Cutin regulating composition containing mandelic acid and having skin smoothing and brightening effects and application thereof

Abstract

The invention belongs to the technical field of daily-use chemistry, and particularly relates to a keratin regulating composition containing mandelic acid and having skin smoothing and brightening effects and application of the keratin regulating composition. The composition provided by the invention comprises mandelic acid, lactobionic acid, hydroxyethyl piperazine ethanesulfonic acid, lactobacillus / soybean milk fermentation product filtrate and lactobacillus fermentation lysate. According to the application, mandelic acid, lactobionic acid, hydroxyethyl piperazine ethanesulfonic acid, lactobacillus / soybean milk fermentation product filtrate and lactobacillus fermentation lysate are compounded, so that the activity of KLK family proteases, especially kallikrein 5 (KLK5), can be obviously promoted, the decomposition of desmosome between keratinocytes is promoted, epidermal cells lose cohesion and finally naturally fall off, and the effect of promoting the activity of KLK family proteases is achieved. The cutin exfoliation promoting effect is achieved, so that the problems of skin darkness, roughness, pore blockage, acne and the like are solved, the glossiness and fineness of the skin are improved, and healthy and bright skin is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of daily chemical products, and in particular to a keratin regulating composition containing mandelic acid and having the effect of delicately brightening the skin and an application thereof. Background Art

[0002] Skin is the largest organ in the human body, and its epidermal cell renewal cycle is usually about 28 days. This cycle covers the division of basal cells, the migration and differentiation of keratinocytes, and the final shedding of keratinocytes. The stratum corneum is mainly composed of highly differentiated keratinocytes, extracellular cornified capsules and keratin fibers, which are connected to each other by corneocyte granules. The human epidermis (SC) is composed of 15 to 20 layers of cells formed in the basal layer of the epidermis. These cells are gradually pushed to the outermost layer of the skin, where they shed to maintain epidermal homeostasis. The normal metabolic shedding of the stratum corneum depends on specific proteases, such as serine proteases (kallikrein 5 (KLK5)) and cathepsins, which gradually decompose the desmosomes between keratinocytes, causing the epidermal cells to lose cohesion and eventually fall off naturally as tiny flakes. However, this process is disturbed with age. According to studies, the renewal rate of the stratum corneum gradually decreases after the age of 20 (Journal of Gerontology, 1983, 38(2), 137-142). When the metabolism of the stratum corneum is abnormal, the accumulation of waste keratin will cause the skin to appear dull, rough, clogged pores, and acne.

[0003] At present, the common keratin renewal active substances mainly work through the following four mechanisms: 1. Maintaining the acidic environment of the stratum corneum to provide suitable enzymatic conditions for serine proteases; 2. Increasing the activity of KLK family proteases to promote keratin exfoliation; 3. Chelating calcium ions in the stratum corneum, changing the calcium ion concentration in keratinized granules, and inducing keratinocyte dissociation; 4. Directly acting on the desmosome structure to accelerate its decomposition. Among them, the use of α-hydroxy acids (AHA, such as fruit acid) or β-hydroxy acids (BHA, such as salicylic acid) is a typical method of chemical exfoliation and is also the most widely used method at present. For example, the use of ingredients such as 3%~6% fruit acid (pH 3.5~4.5) or 1%~2% salicylic acid (pH 3.5~4.5) can chelate calcium ions in the stratum corneum, thereby reducing the calcium ion concentration (calcium ions are the key factor in maintaining the stability of desmosomes), loosening the desmosome structure, and promoting the shedding of old and dead keratinocytes. However, the acid components disclosed so far have little effect on promoting the activity of KLK family proteases, especially KLK5. Summary of the invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a keratin regulating composition containing mandelic acid and having the effect of delicate and brightening skin and its application. The composition provided in the present application has a significant promoting effect on KLK family proteases, especially KLK5, thereby promoting the renewal of skin epidermal cells, thereby improving the glossiness and delicateness of the skin.

[0005] The present application provides a keratin regulating composition containing mandelic acid and having the effect of delicate and brightening skin, comprising: mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate.

[0006] The present application compounds mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate, which can significantly promote the activity of KLK family proteases, especially kallikrein 5 (KLK5), promote the decomposition of desmosomes between keratinocytes, cause epidermal cells to lose cohesion, and eventually fall off naturally, achieving the effect of promoting keratin exfoliation, thereby solving problems such as dull skin, rough skin, clogged pores and acne, improving the gloss and fineness of the skin, and achieving healthy and translucent skin.

[0007] Mandelic acid, also known as mandelic acid and mandelic acid, has the following structural formula: ; Mandelic acid is a fat-soluble α-hydroxy acid, which is a relatively mild fruit acid and has the following effects: Whitening: Mandelic acid can inhibit tyrosinase activity and reduce the production of melanin; Improve skin texture: Mandelic acid can promote the renewal of skin stratum corneum, making the skin smooth and delicate; Antibacterial and anti-inflammatory: Mandelic acid can inhibit skin inflammatory bacteria and improve skin inflammation problems; Moisturizing: Mandelic acid can help the skin lock in moisture and enhance the skin's moisturizing ability.

[0008] The present application has no special limitation on the mandelic acid, and preferably the mandelic acid is di-configuration DL-mandelic acid, which can be purchased on the market.

[0009] Lactobionic acid, molecular formula is C 12 H 22 O 12 , the structural formula is as follows: ; Lactobionic acid is a polyhydroxy acid, which is a relatively mild fruit acid and has multiple functions such as moisturizing, repairing, anti-aging, and anti-oxidation. The present application has no special restrictions on the lactobionic acid, and the product purchased on the market can be used.

[0010] Mandelic acid and lactobionic acid are both relatively mild fruit acids. Under acidic conditions, they mainly promote keratin exfoliation by competitively binding to calcium ions of cadherin on desmosomes, thereby reducing the connectivity of desmosomes. However, the applicant found that after compounding with hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate, mandelic acid and lactobionic acid can also exert an exfoliating effect by promoting the activity of KLK5 protease even at a higher pH close to neutral.

[0011] Hydroxyethylpiperazineethanesulfonic acid, molecular formula is C8H 18 N2O4S, the structural formula is as follows: ; Hydroxyethylpiperazineethanesulfonic acid has the following effects: Soften skin cuticles: Hydroxyethylpiperazine ethane sulfonic acid has the effect of loosening cuticles and can help remove aged cuticles on the skin surface; Regulate skin pH: Hydroxyethylpiperazineethane sulfonic acid can maintain a relatively stable weak acid range for a long time, which can help adjust the pH of the skin and maintain the pH of the skin surface at a more suitable state to help improve skin condition; Sunscreen and whitening: Hydroxyethylpiperazine ethane sulfonic acid can absorb ultraviolet rays and reduce the stimulation of ultraviolet rays on pigment cells, thereby reducing the formation of melanin in the skin.

[0012] In the present application, after compounding with mandelic acid, lactobionic acid, lactobionic acid / soy milk fermentation product filtrate and lactobionic fermentation lysate, hydroxyethylpiperazineethanesulfonic acid is used as a zwitterionic buffer to enhance the delivery efficiency of mandelic acid and lactobionic acid to the deep layer of the epidermis by adjusting the surface charge of the cell membrane, and at the same time, it can optimize the active environment of KLK5 protease, thereby promoting the activity of KLK5 protease. The present application has no special restrictions on the hydroxyethylpiperazineethanesulfonic acid, and the product purchased on the market can be used.

[0013] Lactobacillus / soymilk fermentation product filtrate, English name LACTOBACILLUS / SOYMILK FERMENT FILTRATE, is a black soybean milk filtrate obtained by fermenting a variety of lactobacilli, and has protective, soothing, moisturizing, repairing and whitening effects. The present application has no special restrictions on the lactobacillus / soymilk fermentation product filtrate, and a commercially available product can be used, for example, it can be a commercially available product with a trade name of OPTIMEAL 10W.

[0014] Lactobacillus fermentation lysate, also known as LACTOCOCUS FERMENT LYSATE, is a complex obtained by cell lysis during lactobacillus fermentation. It is rich in amino acids, small peptides, polysaccharides and B vitamins and has multiple functions: ‌Promote skin cell renewal‌: Lactic acid bacteria fermentation lysate can enhance the skin's metabolic function and keep the skin young.

[0015] Strengthen the skin barrier: Lactic acid bacteria fermentation lysate reduces the damage to the skin from the external environment, such as ultraviolet rays, pollution, etc.

[0016] ‌Antioxidant‌: Lactic acid bacteria fermentation lysate can resist the damage of free radicals and slow down the aging process of skin.

[0017] ‌Soothing Skin‌: Lactobacillus ferment lysate helps relieve skin problems such as allergies and inflammation.

[0018] The present application has no special limitation on the lactic acid bacteria fermentation lysate, and any commercially available product may be used, for example, a commercially available product with the trade name ProRenew Complex CLR™ NP.

[0019] In the present application, the lactobacillus / soymilk fermentation product filtrate and the lactobacillus fermentation lysate, through their rich postbiotic components, such as cytoplasmic contents, small molecule peptides, polysaccharides, amino acids, etc., form a synergistic network with mandelic acid, lactobionic acid and hydroxyethylpiperazineethane sulfonic acid, and efficiently regulate the KLK5 protease activity from multiple dimensions.

[0020] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate is: 1~10:1~10:1~20:0.1~20:1~20.

[0021] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate is: 1~3:1~3:10~18:1~10:1~10.

[0022] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate is: 1~3:1~2:12~17:1~2:1~2.

[0023] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate is: 2:1.1:15:1:1.1.

[0024] The above-mentioned keratin regulating composition provided in the present application can promote the activity of kallikrein 5 (KLK5), thereby promoting keratin exfoliation, improving the glossiness and fineness of the skin, and achieving the effect of fine and bright skin. The experimental results show that compared with the compound of mandelic acid and lactobionic acid, the compound of mandelic acid, lactobionic acid and lactic acid bacteria fermentation lysate reduces the expression of KLK5 protease mRNA, and the compound of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate further greatly increases the expression of KLK5 protease mRNA. Therefore, it can be considered that the addition of hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate significantly enhances the function of mandelic acid and lactobionic acid in promoting the activity of KLK5 protease.

[0025] The present invention also provides a product, comprising: the composition described in the above technical solution.

[0026] In some embodiments of the present invention, the above products include but are not limited to personal care products, medicines, etc. Those skilled in the art can understand that, in addition to the composition described in the above technical solution, other excipients are also included, such as pharmaceutical excipients or excipients for personal care products.

[0027] In some embodiments of the present invention, the personal care product comprises: a basic care product and / or a makeup product.

[0028] In some embodiments of the present invention, the cosmetic products include but are not limited to: (1) Foundation makeup: Liquid foundation / cream: used to even out skin tone and cover blemishes; BB cream / CC cream: a light makeup base product that combines skin care and finishing effects; Concealer / pen: for covering local areas such as acne, dark circles, etc.; Loose powder / face powder: sets makeup and reduces facial shine.

[0029] (2) Eye makeup: Eyeshadow: Add color and depth to the eyes; Eyeliner pencil / liquid / gel: outline the eyeliner to make the eyes look more vivid; Mascara: lengthens and thickens eyelashes, making eyes look deeper; Eyebrow pencil / eyebrow powder / eyebrow gel: fill in the gaps in the eyebrows and shape the ideal eyebrow shape.

[0030] (3) Cheek makeup: Blush: add natural redness to cheeks and improve complexion; Contouring cake / stick: Use shading techniques to make the facial contour more three-dimensional; (4) Lip makeup: Lipstick / Lip Glaze / Lip Gloss: Change or emphasize the color of lips; Lip liner: Draw a clear lip boundary to prevent lipstick from overflowing.

[0031] (5) Multifunctional cosmetics: Highlighter stick / liquid / powder: brightens the high points of the face (such as the bridge of the nose and cheekbones) to create a radiant look.

[0032] In addition, there are products designed specifically for special occasions, such as waterproof and sweat-proof eyeliners, long-lasting lipsticks, etc.

[0033] In some embodiments of the present invention, the basic care products include but are not limited to: Facial cleanser / facial cleanser: gently removes facial dirt, oil and makeup residue; Makeup remover oil / makeup remover water / makeup remover cream: specially used to completely remove makeup, especially waterproof makeup; Toner / make-up water: Use after cleansing to further clean the residue on the skin surface, replenish moisture for the skin, restore the pH balance of the skin, and lay a good foundation for the absorption of subsequent skin care products; Essence: Contains high concentrations of active ingredients, providing deep nourishment and repair for specific skin problems (such as anti-aging, moisturizing, whitening, etc.); Eye cream: specially designed for the sensitive area around the eyes, it can reduce fine lines, dark circles and tighten the skin around the eyes. The texture is usually light and easy to absorb; Day / night lotion or cream: has the functions of protecting, repairing and nourishing, promoting cell regeneration, etc., can provide the skin with necessary moisture and lock in the replenished moisture; Sunscreen: used for UV protection, prevention of photoaging, etc.; Facial masks: provide extra nourishment and care to the skin, such as hydration, pore cleansing or brightening.

[0034] In some specific implementations, the personal care product is essence water, which includes 0.1wt%~5wt% of the composition described in the above technical solution, preferably includes 0.5wt%~4wt% of the composition described in the above technical solution, more preferably includes 1wt%~3wt% of the composition described in the above technical solution, and most preferably includes 1.1wt%~2.5wt%.

[0035] In some specific implementations, the essence water further comprises: 0.1wt%~1wt% disodium EDTA; 1wt%~5wt% propylene glycol; 0.01wt%~0.5wt% sodium hyaluronate; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizinate; 0.01wt%~1wt% of acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~1wt% aminomethyl methanol aqueous solution; The remaining amount of water.

[0036] In some specific implementations, the essence water includes: 0.1wt%~1wt% disodium EDTA; 1wt%~5wt% propylene glycol; 0.01wt%~0.5wt% sodium hyaluronate; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizinate; 0.01wt%~1wt% of acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~5wt% of the composition described in the above technical solution; 0.1wt%~1wt% aminomethyl methanol aqueous solution; The remaining amount of water.

[0037] In some specific implementations, the essence water includes: 0.5wt% disodium EDTA; 2wt% propylene glycol; 0.1wt% sodium hyaluronate; 0.5wt% panthenol; 0.1wt% dipotassium glycyrrhizinate; 0.1wt% of acetylated sodium hyaluronate; 6wt% butanediol; 0.2wt% p-hydroxyacetophenone; 1 wt% 1,2-hexanediol; 1 wt% 1,2-pentanediol; 2.02% of the composition described in the above technical solution; 0.4wt% aminomethyl methanol aqueous solution; The remaining amount of water.

[0038] After using the essence water provided in the present application for 14 and 28 days, the skin gloss and roughness are significantly improved, and with the extension of the use time, the improvement of skin gloss and roughness is gradually increasing, that is, the essence water provided in the present application has the effect of brightening and delicate skin, which proves that the composition of the present invention can enhance the gloss and smoothness of the skin.

[0039] The present application compounds mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate, which can significantly promote the activity of KLK family proteases, especially kallikrein 5 (KLK5), promote the decomposition of desmosomes between keratinocytes, cause epidermal cells to lose cohesion, and eventually fall off naturally, achieving the effect of promoting keratin exfoliation, thereby solving problems such as dull skin, rough skin, clogged pores and acne, improving the gloss and fineness of the skin, and achieving healthy and translucent skin. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The figure is a bar graph showing how the composition promotes KLK5 gene expression. DETAILED DESCRIPTION

[0041] The present invention provides a keratin regulating composition containing mandelic acid and having the effect of delicately brightening the skin and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0042] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0043] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0044] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0045] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0046] The present application provides a keratin regulating composition containing mandelic acid and having the effect of delicate and brightening skin, comprising: mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate.

[0047] The above-mentioned keratin regulating composition provided in the present application can promote the activity of kallikrein 5 (KLK5), thereby promoting keratin exfoliation, improving the glossiness and fineness of the skin, and achieving the effect of fine and bright skin. The experimental results show that compared with the compound of mandelic acid and lactobionic acid, the compound of mandelic acid, lactobionic acid and lactic acid bacteria fermentation lysate reduces the expression of KLK5 protease mRNA, and the compound of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate further greatly increases the expression of KLK5 protease mRNA. Therefore, it can be considered that the addition of hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactic acid bacteria fermentation lysate significantly enhances the function of mandelic acid and lactobionic acid in promoting the activity of KLK5 protease.

[0048] The composition and application of the present invention are further described below in conjunction with the examples.

[0049] Comparative Example 1 Mandelic acid and lactobionic acid are mixed in a mass ratio of 2:1.1 to obtain a composition.

[0050] Comparative Example 2 Mandelic acid, lactobionic acid and lactic acid bacteria fermentation lysate are mixed in a mass ratio of 2:1.1:8 to obtain a composition.

[0051] Example 1 Mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactic acid bacteria fermentation lysate and lactobacillus / soymilk fermentation product filtrate solution are mixed in a mass ratio of 2:1.1:15:1.1:1 to obtain a composition.

[0052] Test Example 1 1. Experimental Materials 1. Cells and reagents Human immortalized keratinocyte cell line (HaCaT); DMEM medium (Gibco); Standard fetal bovine serum (Gibco); Lactobionic acid; Mandelic acid; Hydroxyethylpiperazineethanesulfonic acid; Lactobacillus / soy milk fermentation product filtrate (OPTIMEAL10W); Lactic acid bacteria fermentation lysate (ProRenew Complex CLR™ NP); 0.25% pancreatin (Gibco); Sterile PBS (pH=7.4, Gibco); GPCR-specific premix reagent (SYBR Green Master Mix, Thermo Fisher Scientific Inc); Primer synthesis (BioTNT); Nuclease-free (DEPC) water (Ya-zyme); RNAiso plus (Total RNA extraction reagent) (Thermo Fisher Scientific Inc, Thermo Fisher); Anhydrous ethanol, dimethyl sulfoxide, chloroform, isopropanol, etc.; 2. Equipment: CO2 cell incubator (Haier Medical); Clean bench (Haier Medical); Low-speed centrifuge (Beckman); High-speed cryogenic centrifuge (Beckman); High-throughput real-time fluorescence quantitative PCR instrument Bio-Rad CFX OPUS 384 (Bio-Rad).

[0053] 2. Experimental Methods 1. Cell culture 1. Culture medium and culture conditions Human keratinocytes were cultured in 6-well plates using DMEM medium containing 10% fetal bovine serum and 1% double antibody, and then placed in a cell incubator at 37°C and 5% CO2; 2. Recovery of keratinocytes Take out the cryotube from the liquid nitrogen tank, quickly put it into a 37℃ warm water bath to thaw it quickly, centrifuge at 300g×5min, carefully remove the supernatant with a sterile dropper, add an appropriate amount of DMEM culture medium to the precipitate and mix well, then dilute and transfer to a 6-well plate for culture; 3. Medium replacement and subculturing of keratinocytes HaCaT was cultured in DMEM medium, and the medium was changed 3-4 times / week. When the cells grew to about 80% confluence, the cells were digested with 0.25% trypsin, and the digestion was terminated with medium containing 10% serum. After gentle pipetting, the cell suspension was collected and centrifuged, the supernatant was removed, and the cells were resuspended in an appropriate amount of DMEM medium, and the cells were sub-cultured at a ratio of 1:3; 4. Collection and Cryopreservation of Keratinocytes Human keratinocytes in the logarithmic growth phase were selected, digested with 0.25% pancreatic extract, and then added to DMEM medium to make a cell suspension. After centrifugation, the supernatant was discarded, and an appropriate amount of freezing solution (DMEM medium + serum + dimethyl pyruvate) was added. After mixing, the cells were transferred to a cryopreservation tube and placed in a 4°C refrigerator for 1 hour, a -20°C refrigerator for 2 hours, and placed in a -80°C low-temperature refrigerator for short-term storage. Long-term stored cells were stored in a liquid nitrogen tank.

[0054] (II) RT-PCR method to detect the effect of the composition on the expression of KLK5 mRNA in keratinocytes 1. Extraction of Total RNA from Keratinocytes When the cells grow to 80%-90% confluence, digest the cells as usual and place them at a density of 50×10 4The cell suspension was dropped into a 6-well plate, 2 ml / well. After culturing for 24 hours, the compositions of Comparative Example 1 (the final concentrations of mandelic acid and lactobionic acid were 0.2wt% and 0.11wt%, respectively), Comparative Example 2 (the final concentrations of mandelic acid, lactobionic acid, and lactic acid bacteria fermentation lysate were 0.2wt%, 0.11wt%, and 0.8wt%, respectively) and Example 1 (the final concentrations of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactic acid bacteria fermentation lysate, and lactobacillus / soymilk fermentation product filtrate solution were 0.2wt%, 0.11wt%, 1.5wt%, 0.11wt%, and 0.1wt%, respectively) were added, and a negative control group (without drug addition) was set up to continue culturing for 24 hours, with 12 replicates in each group. After continuing culturing for 24 hours, total RNA was extracted from keratinocytes using RNAiso plus (Total RNA extraction reagent). The culture medium in the 6-well plate where the cells were cultured was discarded and washed once with PBS. Every 10cm 2 Add 1ml RNAiso Plus, let it stand horizontally for 5-10 minutes, and repeatedly blow the cells with a pipette to make the cells attached to the well fall off. Transfer the RNAiso Plus lysate containing cells to a sterile centrifuge tube, blow and mix, let it stand at room temperature for 5 minutes, centrifuge at 12000g and 4℃ for 5 minutes, then add 200μl chloroform (about 1 / 5 of the volume of RNAiso Plus) to the above homogenized lysate, shake vigorously for 15s, wait until the solution has no phase separation phenomenon (i.e. fully emulsified), let it stand at room temperature for 5 minutes, and centrifuge at 12000g and 4℃ for 15 minutes. At this time, the liquid in the tube is divided into three layers, the upper layer is a colorless supernatant, the middle layer of white protein, and the bottom colored organic layer. Carefully aspirate the supernatant (about 400-500μl) and transfer it to a new sterile centrifuge tube (do not aspirate the white middle layer). Then add an equal volume (about 400-500μl) of isopropanol to the supernatant, mix thoroughly, let stand at 15-30℃ for 10min, centrifuge at 12000g and 4℃ for 10min, carefully discard the supernatant in the centrifuge tube, slowly add 1ml of 75% ethanol, centrifuge at 12000g and 4℃ for 5min, and discard the ethanol in the tube. Dry the precipitate in the test tube at room temperature for 5min, then add an appropriate amount of RNase-free water (about 20μl), gently blow until the RNA precipitate is completely dissolved, take out 2μl and transfer it to an EP tube, test the concentration and purity of the extracted RNA, and store the rest in a -20℃ or -70℃ refrigerator.

[0055] 2. Primer sequences KLK5 primer sequences: upstream AGATGTTCCAGGGGGTCAAA; downstream TTGATGAGCATGAGGTCGTTAGA ACTB (internal reference) primer sequence: upstream AAGGTGACAGCAGTCGGTT; downstream TGTTGGACTTGGGAGAGG.

[0056] 3. Real-time PCR Quantification 1. Preliminary preparation 1. Reagent preparation: prepare SYBR Green Master Mix, primers (upstream and downstream primers of ACTB and KLK5), cDNA template, nuclease-free water (DEPC), etc.; 2. Primer design: Design specific primers based on the ACTB and KLK5 gene sequences to ensure primer specificity and amplification efficiency. The primers are as above; 3. Instrument preheating: Turn on the Bio-Rad CFX OPUS 384 instrument in advance and preheat it to the appropriate temperature.

[0057] 2. Real-time PCR quantitative experimental steps 1. Prepare the reaction system: prepare a 10 μL reaction system on ice, which usually includes 5 μL SYBR Green MasterMix, 0.5 μL of upstream and downstream primers (adjust the appropriate amount according to the primer concentration), 1 μL cDNA template, and 3 μL nuclease-free water; 2. Sample addition: Carefully add the prepared reaction solution into the corresponding wells of the 384-well plate, taking care to avoid bubbles, and then seal the well plate with a sealing film; 3. Place in the instrument: Place the sealed 384-well plate in the Bio-Rad CFX OPUS 384 instrument, making sure the plate is placed stably; 4. Set up the program: Set up the real-time quantitative PCR reaction program in the instrument software, including pre-denaturation (95°C, 30s), denaturation (95°C, 5s), annealing (set according to the primer Tm value, 60°C, 30s), extension (72°C, 30s), and the number of cycles is usually 40 to 45 cycles. At the same time, set up the fluorescence signal collection step, generally collecting fluorescence signals during the annealing or extension stage; 5. Run the experiment: After confirming that the program settings are correct, click the Run button to start the real-time quantitative PCR experiment; 6. Data analysis: After the experiment, the data were analyzed using the software provided with the Bio-Rad CFX OPUS 384 instrument. First, check the amplification curve and melting curve to ensure good amplification specificity. Then, based on the Ct values ​​of the reference gene ACTB and the target gene KLK5, the relative expression of the KLK5 gene was calculated using the relative quantitative method (2^(-ΔΔCt) method). The results were expressed as the mean value X, and the inter-group comparison was performed using one-way analysis of variance. P<0.05 was considered to be significantly different.

[0058] (III) Data results See Table 1 and Figure 1 , Table 1 is a summary table of the expression levels of KLK5 protease mRNA, Figure 1 The figure is a bar graph showing how the composition promotes KLK5 gene expression.

[0059] Table 1 Summary of KLK5 protease mRNA expression Note: The inter-group comparison was analyzed by t-test, and all statistical analyses were two-tailed. P < 0.05 was considered to be significantly different, and the smaller the P value, the more significant the difference. Compared with the control, the significant difference is indicated by *, * indicates P < 0.05, and ** indicates P < 0.01. Compared with comparative examples 1 and 2, the significant difference is indicated by #, # indicates P < 0.05, and ## indicates P < 0.01.

[0060] Conclusion: See Table 1 and Figure 1 It can be seen that the composition of comparative example 1, the composition of comparative example 2 and the composition of example 1 are all helpful in promoting the expression of KLK5 protease gene, and the increase percentages are 65.6%, 44.8% and 118.2% respectively, and the promotion effect of example 1 is the best; referring to Table 1, it can be seen that compared with comparative example 2, the composition provided in example 1 actually has the effect of significantly promoting the activity of KLK5 protease through synergistic effect, which is 1.8 times that of the composition of comparative example 1 and 2.6 times that of the composition of comparative example 2; based on this, it can be seen that the composition provided in the present application can effectively promote the activity of the skin's own specific hydrolysis desmosome protease KLK5, that is, by restoring the skin's own enzymatic reaction, it helps to improve the skin's own skin rejuvenation ability, thereby helping to improve the skin's glossiness and fineness.

[0061] Test Example 2: Experiment on the efficacy of improving skin gloss and roughness on human body The compositions provided in Comparative Example 2 and Example 1 were prepared into essence water according to the formula shown in Table 2, and human efficacy tests were carried out.

[0062] Table 2 Essence water formula 1. Test plan: 32 subjects, aged 32.78±5.66 years old, with uneven, dull and rough facial skin tone were tested. The test products were randomly applied on the left and right halves of the face every morning and evening for 28 days. The skin gloss was measured at different time points using non-invasive instruments. VC20 was used to capture facial images and analyze the average skin roughness R3, and VISIA-CR facial images were used to capture skin red area analysis.

[0063] 2. Test indicators and instruments ① Specific test plan for skin glossiness: Instrument: Courage+Khazaka, skin gloss test probe GL 200; Parameters: Skin glossiness; Test site: cheeks on both sides (according to the random table); Test method: measure 3 times respectively and take the average value; Test time points: before product use (D0), 14 days after sample use (D14), 28 days after sample use (D28); ② Roughness VC20 imaging test solution: Instrument: Skin surface texture testing system VC-20plus; Parameters: average skin roughness R3; Test site: cheeks on both sides (according to the random table); Test method: Take a photo once; Test time points: before using the product (D0), 14 days after using the product (D14), 28 days after using the product (D28); ③ Indicator VISIA-CR facial image acquisition skin red area test plan: Instrument: Skin red zone area test system VISIA-CR; Parameters: skin red area; Test site: cheeks on both sides (according to the random table); Test method: Take a photo once; Test time points: before using the product (D0), 28 days after using the product (D28).

[0064] 3. Statistics: 1) Descriptive Statistics Calculate the mean, standard deviation, minimum, maximum, and median of each parameter of the test product group at each time point, and calculate the difference between the test product group before using the product (D0) and after using the product (D14, D28); 2) Normal distribution test The above differences were tested for normal distribution using the Shapiro-Wilk Test method using SPSS software. If the asymptotic statistical significance (two-sided) value of the normality test was p>0.05, the data series followed a normal distribution; 3) Evaluation criteria: instrument parameter evaluation; a) Before and after comparison of the product of comparative example 3 in the test group and the product of embodiment 2 in the test group: If the significance level of the statistical method is p<0.05, it means that there are statistically significant differences between the product of the test group comparison example 3 and the test group embodiment 2 before and after use; if the significance level of the statistical method is p≥0.05, it means that there are no statistically significant differences between the product of the test group comparison example 3 and the test group embodiment 2 before and after use.

[0065] 4. The test results are shown in Table 3: Table 3 Summary of 28-day skin test results It can be seen from Table 3 that after using the essence water provided by Comparative Example 3 and Example 2 for 14 and 28 days, the skin gloss and roughness are significantly improved, and in terms of the numerical dimension of the change rate, Example 2 has a greater degree of improvement than Comparative Example 3, and with the increase of use time, the improvement of skin gloss and roughness is also gradually increasing; secondly, it is also found from Table 3 that after continuous use of the products containing Comparative Example 3 and Example 2 for 28 days, the area of ​​the skin red zone has not increased compared with before use, and after statistical difference analysis, there is no significant difference, which proves that the irritation degree of the two products has not increased after continuous use for 28 days; it can be seen that the essence water provided in Example 2 has the effect of brightening and delicate skin, and is not irritating, which proves that the composition of the present invention can improve the gloss and delicateness of the skin.

[0066] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A keratin regulating composition containing mandelic acid and having the effect of delicately brightening the skin, characterized in that: include: Mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate, and lactobacillus fermentation lysate; The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethanesulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate is: 1-10: 1-10: 1-20: 0.1-20: 1-20.

2. The keratin regulating composition according to claim 1, characterized in that The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate is: 1-3:1-3:10-18:1-10:1-10.

3. The keratin regulating composition according to claim 2, characterized in that: The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazineethane sulfonic acid, lactobacillus / soymilk fermentation product filtrate and lactobacillus fermentation lysate is 2:1.1:15:1:1.

1.

4. Use of the keratin regulating composition according to any one of claims 1 to 3 in the preparation of a product that promotes keratin exfoliation.

5. Use of the keratin regulating composition according to any one of claims 1 to 3 in the preparation of a product for promoting kallikrein 5 activity.

6. Use of the keratin regulating composition according to any one of claims 1 to 3 in preparing a product having the effect of delicate and brightening the skin.

7. The product, characterized in that include: The keratin regulating composition according to any one of claims 1 to 3.

8. The product according to claim 7, characterized in that It is a personal care product.

9. An essence water comprising 0.1 wt% to 5 wt% of the keratin regulating composition according to any one of claims 1 to 3.

10. The essence water according to claim 9, characterized in that: Also includes: 0.1wt%~1wt% disodium EDTA; 1wt%~5wt% propylene glycol; 0.01wt%~0.5wt% sodium hyaluronate; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizinate; 0.01wt%~1wt% of acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~1wt% aminomethyl methanol aqueous solution; The remaining amount of water.

Images