DHX8 fusion protein and its preparation method
By preparing the DHX8 fusion protein in the E. coli expression system, the problems of complexity and high cost of baculovirus expression systems were solved, achieving efficient expression and simplified purification of the DHX8 protein, which is suitable for high-throughput screening of DHX8 enzyme activity inhibitors.
Patent Information
- Application Number
- CN202510110158.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2026-04-03
- Estimated Expiration
- 2045-01-23
AI Technical Summary
In existing technologies, the process of expressing DHX8 recombinant protein using baculovirus expression systems is complex, time-consuming, and labor-intensive, and the purified protein is not suitable for high-throughput inhibitor screening.
The DHX8 fusion protein was prepared using the E. coli expression system. The full-length DHX8 protein, which was deleting 234 amino acids at the N-terminus and 263 amino acids at the C-terminus, was supplemented with thioreductase and histidine tags and expressed and purified using the bacterial expression vector pET.32m.3c.
It achieves high expression efficiency and solubility of DHX8 fusion protein, simplifies purification process, is suitable for high-throughput screening of DHX8 enzyme activity inhibitors, and overcomes the complexity and high cost of baculovirus expression systems.
Smart Images

Figure BDA0005256462600000051 
Figure BDA0005256462600000121 
Figure HDA0005256462620000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically, it relates to an RNA helicase DHX8 fusion protein and its preparation method and application. Background Technology
[0002] DHX8 (DEAH-Box Helicase 8) is a protein-coding gene belonging to the DEAH box helicase family. It participates in the RNA splicing process and plays a crucial role in the release of mature mRNA. This protein helps release spliced RNA from the spliceosome by binding to it, allowing it to be translated into protein.
[0003] The structure of DHX8 includes a highly variable N-terminal domain and a conserved C-terminal helicase domain, similar to other DEAH-box RNA helicases. Within the C-terminal helicase domain are two RecA domains (RecA1 and RecA2), which form the core of the helicase and participate in ATP binding and hydrolysis, RNA binding, and helicase activity. In addition, DHX8 also contains a winged-helix, ratchet-like structures, and oligonucleotide-binding (OB) folds. Studies have also found that DHX8 has a preference for adenine-rich RNA and triggers ATP hydrolysis upon RNA binding, leading to the release of ADP. Furthermore, specific structural regions of DHX8, such as the DEAH motif, the "hook" and "bend" regions, are crucial to its function. These regions are believed to be key to regulating the directional movement of RNA through RNA-binding channels.
[0004] Aberrant regulation of alternative splicing is also associated with various human diseases, such as cancer. The full-length DHX8 protein is large and complex, containing over 1220 amino acids and multiple domains, and is widely involved in processes such as binding to other proteins in the spliceosome and recognition of specific substrates. Therefore, research on DHX8 protein expression is extremely important.
[0005] Studies have shown that the DHX8 protein may be essential for the replication of human immunodeficiency virus type 1 (HIV-1). Furthermore, aberrant expression of the DHX8 gene is associated with a variety of diseases, including Cakut (a congenital kidney and urinary tract disorder) and HIV type 1. DHX8 affects 95% of human genes intracellularly through its involvement in alternative splicing processes, and its functional abnormalities may be closely related to cancer development. Therefore, in-depth research into DHX8 and its structure and function is crucial for understanding the complex mechanisms of cancer and developing new therapeutic strategies. For example, novobiocin has been found to act as an inhibitor of DHX8, inhibiting its activity through hydrogen bonding and Pi-Pi interactions with the DHX8 protein.
[0006] In cancer research, DHX8 has been mentioned as a prognostic biomarker for nodular cancer, but it exhibits low cancer specificity across various cancer types. Plasma detection of DHX8 protein showed that it was undetectable by immunoassay, mass spectrometry, and proximity extension assays. Studies have shown that circDHX8 expression is elevated in gastric cancer (GC), and its overexpression significantly enhances the proliferation, invasion, and migration of gastric cancer cells while inhibiting apoptosis. Conversely, knockdown of circDHX8 significantly reduced these effects and suppressed tumor growth in xenograft tumor models.
[0007] Existing technologies adopted The baculovirus expression system for expressing the DHX8 recombinant protein is complex, time-consuming, labor-intensive, and costly to construct, and the purified protein is not suitable for high-throughput screening of inhibitors. Summary of the Invention
[0008] In view of this, the purpose of this invention is to provide a DHX8 fusion protein and its preparation method, so as to solve the problems existing in the prior art.
[0009] The objectives of this invention and the solutions to its technical problems can be achieved through the following implementation schemes.
[0010] On the one hand, the present invention provides a DHX8 fusion protein with ATP hydrolase and helicase activities, the amino acid sequence of which is shown in SEQ ID NO:1.
[0011] Compared to the full-length human RNA helicase DHX8 protein, the DHX8 fusion protein has 234 amino acids missing from its N-terminus but has an added fusion tag, namely a thioreductase protein; and 263 amino acids missing from its C-terminus but has an added purification tag, namely a histidine tag (His-Tag).
[0012] Therefore, in an embodiment of the present invention, the N-terminus of the DHX8 fusion protein has a fusion tag, namely thioreductol protein A (TrxA).
[0013] In a second aspect, the present invention provides a nucleic acid encoding the DHX8 fusion protein.
[0014] In an embodiment of the present invention, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO:2.
[0015] In a third aspect, the present invention provides an expression vector containing nucleic acid encoding the DHX8 fusion protein.
[0016] In a preferred embodiment of the present invention, the expression vector is a bacterial expression vector, such as pET.32m.3c.
[0017] In a fourth aspect, the present invention provides a strain containing the above-described expression vector.
[0018] In a preferred embodiment, the strain can be an E. coli strain, such as Rosetta (DE3) or BL21 (DE3), or BL21 pLysS.
[0019] In a fifth aspect, the present invention provides a method for preparing the DHX8 fusion protein, comprising the following steps:
[0020] 1) Amplify the nucleic acid sequence encoding the DHX8 fusion protein;
[0021] 2) The nucleic acid sequence is cloned into a prokaryotic expression vector;
[0022] 3) Transform the prokaryotic expression vector into E. coli strain;
[0023] 4) Inducing the expression of the DHX8 fusion protein, and
[0024] 5) Purify the DHX8 fusion protein.
[0025] In a specific embodiment of the present invention, the prokaryotic expression vector can be a bacterial expression vector, such as pET.32m.3c.
[0026] In a specific embodiment of the present invention, the E. coli strain can be Rosetta(DE3), BL21(DE3), or BL21pLysS.
[0027] In a specific embodiment of the invention, purification can be performed, for example, by affinity chromatography.
[0028] In a sixth aspect, the present invention provides the use of the DHX8 fusion protein in the preparation of formulations that untangle the double-stranded structure of oligonucleotides.
[0029] In a seventh aspect, the present invention provides the use of the DHX8 fusion protein in RNA modification and processing, preferably in its participation in mRNA splicing.
[0030] In an eighth aspect, the present invention provides the use of the DHX8 fusion protein in high-throughput screening of inhibitors of DHX8 helicase or ATP hydrolase activity.
[0031] Compared with existing technologies, this invention has the following beneficial effects. Specifically, the DHX8 fusion protein of this invention possesses ATP hydrolase and helicase activities, which can be used for DHX8 activity analysis. It is particularly beneficial for high-throughput screening of DHX8 protein inhibitors, intermolecular interactions, antibody and detection kit preparation, and other physiological and biochemical operations. Furthermore, it has high solubility, high expression efficiency, and a simple purification process. This invention expresses the DHX8 fusion protein using the E. coli expression system. Due to the rapid growth cycle and high efficiency of bacterial culture, sufficient quantities of DHX8 fusion protein can be prepared in a short time, making it suitable for high-throughput screening of DHX8 enzyme activity inhibitors. This overcomes the problem that the large molecular weight (1221 amino acids in total length) and complex spatial structure of natural DHX8 prevent its preparation by genetic engineering methods. This invention selects a portion of the natural human RNA helicase DHX8 using genetic engineering fusion protein technology and supplements it with sulfoxide-reductase proteins for prokaryotic expression of the fusion protein. Compared with the insect expression systems used in existing technologies, this invention offers advantages over other methods. The baculovirus expression system overcomes the drawbacks of complex construction, difficult purification process, and high cost. Attached Figure Description
[0032] Figure 1 The DHX8 gene map is shown, where DHX8 is the full-length gene sequence, the truncated DHX8 is the truncated gene sequence of this invention, and the truncated DHX8 Δ547 is the truncated gene sequence of existing literature.
[0033] Figure 2 and Figure 3 The construction map of E. coli recombinant plasmid pET.32m.3c-DHX8;
[0034] Figure 4 Image showing double enzyme digestion verification of recombinant plasmid pET.32m.3c-DHX8;
[0035] Figure 5 The chart shows the induced expression of the DHX8 fusion protein in Rosetta(DE3), with + indicating induction and - indicating no induction.
[0036] Figure 6 The results of nickel column purification of the DHX8 fusion protein;
[0037] Figure 7The results show the ATP helicase activity assay of the DHX8 fusion protein.
[0038] Figure 8 Results of helicase activity assay for the DHX8 fusion protein;
[0039] Figure 9 The amino acid sequence of the DHX8 fusion protein was compared with that of the native DHX8. Detailed Implementation
[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, as described in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 2012), or according to the conditions recommended in the manufacturer's instructions; the materials and reagents used, unless otherwise specified, are commercially available.
[0041] Example 1: Amplification of the DHX8 protein gene fragment
[0042] The human DHX8 wild-type nucleotide (NM_004941.3) and amino acid sequence (NP_004932.1) were obtained from the GenBank gene library. Using online primer design with SnapGene software, and employing a cDNA library from human skin fibroblasts (HSF, purchased from Shanghai Boson Biotechnology Co., Ltd.) as a template, the full-length human DHX8 wild-type target gene fragment was amplified. The N-terminus and C-terminus of the DHX8 protein were selectively truncated, with the N-terminus shortened by 234 amino acids and the C-terminus shortened by 263 amino acids, while retaining the core enzyme active region, resulting in the corresponding amino acid and nucleotide sequences. A detailed comparison of the truncated amino acids with the full-length sequence is shown below. Figure 2 As shown (DHX8 truncated). Primers containing restriction enzyme sites were designed based on the truncated nucleotide sequence. Using the full-length human DHX8 wild-type target gene fragment as a template, the truncated DHX8 target gene fragment was amplified by PCR.
[0043] The primers are shown in Table 1:
[0044] Table 1: Primer sequences
[0045] DHX8-F ATGCAGTTTGGTTGCTTTGTGCAGC DHX8-R TCAGCGCCGTCGGAAAGCTC DHX8 / BamHI-F GGGCCCGGATCCATGCGGAAGGACCGGGACAAATA DHX8 / NotI-R GAGTGCGGCCGCCATGGCTGTGATCAAAGTTT
[0046] The target gene fragment was obtained by PCR polymerase chain reaction, and a high-concentration fragment solution was obtained by using a rapid purification kit (Beijing TransGen Biotech Co., Ltd., #S20513). The PCR amplification reaction system is shown in Table 2.
[0047] Table 2: PCR amplification reaction system
[0048]
[0049] The PCR amplification program is as follows: 94℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 55-65℃ annealing for 15 s, 68℃ extension for 3 min, 33 cycles; 68℃ extension for 10 min, 4℃ to finish.
[0050] Example 2: Construction and Identification of Expression Plasmids
[0051] The vector pET.32m.3c (purchased from the BioVector plasmid vector strain cell protein antibody gene preservation center) was double-digested with restriction endonucleases BamHl / Notl (NEB, New England Biotechnology (Beijing) Co., Ltd.), and the vector fragment was purified by gel extraction using a gel DNA recovery kit (SimGen, Hangzhou Xinjing Biotechnology Reagent Development Co., Ltd., 2001050). Simultaneously, the truncated DHX8 protein gene fragment was double-digested with restriction endonucleases BamHl / Notl (NEB, New England Biotechnology (Beijing) Co., Ltd.), and the gene fragment was purified by gel extraction using a gel DNA recovery kit (SimGen, Hangzhou Xinjing Biotechnology Reagent Development Co., Ltd., 2001050). The purified gene fragment was ligated with the purified pET.32m.3c vector fragment using T4 DNA ligase (NEB, New England Biotechnology (Beijing) Co., Ltd., M0202V) overnight at room temperature. The specific reaction system is shown in Table 3. The prokaryotic expression plasmid construction map is shown below. Figure 2 and Figure 3 The connection system is as follows:
[0052] Table 3: Connection Reaction System
[0053] reaction system 20μL T4 DNA Ligase Buffer (10X) 2μL VectorDNA (5.8kb) 50ng Insert DNA (2.1kb) 93ng Nuclease-freewater to 20μL T4 DNA Ligase 1μL
[0054] Transformation: Mix 5 μL of the overnight ligation product with DH5α competent cells (Shanghai Angyu Biotechnology Co., Ltd.), incubate on ice for 30 min → 42℃ for 1 min → incubate on ice for 3 min, then mix with 900 μL of antibiotic-free LB medium, incubate at 37℃ and 200 rpm for 1 h, centrifuge to collect the bacteria, concentrate, resuspend and plate. Incubate overnight at 37℃.
[0055] The following day, single colonies were picked and cultured to the logarithmic growth phase. Recombinant plasmids were extracted using a plasmid miniprep kit (Tiangen Biotech, DP103). The recombinant plasmids were identified by double digestion with BamHCl / NotI. Recombinant plasmids that were correctly identified by double digestion were sequenced to confirm the correct insertion of the target gene sequence and ensure that the reading frame was completely correct.
[0056] Enzyme digestion identification results as follows Figure 4 As shown, BamHl / Notl double enzyme digestion identification indicated that 8-1 to 8-6 all carried the correct gene fragment (2.1k).
[0057] Example 3: Protein Expression and Purification
[0058] Small amount of induced expression
[0059] Transformation: Mix 1 μL of recombinant plasmid with 30 μL of E. coli Rosetta-(DE3) competent cells (Beyotime, Shenzhen Aidu Technology Co., Ltd., D1067S) for transformation (ice bath for 30 min - heat shock at 42℃ for 1 min - ice bath for 3 min); mix the product from the previous step with 700 μL of antibiotic-free LB medium, shake at 200 rpm for 1 h at 37℃, centrifuge at 4000 rpm for 1 min to collect the bacteria, resuspend the bacteria in 100 μL, plate the bacteria, and incubate the plates upside down in a 37℃ incubator overnight;
[0060] Induction by selection: Select large, easily pickable monoclonal strains and add them to 3 mL of LB medium containing 100 μg / mL ampicillin and 34 μg / mL chloramphenicol. Shake at 290 rpm and 37℃ until the logarithmic growth phase. Take 1 mL of the culture and add it to 250 μL of glycerol. Store at -80℃. Use 1 mL as the control group. Add 10 μL of 100 mM IPTG (Shanghai Aladdin Biochemical Technology Co., Ltd., isopropyl-β-D-thiogalactopyranoside, I104812) to 1 mL of the culture and continue to induce protein expression. Induce at 25℃ for 3-5 h.
[0061] Protein extraction: Centrifuge to collect bacterial culture, add 250 μL of PBS solution (with 1% protease inhibitor, Kailian Gene Technology Co., Ltd., HY-K0010), resuspend and mix well; sonicate to form a semi-transparent bacterial culture; and centrifuge at 4℃ for 10 min to collect the supernatant;
[0062] Take 20 μL of sample and mix it with loading buffer (250 mM Tris-HCl pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol and ddH2O), boil at 95℃ for 5 min, then load the sample onto a gel, stain with Coomassie Brilliant Blue for 1 h, and then destain. Small-scale induction is performed. Results are as follows. Figure 5 As shown, this indicates that the DHX8 fusion protein is expressed in a soluble manner.
[0063] Example 4: High-level protein expression
[0064] The E. coli Rosetta (DE3) strain with high induction efficiency was expanded to 500 mL LB medium. After the logarithmic phase, IPTG (Isopropyl-β-D-thiogalactoside, I104812, Shanghai Aladdin Biochemical Technology Co., Ltd.) was added to a final concentration of 1 mM. Protein expression was induced for another 4-5 h at 25 °C, and the bacterial culture was collected by centrifugation.
[0065] The expressed truncated DHX8 protein was purified using a nickel affinity chromatography column. E. coli cells were resuspended in lysis buffer (composition shown in Table 4) and sonicated at 15% power for 15-25 min until the culture was clear. The cells were then centrifuged at 10,000 rpm at 4°C for 30 min, and the supernatant was collected. The supernatant was mixed with His-tagged protein agarose purification resin (Yisheng Biotechnology (Shanghai) Co., Ltd., 20502ES50) activated on ice for 1 h, and inverted for 1 h to ensure sufficient binding between the resin and the protein. The protein was washed 5 times each with 5 volumes of wash buffer one (composition shown in Table 4) and wash buffer two (composition shown in Table 4) on a nickel column. Elution was performed using the nickel column; the composition of the eluent is shown in Table 4.
[0066] The eluted protein samples were identified by SDS-PAGE, and the results are as follows: Figure 6 As shown, a specific target protein band was observed at approximately 97 kDa. Using protein quantification reagents, the concentration of DHX8 fusion protein in the purified and eluted E1 tube reached 1.5 mg / mL, and the total yield of DHX8 fusion protein extracted in a 0.5 L bacterial culture system reached 1-3 mg.
[0067] Table 4: Solutions required for nickel column affinity chromatography
[0068] name Phosphate buffer (mM) Sodium chloride (mM) Imidazole (mM) Triton100 β-ME (mM) pyrolysis solution 50 150 25 1% 2 Wash solution 1 50 150 25 0.1% 1 Wash solution 2 50 500 25 0.1% 1 Elution solution 50 / 250 / 1
[0069] Example 5: ATPase activity detection
[0070] Biotin-labeled oligoDNA molecules anneal and pair with digoxigenin-labeled oligoDNA molecules to form a double-stranded DNA molecule with a 3'-protrusion. This double-stranded DNA molecule is mixed with the reaction solution and plated in a 96-well plate. The corresponding enzyme protein is added to induce an enzymatic reaction, consuming ATP. The concentration of ATP consumed by the enzyme reaction is detected using an ATP assay kit (Shanghai Beyotime Biotechnology Co., Ltd., S0026), based on the principle that luciferase catalyzes the production of fluorescence from luciferin requiring ATP for energy. Generally, the greater the decrease in chemiluminescence signal, the stronger the ATPase activity. Following this method, the ATPase activity of the DHX8 fusion protein was detected as follows:
[0071] 1. Preparation of DNA substrates: Two DNA primers with different substrate labels were designed and synthesized: biotin-labeled DNA: 5'-biotin-GCTGACCCTGCTCCCAATCGTAATCTATAGTGTCACCTA-3'; and digoxigenin-labeled DNA: 5'-DIG-CGATTGGGAGCAGGGTCAGC-3'. These two DNA oligomeric single-stranded molecules with different labels were resuspended at a 1:1 molar ratio and mixed in an annealing reaction solution (2 mM HEPES, pH 7.0, 0.05 M NaCl, 0.1 mM EDTA, and 0.01% (w / v) SDS). The reaction system was heated to 100 °C and maintained for 5 min, then cooled to 65 °C and maintained for 30 min. The DNA annealing reaction was set at 22 °C for 4 h. The final obtained DNA double-stranded molecules were diluted with deionized water to a final concentration of 2.5 ng / μL, aliquoted, and stored at -20 °C for later use.
[0072] 2. Sample reaction solution: Prepare enzyme reaction solution (25mM 4-MOPS, 5μM ATP, 2mM DTT, 3mM MnCl2, 100μg / mL BSA). Add 90μL of enzyme reaction solution, 2ng of DNA, and 4μL of helicase DHX8 (i.e., DHX8 fusion protein) to each well. Incubate at 37℃ for 1 hour.
[0073] 3. Preparation of ATP assay working solution: Mix the ATP assay solution and ATP assay reagent diluent from the ATP assay kit (Shanghai Beyotime Biotechnology Co., Ltd., S0026) at a ratio of 1:9. Add 100 μL of the ATP assay working solution to each well of a 96-well plate and incubate at room temperature for 5 min.
[0074] 4. Detection: Then, add 40 μL of the sample reaction solution (step 2) to the ATP detection working solution and mix thoroughly. Shake the plate for 1 min using a PerkinElmer multi-plate reader (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.), and then use a PerkinElmer multi-plate reader with chemiluminescence function (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.) to detect the RLU value and analyze the signal. The reading time is 5 s / well.
[0075] The results showed that the purified DHX8 fusion protein exhibited significant ATPase activity; specific data can be found in [link to data]. Figure 7 .Depend on Figure 7It can be seen that the luminescence signal of the experimental group of DHX8 fusion protein was significantly lower than that of the control group (no enzyme), and the difference in readings was obvious. It can be determined that DHX8 fusion protein consumed a large amount of ATP in the enzyme reaction solution, proving that DHX8 fusion protein has obvious ATPase activity.
[0076] The data in Table 5 show that the luminescence signal of the DHX8 fusion protein was significantly lower than that of the control group, with a P value < 0.001, indicating that the DHX8 fusion protein has significant ATP hydrolase activity. Its Z factor was 0.59, indicating a clear distinction between the signal and background in the DHX8 fusion protein group. The data are reliable and reproducible, and can be further optimized for high-throughput screening and research of DHX8 inhibitors.
[0077] Table 5: DHX8 fusion protein ATPase activity data
[0078] control group DHX8 fusion protein 4983143 2252117 4900723 2228959 5009650 2866680 mean 4964505 2449252 Standard deviation 46381 295318 p-value 0.0003 Zfactor 0.59
[0079] Example 6: Helicase Activity Detection
[0080] Biotin-labeled oligoDNA molecules anneal and pair with another digoxigenin-labeled oligoDNA molecule to form a double-stranded DNA molecule with a 3'-protrusion. This double-stranded DNA molecule is then plated on a 96-well plate with a neutral avidin attached to the bottom. After helicase reaction, the digoxigenin-labeled single-stranded DNA molecule dissociates from the plate. The helicase activity is then assessed by adding an alkaline phosphatase-tagged anti-digoxigenin secondary antibody and the alkaline phosphatase substrate CSPD to the 96-well plate and analyzing the chemiluminescent signals generated in each well. Generally, a greater decrease in chemiluminescent signal indicates stronger helicase activity. The helicase activity of the DHX8 fusion protein was tested using this method as follows:
[0081] 1. Dilute avidin (Thermo Fisher Scientific, 31000) with 0.5M Na2CO3 (pH=9.3) to 15μg / mL, 100μL per well, and incubate overnight at 4°C.
[0082] 2. Discard the avidin that has been incubated overnight, wash three times with PBS buffer, pat dry the remaining buffer on a paper towel, and let it air dry at room temperature for 15 minutes.
[0083] 3. Incubate each well with 100 μL of 0.1% BSA (bovine serum albumin, dissolved in PBS) at room temperature for 1 h.
[0084] 4. After washing three times with PBS buffer, pat dry any remaining buffer on a paper towel and allow to air dry at room temperature for 15 minutes.
[0085] 5. Dissolve the annealed DNA (prepared in Example 5) in 1M PBS / 1M NaCl, add 4 ng DNA (75 μL) to each well of a 96-well plate, and incubate at room temperature for 2 h.
[0086] 6. Wash twice with PBS buffer, and once with 200 μL of 50 mM Tris-HCl (pH 7.5) containing 50 mM NaCl.
[0087] 7. Prepare the reaction solution (25mM 4-MOPS (pH 7.0), 5mM ATP, 2mM DTT, 3mM MnCl2, and 100μg / mL BSA). Add 95μL of the reaction solution and 5μL of helicase DHX8 (i.e., DHX8 fusion protein) to each well. No enzyme is added to the control group. React at 37℃ for 60 min.
[0088] 8. After the enzyme reaction is complete, wash twice with 150mM NaCl (200μL / time), and then air dry at room temperature for 15 minutes.
[0089] 9. Wash each well with cleaning solution (0.1M maleic acid, 0.15M NaCl, 0.3% Tween 20 (pH 7.5)) for 5 min, 200 μl per well.
[0090] 10. Sealing: Add 300 μL of 10% BSA (dissolved in a mixture of 0.1 M maleic acid and 0.15 M NaCl, pH 7.5) to each well and seal for 30 min.
[0091] 11. Remove the blocking solution, add 20 μL of anti-digoxigenin secondary antibody-AP (Ms mAb to Digoxigenin[21H8](AP), Beckman Coulter Life Sciences (Shanghai) Co., Ltd., diluted 1:5000 with blocking solution) to each well, and incubate at room temperature for 30 min.
[0092] 12. Wash twice with buffer solution (containing 0.1M Tris-HCl and 0.1M NaCl, pH 9.5), 100 μL each time.
[0093] 13. Add 20 μL of detection solution to each well and let stand for 5 min. Detection solution preparation: Mix buffer (containing 0.1 M Tris-HCl, 0.1 M NaCl, pH 9.5) at a ratio of 20:1 with 25 mM chemiluminescent substrate CSPD. TM Substrate (Thermo Fisher Scientific, T2141).
[0094] 14. The RLU value was detected and the signal was analyzed using a PerkinElmer multi-microplate reader with chemiluminescence function (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.). The reading time was 10 s / well.
[0095] Experimental results showed that the purified DHX8 fusion protein exhibited significant helicase activity, such as... Figure 8 As shown. By Figure 8 It can be seen that, compared with the control group, the luminescence signal of the experimental group of DHX8 fusion protein was significantly reduced, which indicates that Trunc-DDX46 protein catalyzes a large amount of aoligo-DNA helicase reaction, proving that Trunc-DDX46 has significant helicase activity.
[0096] The data in Table 6 show that the luminescence signal of the DHX8 fusion protein group was significantly lower than that of the control group (P < 0.001), indicating a significant difference between the two groups and demonstrating that the DHX8 fusion protein possesses significant helicase activity. Its Z-factor was 0.45, indicating a clear distinction between the signal and background in the DHX8 fusion protein group. Furthermore, the data showed stable reliability and reproducibility, allowing for further optimization for high-throughput screening and research of DHX8 protein inhibitors.
[0097] Table 6: DHX8 fusion protein helicase activity data
[0098] control group DHX8 fusion protein 5865 2526 5160 2403 6076 2659 5606 2601 6253 2787 5475 2852 average value 5739.17 2638.00 Standard deviation 404.05 165.88 p-value 0.0000 Zfactor 0.45
[0099] Based on the above experimental results, it can be seen that the insect expression system... Compared with baculovirus expression systems, the purification of recombinant DHX8 proteins through an E. coli expression system has significant advantages, as shown in Table 7.
[0100] Table 7: Production Costs of DHX8 Fusion Protein
[0101]
Claims
1. A DHX8 fusion protein possessing ATP hydrolase and helicase activities, characterized in that, The amino acid sequence of the DHX8 fusion protein is shown in SEQ ID NO:
1.
2. Nucleic acid encoding the DHX8 fusion protein of claim 1.
3. The nucleic acid according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:
2.
4. An expression carrier, characterized in that, The expression vector contains the nucleic acid as described in claim 3.
5. The expression vector according to claim 4, characterized in that, The expression vector is a bacterial expression vector.
6. The expression vector according to claim 5, characterized in that, The bacterial expression vector is pET.32m.3c.
7. A bacterial strain, characterized in that, The strain contains the expression vector as described in claim 5.
8. The strain according to claim 7, characterized in that, The strain is E. coli strains.
9. The strain according to claim 8, characterized in that, The strains are Rosetta (DE3), BL21 (DE3), or BL21 pLysS.
10. The method for preparing the DHX8 fusion protein according to claim 1, characterized in that, The method includes the following steps: 1) Amplify the nucleic acid sequence encoding the DHX8 fusion protein; 2) The nucleic acid sequence is cloned into a prokaryotic expression vector; 3) Transform the prokaryotic expression vector into... E. coli In the strains; 4) Inducing the expression of the DHX8 fusion protein, and 5) Purify the DHX8 fusion protein.
11. The method according to claim 10, characterized in that, The prokaryotic expression vector is a bacterial expression vector.
12. The method according to claim 11, characterized in that, The bacterial expression vector is pET.32m.3c.
13. The method according to claim 10, characterized in that, The E. coli The strains were Rosetta (DE3), BL21 (DE3), or BL21 pLysS.
14. Use of the DHX8 fusion protein of claim 1 in the preparation of formulations that untangle oligomeric DNA double-stranded structures.
15. The use of the DHX8 fusion protein of claim 1 in DNA modification and processing.
16. The application according to claim 15, characterized in that, The application is in the process of participating in mRNA splicing.
17. Use of the protein of claim 1 in high-throughput screening of DNA helicases or ATP hydrolase inhibitors.
Citation Information
Patent Citations
Allogeneic cell compositions and methods of use
CN113383018A
Enzyme combination product for nucleic acid isothermal amplification reaction and application thereof
CN116411049A