT-ERA primer to obtain an RT-ERA amplification product; S03: Activate the Cas12a enzyme activity of the CRISPR-Cas12a reaction system using the amplified product obtained in S02 to cut the fluorescent labeled probe; S04: Perform fluorescence intensity detection on the reaction system obtained in S03, and judge the detection result according to the fluorescence intensity. The specific judgment method is: when the fluorescence signal in the reaction tube is enhanced, it indicates that the sample to be tested is DHAV-1 positive, and when the fluorescence signal intensity in the reaction tube remains unchanged, it indicates that the sample to be tested is DHAV-1 negative.

[0033] In the validation method, the preparation method of total RNA of the sample to be tested is consistent with the detection method.

[0034] The detection results obtained by judging based on the fluorescence intensity in the verification method are compared with the detection results judged based on the color development position. The two judgment results are consistent. It can be seen that the accuracy of the judgment results of the detection method provided in the present application can achieve the detection accuracy of fluorescence intensity and has high accuracy.

[0035] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] Experimental Materials Reagents: RT-ERA isothermal amplification kit was purchased from Suzhou Xinda Gene Technology Co., Ltd., ssDNA probes and amplification primers were synthesized by Sangon Biotech Co., Ltd., Cas12a protease and crRNA were purchased from Guangzhou Bolais Biotechnology Co., Ltd., Cas12 / 13 special nucleic acid detection strips were purchased from Baoying Company, and reverse transcription kits were purchased from Bao Biotech.

[0037] Instruments: Gel imaging analysis system (Bio-Rad), fluorescence quantitative PCR instrument (Bio-Rad CFX), high-speed centrifuge.

[0038] Strains and toxins: DHAV-1 CH strain, DHAV-3 CH60 strain, duck plague virus (DPV), duck reovirus (NDRV), duck Tembusu virus (DTMUV), Riemerella anatipestifer (RA), Escherichia Coli (E. coli), Escherichia coli DH5a, Salmonella enteritidis (SE), Salmonella typhimurium (Sty), Pasteurella multocida (PM), New type gosling viral enteritis virus (NGVEV) were isolated and preserved by the Poultry Disease Control and Prevention Research Center, College of Animal Sciences, Sichuan Agricultural University.

[0039] Embodiment 1: Construction of DHAV-1 nucleic acid detection method based on RT-ERA amplification and CRISPR-Cas12a 1. CrRNA screening and establishment of RT-ERA / CRISPR-Cas12a detection system Initial screening of crRNA The online CRISPR-Cas12a crRNA prediction software CRISPOR was used to screen crRNAs targeting the whole genome sequence of DHAV-1. The high-activity and low-off-target rate crRNA-1, crRNA-2 and crRNA-3 were screened out. The sequences are shown in SEQ ID NO.7-9: The nucleic acid sequence of crRNA-1 is shown in SEQ ID NO.7: 5'-UAAUUUCUACUAAGUGUAGAUCCGAGCCCCCCACAACAUCUGUC-3'; The nucleic acid sequence of crRNA-2 is shown in SEQ ID NO.8: 5'-UAAUUUCUACUAAGUGUAGAUGAUCUUCCAAAUCACUAAAAAGA-3'; The nucleic acid sequence of crRNA-3 is shown in SEQ ID NO.9: 5'-UAAUUUCUACUAAGUGUAGAUGAAUGCCCAAAUGUCAAGAC-3'.

[0040] Screening of crRNA and amplification primers According to the position of crRNA in the DHAV-1 gene, RT-ERA primers are designed, and the size of the amplified product is within the range of 150-300 bp, so that it can amplify the amplicon containing the corresponding crRNA sequence. According to the primer amplification sequence as the target, the corresponding crRNA is selected for Cas12a reaction. The relationship between the primer set and crRNA is RT-ERA-F1 / RT-ERA-R1 corresponding to crRNA-1, RT-ERA-F2 / RT-ERA-R2 corresponding to crRNA-3, RT-ERA-F3 / RT-ERA-R3 corresponding to crRNA-3, and the primer sequence is shown in SEQ ID NO.1-6. The above-mentioned different combination reaction systems are respectively subjected to RT-ERA / CRISPR-Cas12a detection and preliminary screening verification.

[0041] The nucleic acid sequence of RT-ERA-F1 is shown in SEQ ID NO.1: 5'-GATTACCGGTAGTAGCATCTTAGACTACCAA-3'; The nucleic acid sequence of RT-ERA-R1 is shown in SEQ ID NO.2: 5'-TCATGAAAGTCTACTGGTATTATAGTGTGTG-3'; The nucleic acid sequence of RT-ERA-F2 is shown in SEQ ID NO.3: 5'-TTAGGCCTTGAATGTTGGAATCCTATAAAT-3'; The nucleic acid sequence of RT-ERA-R2 is shown in SEQ ID NO.4: 5'-TTTAGAGATTTTTCCTTCTTTTGGTTTTGC-3'; The nucleic acid sequence of RT-ERA-F3 is shown in SEQ ID NO.5: 5'-GAATTTCAGACATATTTGCAATAGACTCGT-3'; The nucleic acid sequence of RT-ERA-R3 is shown in SEQ ID NO.6: 5'-GGTATATCACATCCAATAACTGGAGATCA-3'; The RT-ERA / CRISPR-Cas12a detection reaction system is as follows: 50 μL reaction system contains 20 μL ERA solvent, 2 μL upstream and downstream primers (10 μmol / L), 1 μL Cas12a and crRNA, and 1 μL ssDNA fluorescent probe (10 μmol / L). Add DEPC water to 46 μL, mix well, add 2 μL of the sample RNA template to be tested, and then add 2 μL of ERA reaction activator. Incubate the reaction tube at 37°C for 30 minutes, and take a photo under ultraviolet light using a gel imaging system. The results are as follows. Figure 1 As shown. Figure 1 It can be seen that crRNA1-3 can all achieve rapid visual detection of DHAV-1, among which crRNA-3 can cleave the ssDNA fluorescent probe in the system to the greatest extent, release the most fluorescent signals in a short time, and show the strongest fluorescence intensity, indicating that it has the highest activity. The results are consistent with the reaction activity scores predicted by the online software CRISPOR. Therefore, crRNA-3 was selected for subsequent experiments and also for subsequent chromatography test strip experiments.

[0042] Wherein, the nucleic acid sequence of the ssDNA fluorescent probe is shown in SEQ ID NO.10: 5′-6-FAM-TTTTTT-BHQ-1-3′.

[0043] Construction of standard plasmid The extracted DHAV-1 RNA was reverse transcribed using the reverse transcription kit of Bao Bio, and then the gene fragment containing crRNA-3 was amplified using a high-fidelity enzyme and RT-ERA-F3 / RT-ERA-R3 primers to obtain an amplified product with a length of 222 bp. The DNA fragment was recovered using a gel recovery kit, and the recovered DNA was sequenced. The sequencing results were corrected by BLAST alignment, and the nucleotide sequence is shown in SEQ ID NO.11. The 3' end of the above-mentioned recovered PCR product was added with Taq enzyme and connected to the pMD-19T vector. The ligated product was transferred into E. coli DH5α competent cells and evenly spread on Amp-resistant LB solid plates. On the second day, a single colony with good growth was picked for expansion culture, and the plasmid was extracted using a plasmid extraction kit. The extracted plasmid pMD19-T-ERA3 was sequenced, and it can be used as a standard plasmid after confirming that the sequence is correct.

[0044] The nucleotide sequence is shown in SEQ ID NO.11: 5'-gaatttcagacatatttgcaatagactcgtcaatgtgagtaatgaggatgaagtagccactggtttagccattggtgggaaaaatg tcttgacatttgggcattctaaatttacacaattggatgagattagggacatgcaattcaatgcaccagctaaggggacccccattacttatgatggagaacccactgatctccagttattggaatgtgatatacc-3'.

[0045] optimization (1) Optimization of crRNA concentration in RT-ERA / CRISPR-Cas12a detection system In order to detect the effect of different concentrations of crRNA-3 on fluorescence intensity and reaction time in the CRISPR-Cas12a reaction system, the standard plasmid was used as a positive detection template to detect the fluorescence intensity of crRNA-3 at different final concentrations. The final concentrations of crRNA-3 were 12.5, 25, 50, 100 and 200 nmol / L, and the reaction temperature of the detection system was 37°C. The fluorescence intensity of each group was observed, and the detection results are shown in Figure 2 (A) and Figure 2 (B). As can be seen from Figure 3 (A) and Figure 3 (B), obvious fluorescence can be detected when the final concentration of crRNA in the CRISPR-Cas12a reaction system is 50 nmol / L.

[0046] (2) Optimization of Cas12a concentration in RT-ERA / CRISPR-Cas12a detection system In order to detect the effect of Cas12a protease concentration on the reaction in the CRISPR-Cas12a reaction system, the concentration of Cas12a protease in the reaction system was set to 12.5, 25, 50, 100 and 200 nmol / L, respectively, and the reaction was carried out at 37°C. The fluorescence intensity generated by each group of reactions was observed, and the detection results are shown in Figures 3 (A) and 3 (B). As can be seen from Figures 3 (A) and 3 (B), when the final concentration of Cas12a in the enzyme cleavage system is 50 nmol / L, the reaction has strong fluorescence, and a relatively obvious fluorescence signal can be observed in a short time.

[0047] (3) Optimization of reaction time in RT-ERA / CRISPR-Cas12a detection system In order to achieve rapid detection of DHAV-1 by the RT-ERA / CRISPR-Cas12a system, the reaction time of the system was optimized based on the above crRNA screening and concentration optimization.

[0048] The final concentration of Cas12a protease and crRNA in the system was set to 50 nmol / L. The fluorescence intensity of the system was detected using a gel imaging system at 0, 5, 10, 15, 20, 25, and 30 min of the reaction. The detection results are shown in Figure 5. Figure 4 As shown. Figure 4 It can be seen that fluorescence begins to appear when the system reacts for 5 minutes, and the fluorescence signal is very strong when the reaction is carried out for about 30 minutes.

[0049] According to the optimization results, the optimal detection system is obtained.

[0050] In order to verify the effectiveness of the detection system obtained above in the reaction system provided in the present application, the inventors conducted specific detection and sensitivity detection on the above optimized reaction system, and tested the detection results using the RT-qPCR method. The detection method and detection results are as follows.

[0051] 1. Specificity detection of RT-ERA / CRISPR-Cas12a detection system The genomes of DHAV-1 and 10 other common clinical duck infectious diseases were extracted respectively, including duck hepatitis A virus type 3 (DHAV-3) CH60 strain, duck reovirus (NDRV), duck Tembusu virus (DTMUV), Riemerella anatipestifer (RA), Escherichia coli (E. coli), Salmonella enteritidis (SE), Salmonella typhimurium (Sty), Pasteurella multocida (PM), and gosling novel viral enteritis virus (NGVEV). The nucleic acid of healthy duck liver was extracted as the negative control group and detected using the RT-ERA / CRISPR-Cas12a system. The test results are shown in the figure. Figure 5 As shown. Figure 5 It can be seen that only the DHAV-1 experimental group showed obvious fluorescence, while other common pathogens had no fluorescence, indicating that this detection system has good specificity.

[0052] 2. Sensitivity test of RT-ERA / CRISPR-Cas12a detection system The ten-fold dilution method was used to explore the minimum detection limit of the detection method for the number of viral copies. 7 The DHAV-1 RNA of 10 copies / uL was diluted ten-fold with RNase-free sterile water, and the RNA of different concentration gradients was detected by RT-ERA coupled with Cas12a detection method. At the same time, the same sample was detected by RT-qPCR method to determine the minimum viral copy number of this method. The test results are shown in Figure 6 As shown. Figure 6 As can be seen from the figure, the detection system can detect 10-6 The detection limit of the virus RNA was about 100 copies / uL DHAV-1.

[0053] 3. Verification of DHAV-1 results using the RT-ERA / CRISPR-Cas12a detection system The dead ducks collected from duck farms in various places in recent years were used as test samples. The detection system was used to detect the RNA of 32 dead duck tissues. At the same time, the RT-qPCR method was used to detect the DHAV-1 copy number in the tissue RNA. The detection results of the two methods were compared. The results are as follows: Figure 7 As shown, this method detected 24 positive results, and quantitative PCR detected 28 positive results. The results showed that the compliance rate of this method reached more than 85%. It can be seen that the accuracy of this detection system is relatively high.

[0054] In addition, before preparing the test kit, it is necessary to design the test strips and optimize the adaptability of the reaction system based on the reaction system.

[0055] (1) Selection of test strips An ssDNA-biotin reporter molecule is designed, and one end of the probe is modified with a biotin group and the other end is modified with a fluorescent group FAM. Anti-fluorescein antibodies are added to the test strip. These antibodies labeled with gold nanoparticles can specifically bind to the FAM fluorescent group exposed after the ssDNA-biotin reporter molecule is cut. When the target sequence is present in the system, the Cas12a protease can cut the ssDNA-biotin reporter probe, causing the FAM group to separate from the Biotin group, and the FAM group is exposed in the system. In the Cas12a-specific nucleic acid detection test strip, the detection line (T line) contains a second antibody that can bind to the antibody labeled with gold nanoparticles. The quality control line (C line) contains streptavidin that can bind to the biotin group. The introduction of the test strip method will help to further improve the efficiency of on-site detection in clinical practice, shorten time, and simplify detection operations. Figure 8 As shown, the FAM group will aggregate with the antibody labeled with gold nanoparticles on the detection line (T line) of the test strip, thereby showing color. The quality control line (C line) can show color in the absence of target sequence.

[0056] The RT-ERA coupled CRISPR-Cas12a reaction was performed according to the above method, and the fluorescent probe in the reaction was replaced with a biotin reporter probe. The final concentrations of the biotin reporter probe, crRNA, and Cas12a in the detection reaction system were explored. When the reaction was completed, the test strip binding pad end was immersed in the PCR reaction tube to observe the results.

[0057] The nucleic acid sequence of the ssDNA biotin reporter probe is shown in SEQ ID NO.12: 5′-6-FAM-TTTTTT-Biotin-3′.

[0058] (2) Optimization of crRNA concentration in RT-ERA / CRISPR-Cas12a test strips In order to evaluate the effect of different concentrations of crRNA-3 on the detection results in the CRISPR-Cas12a test strip detection system, the standard plasmid was used as the positive detection template, and crRNA-3 was set at different final concentrations of 12.5, 25, 50 and 100 nmol / L, and the system reaction temperature was 37°C. Fig. 9 It was shown that the test strip had a better detection effect when the final concentration of crRNA-3 in the CRISPR-Cas12a reaction system was 50 nmol / L.

[0059] (3) Optimization of Cas12a concentration in RT-ERA / CRISPR-Cas12a test strips In order to evaluate the effect of Cas12a protease concentration on the reaction in the CRISPR-Cas12a reaction system, this study diluted Cas12a protease. The concentration of Cas12a protease in the system was set to 12.5, 25, 50, 100 nmol / L, and 200nmol / L, and the reaction was carried out at 37°C. The results are shown in Fig.10 It shows that when the final concentration of Cas12a in the enzyme cleavage system is 50nmol / L, relatively obvious detection results can be obtained in a short time.

[0060] (4) Optimization of biotin reporter probe concentration for RT-ERA / CRISPR-Cas12a test strips In order to evaluate the effect of different concentrations of biotin reporter probe on the detection results in the CRISPR-Cas12a reaction system, the standard plasmid was used as the positive template to detect the effect of different final concentrations of biotin reporter probe on the results. The final concentrations of biotin reporter probe were 1000, 500, 200 and 100 nmol / L, respectively. The reaction temperature of the detection system was 37°C, and the reaction results of each test strip were observed. The results are shown in Figure 2. Fig.11 It shows that better reaction results can be obtained when the final concentration of the biotin reporter probe in the CRISPR-Cas12a reaction system is 5 μmol / L.

[0061] According to the optimization results, a detection system suitable for the kit can be obtained, and the kit can be designed according to the detection system suitable for the kit.

[0062] In order to verify the test kit detection system provided by the present application, the inventors compared and verified the test results of the above-mentioned optimized test kit detection system with the detection results of the fluorescent quantitative PCR method, and the verification results are as follows: The biotin reporter probe of the present invention is used as a probe in the RT-ERA coupled CRISPR-Cas12a detection method. The Biotin group is exposed by cutting the probe, and a specific antigen-antibody binding reaction occurs at the positive line position of the test strip, thereby achieving the purpose of detection. The 18 collected clinical samples were tested using the RT-ERA / CRISPR-Cas12a test strip method and the fluorescent quantitative PCR method. As shown in Figures 12 (A) and 12 (B), the test strip provided by the present application detected 14 positive results and 16 positive results by quantitative detection, with a compliance rate of more than 85%.

[0063] It can be seen that the rapid detection kit for duck hepatitis A virus type 1 provided in the present application has a high accuracy of detection results, a high sensitivity of the detection system, a strong specificity, and a rapid and accurate detection, which is conducive to wide application.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them; although the present application is described in detail with reference to the above embodiments, ordinary technicians in this field should understand that they can still modify the technical solutions recorded in the above embodiments, or replace part or all of the technical features therein with equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application. .

Claims

1. A method for constructing a rapid virus detection system, characterized in that: The following steps are involved: Step 1: Initial screening The online CRISPR-Cas12a crRNA prediction software CRISPOR was used to screen crRNA targeting the whole genome sequence of DHAV-1 to obtain a preliminary screening group of crRNA sequences; Step 2: Design primers Design RT-ERA primers based on the position of each crRNA sequence in the DHAV-1 gene and the size of the amplified product in the crRNA sequence preliminary screening group to obtain primers corresponding to each crRNA sequence in the preliminary screening group; Step 3: Verification Select crRNA and the corresponding primer amplification sequence as the target for RT-ERA / CRISPR-Cas12a detection, and screen the crRNA sequence and corresponding primer with the highest fluorescence intensity as the reaction system; Step 4: Construction of standard plasmid According to the crRNA sequence and corresponding primers screened in step 3, the gene fragment containing the corresponding crRNA is amplified using the primers, and the length is within the range of 150-300 bp, and the corresponding DNA fragment is recovered, and the 3' end of the DNA fragment is added with Taq enzyme and then connected with the pMD-19T vector to obtain a connection product; the connection product is transferred into competent cells for cell culture and plasmids are extracted from them to obtain a standard plasmid; Step 5: System Optimization Using the standard plasmid as a positive detection template, the crRNA concentration, Cas12a concentration, and Cas12a reaction time were optimized to obtain a rapid detection system with a reaction time of no more than 30 min.

2. The method for constructing a rapid virus detection system according to claim 1, characterized in that: The activity of the crRNA sequences in the crRNA sequence preliminary screening group is not less than 80 points, and the off-target rate is not more than 3; and / or In step 2, the primers are designed so that the length of the amplified product is within the range of 150-300 bp.

3. The method for constructing a rapid virus detection system according to claim 2, characterized in that: In step 3, the corresponding reaction system obtained includes: ERA dissolving agent with a volume concentration of 40%, upstream primer solution with a volume concentration of 1-10%, downstream primer solution with a volume concentration of 1-10%, Cas12a with a volume concentration of 0.5-5%, crRNA with a volume concentration of 0.5-5%, ssDNA fluorescent probe solution with a volume concentration of 0.5-5%, RNA template with a volume concentration of 4%, and ERA reaction activator with a volume concentration of 4%; The concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the ssDNA fluorescent probe in the ssDNA fluorescent probe solution is 10 μmol / L.

4. The method for constructing a rapid virus detection system according to claim 3, characterized in that: After the reaction system was incubated at 37° C. for 30 minutes, a gel imaging system was used to take photos under ultraviolet light to obtain the test results.

5. The method for constructing a rapid virus detection system according to claim 1, characterized in that: The crRNA sequence preliminary screening group selected in step 1 includes at least three crRNA sequences.

6. A rapid detection system for duck hepatitis A virus type 1, characterized in that: Including an ERA dissolving agent with a volume concentration of 40%, an upstream primer solution with a volume concentration of 4%, a downstream primer solution with a volume concentration of 4%, a Cas12a with a molar concentration of 50 nmol / L, a crRNA with a molar concentration of 50 nmol / L, a probe solution with a volume concentration of 2%, an RNA template with a volume concentration of 4%, and an ERA reaction activator with a volume concentration of 4%; Wherein, the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; Wherein, the RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5-6; The sequence of the crRNA is selected from the sequence in SEQ ID NO.

9.

7. The rapid detection system for duck hepatitis A virus type 1 according to claim 6, characterized in that: The probe solution includes a ssDNA fluorescent reporter probe; Cas12a protease cuts the ssDNA-fluorescent reporter probe, separating the FAM group from the quencher group BHQ, and its FAM group is exposed in the reaction system to produce fluorescence; The sequence of the ssDNA fluorescent reporter probe is the sequence in SEQ ID NO.

10.

8. A rapid detection kit for duck hepatitis A virus type 1, characterized in that: Including RT-ERA reaction system, Cas12a protein, DHAV-1 specific crRNA, RT-ERA amplification primer pair, ssDNA biotin reporter probe, Cas12 / 13 special nucleic acid detection test strip; The RT-ERA amplification primer pair is the corresponding sequence shown in SEQ ID NO.5 and SEQ ID NO.6; The sequence of the DHAV-1 specific crRNA is selected from the sequence in SEQ ID NO.9; The sequence of the DNA probe is the sequence in SEQ ID NO.

12.

9. The rapid detection kit according to claim 8, characterized in that The RT-ERA reaction system in the detection kit includes an ERA dissolving agent, an RNA template and an ERA reaction activator; The concentrations of the ERA dissolving agent, RNA template and ERA reaction activator in the kit are 40%, 4% and 4% by volume respectively; The concentrations of the Cas12a protein, DHAV-1 specific crRNA, RT-ERA amplification primer pair, ssDNA fluorescent reporter probe, and ssDNA biotin reporter probe are respectively 4% by volume of an upstream primer solution, 4% by volume of a downstream primer solution, 50 nmol / L of Cas12a, 50 nmol / L of crRNA, 1% by volume of an ssDNA fluorescent probe solution, and 1% by volume of an ssDNA biotin reporter probe solution; the concentration of the upstream primer in the upstream primer solution is 10 μmol / L, the concentration of the downstream primer in the downstream primer solution is 10 μmol / L, and the concentration of the probe in the probe solution is 10 μmol / L; the concentration of the ssDNA biotin reporter probe in the ssDNA biotin reporter probe solution is 10 μmol / L. 10.1 A method for rapid detection of duck hepatitis A virus, characterized in that: The following steps are involved: (1) Extract the total RNA of the sample to be tested as a template; (2) configuring a reaction system with an ssDNA biotin reporter probe as a probe, labeling one end of the probe with Biotin and the other end with FAM to obtain a biotin-labeled probe, adding the RNA template obtained in S1, and performing an isothermal amplification reaction using the RT-ERA primer to obtain an RT-ERA amplification product; (3) S3: Use the amplified product obtained in S2 to activate the Cas12a enzyme activity of the CRISPR-Cas12a reaction system to cut the biotin-labeled probe; (4) Use the Cas12a-specific nucleic acid detection test strip to detect the reaction system of S3, and judge the test result based on the color development position.

Images