Application of beta-hydroxybutyric acid in preparation of medicine for preventing and / or treating osteoporosis

Abstract

The invention relates to the technical field of medicine, in particular to application of beta-hydroxybutyric acid in preparation of medicine for preventing and / or treating osteoporosis, the osteoporosis comprises postmenopausal osteoporosis and diabetic osteoporosis due to estrogen deficiency, the administration concentration of the beta-hydroxybutyric acid is 150mM, and the administration concentration of the beta-hydroxybutyric acid is 10mM. According to the application of the beta-hydroxybutyric acid in preparing the medicine for inhibiting osteoclast differentiation or osteoclast formation, the beta-hydroxybutyric acid inhibits osteoclast precursor cells from being differentiated into osteoclasts, and the administration concentration of the beta-hydroxybutyric acid is 10 mM; the invention proves that the beta-hydroxybutyric acid improves bone microstructures of OVX mice and db / db mice, inhibits osteoclast differentiation and reduces bone resorption, and provides a new target for prevention and treatment of osteoporosis.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to application of beta-hydroxybutyric acid in preparing drugs for preventing and / or treating osteoporosis. Background Art

[0002] With the aging of the population and changes in lifestyle, osteoporosis (OP) has become a global public health problem, characterized by decreased bone mass and destruction of bone microstructure. OP is divided into two categories: primary and secondary. Postmenopausal osteoporosis (PMOP) is one of the most common forms of primary OP, which is caused by increased bone resorption due to estrogen deficiency, disrupting normal bone remodeling. Epidemiological data show that diabetic patients suffer from damage to the skeletal system and increased risk of fractures due to long-term exposure to a high-sugar environment. Therefore, there is an urgent need for alternative methods to promote bone health.

[0003] As a therapeutic diet, the biggest feature of the ketogenic diet (KD) is that it limits the intake of carbohydrates and increases the intake of fat. Ketone bodies replace glucose to provide energy to the whole body, effectively reducing weight, lowering blood sugar, and improving insulin resistance. The impact on bones is still controversial. β-Hydroxybutyrate (BHB) is the main component of ketone bodies. When insulin is deficient, excessive production of BHB can induce ketoacidosis in diabetic patients. However, appropriate supplementation of BHB or the increase in BHB levels induced by fasting have a protective effect on the body.

[0004] However, no studies have reported whether BHB acts on osteoclasts (OCs) to regulate bone loss in PMOP and diabetic osteoporosis (DOP). Summary of the invention

[0005] In order to solve the above technical problems, an embodiment of the present invention provides the use of β-hydroxybutyric acid in the preparation of a drug for preventing and / or treating osteoporosis.

[0006] To achieve the above object, the embodiments of the present invention adopt the following technical solutions:

[0007] On the one hand, use of β-hydroxybutyric acid in the preparation of a drug for preventing and / or treating osteoporosis.

[0008] In some embodiments, the osteoporosis includes estrogen-deficient postmenopausal osteoporosis and diabetic osteoporosis.

[0009] In some embodiments, the β-hydroxybutyrate is administered at a concentration of 150 mM.

[0010] In another aspect, the present invention provides a use of β-hydroxybutyric acid in the preparation of a drug for inhibiting osteoclast differentiation or inhibiting osteoclast formation.

[0011] In some embodiments, the β-hydroxybutyrate inhibits the differentiation of osteoclast precursor cells (RAW264.7 cells) into osteoclasts.

[0012] In some embodiments, the β-hydroxybutyrate is administered at a concentration of 10 mM.

[0013] In some embodiments, the above-mentioned drug includes a pharmaceutical preparation prepared with an effective amount of β-hydroxybutyric acid as an active ingredient and a pharmaceutically acceptable carrier and / or excipient.

[0014] An effective amount refers to the amount of a drug, compound, or pharmaceutical composition necessary to obtain any one or more beneficial or desired therapeutic results. Beneficial or desired results include: clinical improvement (such as reducing morbidity, reducing mortality, improving one or more symptoms), reducing severity, delaying the onset of symptoms (including symptoms or their complications, intermediate pathological phenotypes presented during the development of the disease, biochemistry, histology, and / or behavioral symptoms). The preparation can be an injection, spray, aerosol, nasal drops, oral preparation, a dosage form suitable for mucosal administration, and the route of administration to the subject includes, but is not limited to: intramuscular, intravenous, subcutaneous, intradermal, oral, intranasal, respiratory, transmucosal, sublingual, parenteral.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention uses bilateral ovariectomy (OVX) to construct an estrogen-deficient PMOP mouse model, and db / db male mice to replicate a DOP mouse model. From different OP models, it was confirmed that BHB intervention reduced fasting blood glucose and insulin levels in db / db mice, improved glucose metabolism and insulin resistance; significantly increased the levels of type I procollagen N-terminal propeptide (PINP) and bone-specific alkaline phosphatase (BALP) in OVX mice and db / db mice, and reduced the levels of tartrate-resistant acid phosphatase 5b (TRACP 5b) and type I collagen C-terminal peptide (CTX-I). The results showed that BHB upregulated bone formation and downregulated bone resorption. The bone density of mice in the drug-treated group increased, the arrangement of trabeculae was regular, the fracture defects were improved, the number of OCs decreased, and the expression of OCs differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP decreased. This shows that BHB improves the bone microstructure of OVX mice and db / db mice and reduces bone loss by inhibiting the generation of OCs.

[0017] (2) In vitro experiments further confirmed that BHB inhibited the expression of OCs differentiation-related marker proteins and mRNA, inhibited the differentiation of RAW264.7 cells into OCs and the formation of F-actin rings, and reduced the nuclear translocation of NFATc1, indicating that BHB has the activity of inhibiting OCs bone resorption in vitro.

[0018] In general, the present invention confirms that BHB improves bone microstructure in db / db mice and OVX mice, inhibits OCs differentiation, and reduces bone resorption, providing a new target for the prevention and treatment of OP. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a diagram showing the DXA analysis results of bilateral femurs of OVX mice after administration of BHB provided in the examples of the present application;

[0020] Figure 2 The 3D reconstructed image of the trabecular bone of OVX mice after BHB administration, the coronal CT image of the femur, the cross-sectional CT image of the distal femur, and the quantitative analysis graph of trabecular bone related parameters provided in the examples of the present application;

[0021] Figure 3 This is a graph showing the results of Elisa assay for detecting the levels of serum bone formation markers (PINP, BALP) and bone resorption markers (TRACP 5b, CTX-I) in OVX mice after BHB administration provided in the examples of the present application;

[0022] Figure 4 This is a diagram showing the results of HE staining and TRAP staining analysis of the distal femur of OVX mice after BHB administration provided in the examples of the present application;

[0023] Figure 5 A schematic diagram of the results of Western Blot detection of protein expression levels of OCs differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP in bone tissue of OVX mice after BHB administration provided in the examples of the present application;

[0024] Figure 6 A comparison of fasting blood glucose and insulin levels in db / db mice after administration of BHB provided in the examples of the present application;

[0025] Figure 7 This is a diagram showing the DXA analysis results of bilateral femurs of db / db mice after administration of BHB provided in the examples of the present application;

[0026] Figure 8 The 3D reconstructed image of trabecular bone of db / db mice after BHB administration, the coronal CT image of the femur, the cross-sectional CT image of the distal femur, and the quantitative analysis graph of trabecular bone related parameters provided in the examples of the present application;

[0027] Fig. 9 This is a graph showing the results of Elisa assay for detecting the levels of serum bone formation markers (PINP, BALP) and bone resorption markers (TRACP 5b, CTX-I) in db / db mice after BHB administration provided in the examples of the present application;

[0028] Fig.10 This is a diagram showing the results of HE staining and TRAP staining analysis of the distal femur of db / db mice after BHB administration provided in the examples of the present application;

[0029] Fig.11 The CCK-8 assay provided in the examples of the present application detected the effects of different concentrations of BHB on the viability of RAW264.7 cells;

[0030] Fig.12 This is a result diagram of the TRAP staining provided in the embodiment of the present application to detect the formation of OCs after BHB intervention;

[0031] Fig.13 A schematic diagram of the results of Western Blot and qRT-PCR detection of protein and mRNA expression levels of OCs differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP after BHB intervention provided in the examples of the present application;

[0032] Fig.14 This is a graph showing the results of phalloidin staining and immunofluorescence detection of F-actin ring formation and nuclear translocation of NFATc1 after BHB intervention provided in the examples of the present application. DETAILED DESCRIPTION

[0033] The following will be combined with the accompanying drawings to clearly and completely describe the technical solutions in some embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all the embodiments. Based on the embodiments provided by the present disclosure, all other embodiments obtained by ordinary technicians in this field belong to the scope of protection of the present disclosure.

[0034] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods. Sodium β-hydroxybutyrate (Sodium 3-hydroxybutyrate) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Cat# BD13033) and dissolved in double distilled water to obtain a BHB-containing aqueous solution.

[0035] 1. Experimental Methods

[0036] Example 1: BHB can improve bone loss in two osteoporosis model mice

[0037] All experimental mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. and were raised in an SPF animal laboratory. They were given free access to water and food and maintained under normal conditions: temperature 22±2℃, relative humidity 55±5%, light / dark cycle 12 hours, and were divided into experimental groups after 7 days of adaptive feeding. The 60Kcal% high-fat feed used in the experiment was purchased from Research Diets, and the ordinary feed was purchased from Chengdu Dashuo Company.

[0038] 1. Establishment of the Ovariectomy (OVX) Mouse Model

[0039] Fifteen 10-week-old healthy C57BL / 6 female mice were fasted and deprived of water for 4 hours before surgery. They were anesthetized by intraperitoneal injection of 1% sodium pentobarbital solution at a dose of 50 mg / kg and randomly divided into 3 groups, 5 mice in each group. The groups were set as sham group (Sham), OVX group (OVX), and OVX+β-hydroxybutyrate group (OVX+BHB). The mice were placed in a prone position, their limbs were fixed, the hair on both sides of the back was removed, iodine was disinfected, and sterile drapes were laid. A 1-2 cm incision was made through the bilateral costovertebral angles of the back, and the skin, fascia, and muscle were cut or bluntly separated in turn. After separating the fat mass, glucose-like red tissue was visible, which was the ovary. The ovary was removed after ligating the junction between the fallopian tube and the ovary. The sham group removed adipose tissue of similar weight to the ovary. After ovariectomy and sham surgery, the remaining tissues were put back in place, sutured in layers, and the surgical area was disinfected. The mice were placed in a warm and comfortable environment after surgery and waited for awakening. After the mice woke up, they were put back into the cage and given penicillin to prevent infection depending on the incision. Drug intervention began one week after surgery, and the OVX+BHB group freely drank a BHB aqueous solution containing a final concentration of 150 mM. The intervention lasted for 16 weeks, and mice in each group were fed with ordinary feed.

[0040] 2. Establishment of diabetic osteoporosis (DOP) model in mice

[0041] Ten 8-week-old healthy db / db male mice were fed a high-fat diet to establish a DOP model and randomly divided into two groups, with 5 mice in each group. The groups were set as DOP group and DOP+BHB group. Mice in the DOP+BHB group were allowed to freely drink a BHB aqueous solution with a final concentration of 150mM for 12 consecutive weeks. Five wild-type mice from the same litter were set as the normal control group (NC group) and given a normal diet. After the drug intervention, tail vein blood was collected to detect the fasting blood glucose level of the mice.

[0042] After the intervention in Example 1 is completed, follow-up treatment is performed:

[0043] 1% sodium pentobarbital solution 50 mg / kg was injected intraperitoneally, and after the mice were anesthetized, bilateral femur DXA detection was performed. After the scan was completed, blood was collected through the eye sockets and the mice were killed by cervical dislocation. After the fresh blood was allowed to stand for 1 hour, it was placed in a centrifuge to separate the serum (3000rpm / min, 10min) after the blood coagulated. The serum was divided into new EP tubes and stored at -80℃ for standby use. The ELISA kit of Andygene Company in Beijing, China was used to detect the levels of TRACP 5b, CTX-I, BALP, PINP and insulin. The lower limbs of the mice were separated, and the soft tissues such as muscles on the surface of the femur were removed. The left femur was stored in liquid nitrogen for Western Blot experiments; the right femur was fixed in 4% paraformaldehyde solution for 24 hours, and then stored in 70% alcohol for micro-CT scanning of the microstructural changes of the distal femur. After completing the micro-CT scan, the specimens were placed in 10% EDTA solution and decalcified on a shaker at room temperature for 10-12 weeks to prepare paraffin specimens for HE and TRAP staining.

[0044] Bilateral femoral DXA bone density test

[0045] The mice were anesthetized, and the limbs and tail of the mice were fixed with titanium alloy splints. The scanning area (ROI) was adjusted and fixed by infrared rays. The scanning program was set to the small animal whole body scanning mode, and the bilateral femurs (including Ward's triangle) were selected as the ROI area for data analysis. The mean value obtained was the bone mineral density (BMD) value of the mouse.

[0046] Micro-CT scan of the distal femur

[0047] Scanning was performed using SCANCO MEDICALAGμCT50, with scanning parameters set to 15μm resolution, 70kVp, 200μA, and a scanning speed of 1*300ms. The scanner-specific program SCANCO Medical Evaluation was used to locate and analyze the distal femur, with a total of 1800-2000 layers of bone tissue as the cancellous bone region of interest (ROI), and the VOI 29×29×29μm3 bone tissue was analyzed. The scan results were output for bone volume fraction (bone volume / total volume, BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular spacing (Tb.Sp), and 3D-Display was selected to reconstruct the bone tissue microstructure.

[0048] HE staining

[0049] (1) Tissue sectioning: The femur wax block was sliced ​​serially with a thickness of 4 μm and placed in a 37°C constant temperature oven for baking overnight.

[0050] (2) Dewaxing: Place the sections in an environmentally friendly transparent dewaxing solution for 30 min.

[0051] (3) Hydration: Hydration with gradient alcohol, the concentration is 100% → 95% → 90% → 80%, each time for 10 minutes, and rinse thoroughly with tap water.

[0052] (4) Staining: Hematoxylin staining for 5 min → rinse with tap water for 5 min → 1% saline-alcohol differentiation for 10 s → rinse with tap water for 5 min → eosin staining of cytoplasm for 5 min → rinse with tap water for 5 min.

[0053] (5) Dehydration: 80% alcohol for 2 min → 90% alcohol for 2 min → 95% alcohol for 2 min → 100% alcohol for 2 min → 100% alcohol for 5 min → xylene I for 5 min → xylene II for 5 min.

[0054] (6) Sealing and photographing: After the slices are dried, seal them with neutral gum, observe the staining results under a microscope and take photos.

[0055] Tissue TRAP staining

[0056] (1) The steps of tissue sectioning, dewaxing, and hydration are the same as those for HE staining.

[0057] (2) Cover the tissue with double distilled water and incubate in a 37°C constant temperature oven for 2 h.

[0058] (3) After incubation, pour off the double distilled water, add the prepared TRAP staining working solution to cover the tissue, and continue to place in a 37°C constant temperature oven away from light for 30 minutes.

[0059] (4) Discard the TRAP staining working solution, rinse with tap water, stain the nucleus with hematoxylin for 2 minutes, and rinse repeatedly with tap water; differentiate with 1% hydrochloric acid alcohol for 2-3 seconds, use lithium carbonate saturated solution for 1 minute, and rinse repeatedly with tap water; dehydrate with gradient alcohol in sequence (the concentration is vaguely 80% for 2 minutes → 85% for 2 minutes → 90% for 2 minutes → 95% for 2 minutes → 100% for 2 minutes → 100% for 5 minutes).

[0060] (5) Sealing and photographing: After the slices are dried, seal them with neutral gum, observe the staining results under a microscope and take photos.

[0061] Tissue protein extraction and Western Blot experiment:

[0062] The tissue was homogenized according to 100 mg + 1000 μL RRIPA lysis buffer (containing 1% PMSF) (P0013B, Shanghai Bio-Tech Biotechnology Co., Ltd.), centrifuged at 12000 rpm for 15 min, the supernatant was collected and added with 5X loading buffer, and heated at 100° C. for 10 min to denature the protein.

[0063] After 12.5% ​​SDS-PAGE gel electrophoresis, the membrane was transferred to PVDF membrane, blocked with 5% BSA at room temperature for 2 hours, and incubated with primary antibodies at 4°C overnight with shaking. The primary antibody product numbers are: NFATc1 (SC-7294, Santa Cruz, USA), c-Fos (AF6489, Beyotime, China), TRAP (ab191406, abcam, USA), CTSK (AF6597, Beyotime, China), MMP-9 (ab283575, abcam, USA). After that, the membrane was washed three times with PBST and replaced with the corresponding secondary antibody, at room temperature for 1 hour, and then washed again with PBST and developed, and then placed in a dark box filled with chemiluminescent solution and soaked for 1-2 minutes, and developed in a chemiluminescent machine. The images were collected and saved, and the protein expression was quantitatively analyzed using Image J software.

[0064] Example 2: BHB can inhibit osteoclast differentiation

[0065] 1. Cell Viability Assay

[0066] Mouse osteoclast precursor cell line RAW264.7 cells were used, and 5000 cells / well were inoculated in a 96-well plate containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin and DMEM culture medium, and cultured in a 37°C, 5% CO2 incubator, and the medium was changed every day. After the cells adhered to the wall and grew, different concentrations of BHB (0, 2, 4, 6, 8, 10, 12, 14, 16mM) were added to the experimental group, and a blank well (culture medium without cells) was set, and 100μL of sterile PBS was added to each well to prevent evaporation, and the culture was continued for 5 days, and 10μL of CCK8 solution was added to each well, and the well was returned to the incubator for incubation for 4h. After the incubation, the 96-well plate was taken out, and the OD value of each well was measured at a wavelength of 450nm using an enzyme reader, and the cell viability was calculated according to the formula.

[0067] 2. Cell protein extraction and Western blot analysis

[0068] Select RAW264.7 cells within 10 generations, which are round and transparent, have good refractive index, and have no pseudopodia. Inoculate 50,000 cells / well in a 6-well plate and wait for the cells to adhere to the wall overnight. Set up groups: negative control group (culture medium is MEM Alpha complete culture medium), positive control group (culture medium is MEM Alpha complete culture medium + 100ng / mL RANKL), and drug treatment group (MEM Alpha complete culture medium + 100ng / mL RANKL + 10mM BHB). Change the medium every other day and collect samples after 5 days. Aspirate the culture medium, wash 3 times with PBS, add RIPA lysis buffer containing 1% PMSF, scrape the cells with a cell scraper, break them with an ultrasonic disruptor, and lyse them on ice for 20min. Centrifuge at 4℃12000rpm / min for 10min, collect the supernatant into an EP tube, add 5× loading buffer, heat at 100℃ for 10min to denature the protein, and the rest of the steps are the same as tissue SDS-PAGE electrophoresis.

[0069] 3. Cell RNA Extraction and RT-qPCR Detection

[0070] Total RNA of OCs was extracted, the culture medium was removed, and the cells were washed three times with PBS. According to the experimental protocol in the kit instructions, 1000 μL Trizol (15596018CN, Thermo Fisher Scientific, USA) was added, and the cells were repeatedly blown to lyse the cells (clear enough), and the RNA was reverse transcribed into cDNA. RT-qPCR was used to determine the expression of genes related to OCs differentiation. The specific primers for OCs-related genes used in this experiment are listed below:

[0071] Gene ForwardPrimer ReversePrimer GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA NFATc1 GGTGCCTTTTGCGAGCAGTATC CGTATGGACCAGAATGTGACGG c-Fos GGGAATGGTGAAGACCGTGTCA GCAGCCATCTTATTCCGTTCCC MMP-9 GCTGACTACGATAAGGACGGCA TAGTGGTGCAGGCAGAGTAGGA CTSK AGCAGAACGGAGGCATTGACTC CCCTCTGCATTTAGCTGCCTTTG TRAP GCGACCATTGTTAGCCACATACG CGTTGATGTCGCACAGAGGGAT

[0072] 4. TRAP and Phalloidin Staining of Cells

[0073] RAW264.7 cells were inoculated at 10,000 cells / well in a 24-well plate and allowed to adhere overnight. Groups were set up, with 3 replicates in each group. After 5 days, the cell culture medium was removed, 4% paraformaldehyde was added for fixation for 15 minutes, and the cells were washed 3 times with distilled water. 0.2% TritonX-100 solution was added to cover the cells for membrane permeabilization for 20 minutes, and then washed 3 times with distilled water. TRAP working solution was added to the cell well plate to cover the cells, and the cells were reacted in a 37°C constant temperature oven away from light for 30 minutes. After washing 3 times with distilled water, the cells were observed under a microscope and photographed.

[0074] After the cell intervention, fix and permeabilize according to the TRAP staining procedure, and then wash with PBS three times. Add phalloidin staining reagent to each slide and incubate at room temperature in the dark for 1 hour. Wash with PBS three times, add DAPI containing anti-fluorescence quencher and seal the slide. After drying in the dark, observe and take pictures under a microscope.

[0075] 5. Immunofluorescence detection of NFATc1 expression

[0076] Place the cell slides in a 24-well plate, set up groups, stimulate for 48 hours, fix and permeabilize in turn, and wash with PBS three times. Add 10% goat serum and block at room temperature for 2 hours. Add primary antibody and incubate overnight in a 4°C refrigerator. The next day, wash with PBS three times, add fluorescent secondary antibody, and incubate at room temperature in the dark for 1 hour. Wash with PBS three times, add DAPI containing anti-fluorescence quencher to counterstain and seal the slides. After drying in the dark, observe under a microscope and take pictures.

[0077] 6. Statistical methods

[0078] GraphPadPrism 8.0.2 software was used to analyze the data, and the data were expressed as mean±SD. One-way ANOVA was used to compare the differences among groups, and p<0.05 indicated that the difference was statistically significant.

[0079] 2. Experimental Results

[0080] 1. BHB increases BMD and improves bone microstructure in OVX and db / db mice

[0081] In order to clarify the effect of BHB on the whole body bone mass of OVX and db / db mice, the femoral BMD was detected by DXA, MicroCT scanning and three-dimensional reconstruction, and the bone microstructure parameters were analyzed. The DXA test results showed that the BMD of OVX and db / db mice increased after BHB administration ( Figure 1 , Figure 7 ), and the bone loss of bilateral femurs was improved. Micro-CT 2D / 3D reconstruction images showed that the number of trabeculae in OVX and db / db mice increased and the structure became compact after BHB administration ( Figure 2 , Figure 8 ). Further analysis of bone microstructure parameters revealed that compared with the model group, BHB intervention increased BV / TV, Tb.N, and Tb.Th, and reduced Tb.Sp( Figure 2 , Figure 8 ). The above results show that BHB can increase bone mass and improve bone microstructure in mice.

[0082] 2. Effects of BHB on glucose metabolism in db / db mice and on bone turnover markers in OVX and db / db mice

[0083] ELISA was used to detect the changes in the levels of PINP, BALP, TRACP 5b and CTX-I in the serum of OVX mice after 16 weeks of administration and db / db mice after 12 weeks of administration. The results showed that the expression of bone formation markers PINP and BALP in serum was significantly higher than that in the model group, while the expression of bone resorption markers TRACP 5b and CTX-I was significantly lower than that in the model group ( Figure 3 , Fig. 9 ). Fasting blood glucose and insulin levels in db / db mice were also tested, and the levels were significantly reduced after BHB treatment ( Figure 6 ). These results suggest that BHB upregulates bone formation, downregulates bone resorption, and improves glucose metabolism and insulin resistance.

[0084] 3. BHB prevents trabecular bone loss and inhibits osteoclast formation in vivo in OVX and db / db mice

[0085] The effect of BHB on the femoral pathological morphology of OVX and db / db mice was further studied. HE staining showed that compared with the model group, the number of trabeculae in the BHB-treated group increased, the arrangement was regular, the fracture defects were improved, and the number of adipocytes did not increase ( Figure 4 , Fig.10 ), improving bone loss. TRAP staining results showed that the number of OCs in the BHB-treated mice decreased ( Figure 4 , Fig.10 ). Western Blot further verified that BHB significantly downregulated the expression of OCs differentiation-related markers NFACTc1, c-Fos, MMP-9, CTSK, and TRAP ( Figure 5 The above results suggest that BHB intervention can reduce the number of OCs, which may be related to the fact that BHB alleviates bone loss in OVX and db / db mice.

[0086] 4. Cell proliferation function detection

[0087] The results of CCK-8 assay showed that compared with the blank control group, BHB at a concentration of 1-10 mM had no significant effect on cell viability. When the concentration reached 12 mM, the cell survival rate was significantly reduced, and the difference was statistically significant ( Fig.11 ), so 10mM was selected as the optimal intervention concentration.

[0088] 5. BHB inhibits RANKL-mediated osteoclastogenesis in vitro

[0089] RANKL was used to induce RAW264.7 cells to establish an in vitro OCs differentiation system. TRAP staining showed that BHB inhibited the differentiation of RAW264.7 cells into OCs, and the number of OCs was significantly reduced ( Fig.12 ). Western Blot and qRT-PCR assays showed that BHB intervention significantly inhibited the expression of OCs differentiation-related markers NFATc1, c-Fos, MMP-9, CTSK, TRAP protein and mRNA ( Fig.13 ). Furthermore, fluorescence staining also showed that BHB inhibited the formation of F-actin ring and reduced the nuclear translocation of NFATc1 ( Fig.14 ).

[0090] In summary, BHB can improve the bone microstructure of ovariectomized postmenopausal osteoporosis mice and diabetic osteoporosis mice by increasing the bone density of mouse femur and regulating the changes of bone parameters such as BV / TV, Tb.N, Tb.Th and Tb.Sp. In addition, BHB significantly inhibited the in vitro transcription of NFATc1 and c-Fos, reduced the expression of osteoclast-specific genes MMP-9, CTSK, and TRAP, inhibited the transformation of RAW264.7 cells into osteoclasts, and effectively inhibited the fusion and bone resorption of osteoclasts. Therefore, BHB has great potential as an effective drug for inhibiting osteoclasts in the prevention and treatment of osteoporosis.

[0091] In the description of this specification, specific features, structures, materials or characteristics may be combined in an appropriate manner in any one or more embodiments or examples.

[0092] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Use of β-hydroxybutyric acid in the preparation of drugs for preventing and / or treating osteoporosis.

2. The use according to claim 1, characterized in that: The osteoporosis includes estrogen-deficient postmenopausal osteoporosis and diabetic osteoporosis.

3. The use according to claim 1, characterized in that: The administration concentration of β-hydroxybutyrate is 150 mM.

4. The use of β-hydroxybutyric acid in the preparation of drugs for inhibiting osteoclast differentiation or inhibiting osteoclast formation.

5. The use according to claim 4, characterized in that: The β-hydroxybutyrate inhibits the differentiation of osteoclast precursor cells into osteoclasts.

6. The use according to claim 5, characterized in that: The β-hydroxybutyrate administration concentration is 10 mM.

Images